ID: 1166326717

View in Genome Browser
Species Human (GRCh38)
Location 19:42055359-42055381
Sequence CTCTGCGCGTAGAAGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166326713_1166326717 21 Left 1166326713 19:42055315-42055337 CCTGTGTGGACACATCTGACTGG 0: 1
1: 0
2: 0
3: 17
4: 124
Right 1166326717 19:42055359-42055381 CTCTGCGCGTAGAAGTGTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1166326712_1166326717 22 Left 1166326712 19:42055314-42055336 CCCTGTGTGGACACATCTGACTG 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1166326717 19:42055359-42055381 CTCTGCGCGTAGAAGTGTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166326717 Original CRISPR CTCTGCGCGTAGAAGTGTCT TGG Intronic
913033545 1:114937083-114937105 CTTTTCGCTTAGAATTGTCTTGG - Intronic
923292391 1:232558889-232558911 CTCTCAGGGTAGAAGTGTCATGG + Intronic
1065088474 10:22204515-22204537 CTCTGGGAGTAGAAATGTATTGG + Intergenic
1067662535 10:48247206-48247228 CTCTGGGCAGAGAAGTGACTGGG + Intronic
1068116199 10:52740158-52740180 CTCTGGGCAAAGAGGTGTCTTGG - Intergenic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535864 10:131176945-131176967 CTCTGTGTGTACACGTGTCTTGG - Intronic
1086455782 11:86957124-86957146 CTCTGTGCCTAGAACTGTGTTGG + Intergenic
1087163407 11:94973561-94973583 CTCTGGGCGCAGAGGTTTCTGGG - Exonic
1089129616 11:116201373-116201395 CTCTGCACATAGACGTGACTAGG - Intergenic
1090190544 11:124763510-124763532 CTCTGCGGGCAGAGCTGTCTGGG + Intergenic
1090638341 11:128707769-128707791 CTCTGGGCAGAGAAGAGTCTGGG - Intronic
1099531217 12:83783769-83783791 CTGTGCTCTTAGAAGTGTATAGG - Intergenic
1116224014 14:42124956-42124978 CTCTGTGCTTAGAATTGCCTTGG - Intergenic
1123925552 15:25106577-25106599 CTCAGCTCACAGAAGTGTCTTGG - Intergenic
1127355771 15:58198086-58198108 CTTTGCGCTTAGGATTGTCTTGG - Intronic
1127758832 15:62118498-62118520 CGCTGCGCGCAGAAGCTTCTGGG + Intergenic
1137611939 16:49824198-49824220 CTGTGGGCTTAGAAGTCTCTTGG - Intronic
1143020572 17:3915345-3915367 CTCTGTGCCTATATGTGTCTGGG - Intronic
1154318366 18:13324496-13324518 CTCTGCGCATAGAAGGTCCTCGG - Intronic
1166326717 19:42055359-42055381 CTCTGCGCGTAGAAGTGTCTTGG + Intronic
935131729 2:100265646-100265668 CTCTGCAGGTTGAAATGTCTGGG - Intergenic
937997873 2:127708722-127708744 CTCTGTGCTCAGAAGTGCCTGGG + Exonic
940629851 2:156224353-156224375 CTCTTTGCTTAGAATTGTCTTGG - Intergenic
943876667 2:193074677-193074699 CTCTGGGAGCAGAAGGGTCTAGG - Intergenic
946191045 2:218008147-218008169 CCCTGGGCGGAGACGTGTCTGGG + Intergenic
949063549 2:241975280-241975302 CTCTGCGCGTGGAGGTGTGTTGG + Intergenic
1169422777 20:5473235-5473257 CTCTTCCAGGAGAAGTGTCTGGG + Intergenic
1170754581 20:19188519-19188541 CTCTGTGCTTAGGATTGTCTTGG + Intergenic
1171724353 20:28602683-28602705 CTCTCCGCGCAGAAGTCTCCCGG - Intergenic
1171753701 20:29080363-29080385 CTCTCCACGTAGAAGTCTCCCGG + Intergenic
1180297904 22:10961357-10961379 CTCTCCGCGCAGAAGTCTCCCGG - Intergenic
952953670 3:38543646-38543668 CTCTGCCTGTAGGAGTGCCTGGG + Intergenic
953386775 3:42510874-42510896 CTCTGAGGGTAGAAGAGTGTTGG - Intronic
957410450 3:79833251-79833273 CTCTTTGCTTAGAATTGTCTTGG - Intergenic
958072845 3:88636817-88636839 CTTTTTGCGTAGAATTGTCTTGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968358789 3:198131626-198131648 CTTTTCGCTTAGAATTGTCTTGG + Intergenic
980858620 4:138471372-138471394 CTTTGTGCTTAGAATTGTCTTGG + Intergenic
981578053 4:146225560-146225582 CTCTGCTTTTAGGAGTGTCTTGG - Intronic
985040349 4:185885410-185885432 CTCAGAGTGCAGAAGTGTCTAGG + Intronic
985437122 4:189940983-189941005 CTCTCCGCGCAGAAGTTTCCCGG + Exonic
988120090 5:26950296-26950318 CTCAGTGCGTGGAAGTGTATGGG + Intronic
1003647909 6:7930356-7930378 CTTTGTGCATAGAATTGTCTTGG - Intronic
1006268827 6:32948756-32948778 CTCTTAGGGTAGAAGTCTCTGGG - Exonic
1008563080 6:52740854-52740876 ATCTGCAAGTTGAAGTGTCTAGG + Intergenic
1024183701 7:46925578-46925600 CTTTTCGCTTAGAATTGTCTTGG + Intergenic
1046023200 8:108690989-108691011 CTCTTGGCATAGAAGTGTCTTGG - Intronic
1049613044 8:143564656-143564678 CACTGTGGGTAGGAGTGTCTAGG - Intergenic
1053725243 9:40992399-40992421 CTCTCCGCGCAGAAGTCTCCCGG + Intergenic
1055779902 9:79809227-79809249 CTGTGTGCTTAGAAGTGTGTTGG + Intergenic
1059897876 9:118888497-118888519 GTCTGTGCTTAGAAGTCTCTGGG + Intergenic
1062082977 9:134634151-134634173 GTCTGCAGGGAGAAGTGTCTAGG + Intergenic
1203449556 Un_GL000219v1:99482-99504 CTCTCCGCGCAGAAGTGTCCCGG - Intergenic
1189916187 X:45857973-45857995 CTCTGAGAGTAAATGTGTCTCGG - Intergenic
1194523525 X:94947345-94947367 CTTTTCGCTTAGAATTGTCTTGG - Intergenic