ID: 1166326891

View in Genome Browser
Species Human (GRCh38)
Location 19:42056550-42056572
Sequence GAACCCTCTCGCCCTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166326891_1166326894 7 Left 1166326891 19:42056550-42056572 CCTCAGGGAGGGCGAGAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1166326894 19:42056580-42056602 GATCTGAGTGAGGTCTGAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 217
1166326891_1166326892 -3 Left 1166326891 19:42056550-42056572 CCTCAGGGAGGGCGAGAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1166326892 19:42056570-42056592 TTCTGAGCATGATCTGAGTGAGG 0: 1
1: 1
2: 1
3: 20
4: 215
1166326891_1166326893 6 Left 1166326891 19:42056550-42056572 CCTCAGGGAGGGCGAGAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1166326893 19:42056579-42056601 TGATCTGAGTGAGGTCTGAAAGG 0: 1
1: 0
2: 2
3: 18
4: 183
1166326891_1166326896 9 Left 1166326891 19:42056550-42056572 CCTCAGGGAGGGCGAGAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1166326896 19:42056582-42056604 TCTGAGTGAGGTCTGAAAGGGGG 0: 1
1: 0
2: 1
3: 14
4: 195
1166326891_1166326895 8 Left 1166326891 19:42056550-42056572 CCTCAGGGAGGGCGAGAGGGTTC 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1166326895 19:42056581-42056603 ATCTGAGTGAGGTCTGAAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166326891 Original CRISPR GAACCCTCTCGCCCTCCCTG AGG (reversed) Intronic
901072131 1:6526318-6526340 GAGCCCACTCGCAGTCCCTGTGG + Intronic
902382156 1:16057828-16057850 GAGCCCACTCCCCCTCCTTGCGG - Exonic
904145396 1:28386976-28386998 GAGCCATCTCGCCCAGCCTGAGG - Intronic
904710973 1:32429888-32429910 GAATCCTCTCATCCTCCTTGAGG + Intergenic
907475459 1:54702265-54702287 GCACCCTCTACCCCTCCCTCGGG + Intronic
911144780 1:94541720-94541742 GCACCCCCTCGCACTCCCTCTGG - Exonic
912881672 1:113422733-113422755 GAACCCTATTGCCCTCAGTGTGG + Intronic
915581187 1:156814278-156814300 GCAGCCTCTCTGCCTCCCTGTGG + Exonic
915677860 1:157548195-157548217 TCACCCTCTGACCCTCCCTGGGG - Intronic
917839354 1:178964894-178964916 GTAGCCTCTCCCCCTCCATGTGG - Intergenic
921608211 1:217179641-217179663 AATTCCTCTAGCCCTCCCTGTGG + Intergenic
923803385 1:237232272-237232294 AGACCCTCTCCCCCTCCCCGGGG - Intronic
924740651 1:246792747-246792769 GAGCCCTCGCGGCCGCCCTGGGG + Intergenic
1062946433 10:1465239-1465261 GAACCCTCTCGCACCCTCTGTGG - Intronic
1065535424 10:26710792-26710814 GTATCCTCTCCCCCTCCCTCAGG - Intronic
1065535848 10:26714017-26714039 GTATCCTCTCCCCCTCCCTCAGG + Intronic
1066745912 10:38604202-38604224 TCACCCTCCAGCCCTCCCTGTGG + Intergenic
1067572904 10:47384576-47384598 GAACGCCCTCGCCCTCCCGCAGG - Intergenic
1067735555 10:48847524-48847546 TAACCTTCTTGCCCTGCCTGAGG + Intronic
1069870255 10:71528725-71528747 GAACCCTGTTCCCCACCCTGGGG + Intronic
1071501951 10:86210586-86210608 GAGCCATCTCGCCCTCCCCGTGG + Intronic
1072503766 10:96043994-96044016 GAGTTCTCCCGCCCTCCCTGAGG - Intronic
1072537134 10:96372175-96372197 GAACCCTGTCAAACTCCCTGAGG - Intronic
1073094518 10:100971589-100971611 GCACCCTCTGGCCCTGCCTGTGG + Intronic
1073177340 10:101564616-101564638 GACCCCTCTCAGGCTCCCTGGGG + Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1077405635 11:2381330-2381352 CAAGTCACTCGCCCTCCCTGCGG + Intronic
1078362635 11:10680964-10680986 GAACTCACTGACCCTCCCTGAGG - Intronic
1079163227 11:18013145-18013167 GCACCCTCTCTCCCGGCCTGCGG - Exonic
1080676894 11:34436279-34436301 GAACATTCTCGGCCTCTCTGAGG + Intergenic
1080825939 11:35849436-35849458 GTACCCTCTCTGCCTTCCTGTGG + Intergenic
1081786494 11:45751381-45751403 GAGCCCTCTCCCCTTCCCAGTGG + Intergenic
1083265052 11:61542765-61542787 AAGCCCTCGCGCCCACCCTGAGG + Intronic
1083296671 11:61718851-61718873 ACGCCCTCTCGCCCACCCTGGGG + Intronic
1083309869 11:61778640-61778662 GAACACTCACCCCTTCCCTGTGG - Intronic
1083575072 11:63784439-63784461 GACCCCTCTAACCTTCCCTGTGG + Intergenic
1083731458 11:64654613-64654635 GAAGCCTCTGGCCATCCCTCTGG + Intronic
1085391935 11:76186666-76186688 GGACCCCCTGGCCCACCCTGGGG - Exonic
1088368133 11:109060241-109060263 GAACCCCTCAGCCCTCCCTGAGG - Intergenic
1089544848 11:119215990-119216012 GCACCCCCTCTCCCTCCTTGCGG - Intronic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091437048 12:481122-481144 GAAAGCTCCCTCCCTCCCTGAGG - Intronic
1096849629 12:54427277-54427299 GAACCCAGCCCCCCTCCCTGAGG - Intergenic
1103787222 12:123441923-123441945 GAGCTCCCACGCCCTCCCTGGGG + Intergenic
1104921862 12:132294716-132294738 GACCCCACCCGCCCTCCCAGAGG - Intronic
1113710605 13:112461903-112461925 CCACCCCCTCCCCCTCCCTGTGG - Intergenic
1114364743 14:22014004-22014026 GGACCCACTCCCCCTACCTGGGG - Intergenic
1114531061 14:23396783-23396805 GAACCCAGTGGCCATCCCTGAGG - Exonic
1115648105 14:35384187-35384209 GACCCCTTTGGCCCTCCTTGAGG - Intergenic
1119554453 14:75542563-75542585 GTCCCCTCTGGCCCTCCTTGGGG - Intronic
1120755775 14:88242856-88242878 GAAGCCTAGAGCCCTCCCTGCGG - Intronic
1122313746 14:100813506-100813528 GCACCCTGTGGCCCTCACTGTGG + Intergenic
1122389095 14:101368126-101368148 AAACCCGCTCGCCCTCCACGTGG - Intergenic
1123020651 14:105396296-105396318 CTACCCTCTCCCCCACCCTGGGG - Exonic
1125701468 15:41689244-41689266 GTACCCTCTCCCTCTCTCTGTGG + Intronic
1127353079 15:58171779-58171801 GAAGCCTCTACCACTCCCTGTGG - Intronic
1128537304 15:68500851-68500873 GAGCTCTCAGGCCCTCCCTGTGG - Intergenic
1128715419 15:69904362-69904384 CAACACTCTCGGCCACCCTGGGG + Intergenic
1129729479 15:77921800-77921822 GTGCCATCTCGGCCTCCCTGTGG - Intergenic
1129933939 15:79433543-79433565 GAACCATGCCGCCATCCCTGAGG + Intronic
1130435622 15:83896273-83896295 GAACCCTCAGCCCCTCCCTGGGG + Intronic
1133963674 16:10516144-10516166 GAGCTCTCTCTGCCTCCCTGTGG - Intergenic
1135295847 16:21278434-21278456 GACCCATCTCGCCCACCCTTAGG - Intronic
1138017076 16:53438502-53438524 GAACCCTCTCTACCTCTCAGTGG + Intronic
1138427887 16:56948424-56948446 AAACCCTGTGGCCTTCCCTGAGG + Intergenic
1140442525 16:74998945-74998967 TAACCCTTTCGCGGTCCCTGCGG - Intronic
1141528637 16:84629977-84629999 GAACCGTCTCCCCATTCCTGAGG + Intergenic
1142201999 16:88765518-88765540 GAACCATCTTGCCCTCCCAGTGG + Intronic
1142294486 16:89211473-89211495 GCACCCCCTGGCCCTTCCTGTGG + Intergenic
1143099724 17:4498654-4498676 AAACCCTCTCCCGCTCCCCGCGG + Intergenic
1148081289 17:44968678-44968700 GAGCTCTCTAGCTCTCCCTGTGG - Intergenic
1150582306 17:66485440-66485462 GAAACCTCTCTCCCTCGCTAAGG - Intronic
1151369646 17:73639711-73639733 GAACCCTCTCCCTGTCCCTACGG - Intronic
1151946604 17:77323168-77323190 GTACTCTCCCGCCCTCCCTGGGG + Intronic
1151993990 17:77597068-77597090 TATCCTTCTCGCCCTCTCTGGGG + Intergenic
1152043173 17:77918167-77918189 GAACGCTCTGTCCTTCCCTGGGG - Intergenic
1159241695 18:65750793-65750815 GCGCCCTCTCGCCCTCTCTCTGG + Intronic
1161326152 19:3665170-3665192 CAATCCTCTTGCCCTTCCTGAGG - Intronic
1161851241 19:6739198-6739220 AAACCCTCTCATCCGCCCTGTGG + Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163729474 19:18940972-18940994 GAACCCCCACGCCCTCCCCTTGG + Intronic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1166335744 19:42105853-42105875 GACCCCTCTCTGCCTGCCTGGGG - Intronic
1166345654 19:42163616-42163638 GATCCCTCAGTCCCTCCCTGAGG + Intronic
1166542674 19:43615832-43615854 GGAGCTTCACGCCCTCCCTGGGG + Intronic
1168687144 19:58355890-58355912 GGAGCCTGCCGCCCTCCCTGGGG + Exonic
926586421 2:14690856-14690878 GCACCCACTGGCCCTACCTGTGG + Intergenic
929865131 2:45711037-45711059 GTCCCCTGTCCCCCTCCCTGTGG + Intronic
931803899 2:65785983-65786005 GCCCCCTCTCGCCCTCCCACAGG - Intergenic
934574121 2:95389778-95389800 GAAACGTCTCCACCTCCCTGGGG - Intergenic
935050096 2:99517986-99518008 AAATCCTCTCCCCTTCCCTGGGG + Intergenic
936350125 2:111706287-111706309 GAAACCTCTCACCCTCTCTCGGG - Intergenic
937701395 2:124866569-124866591 GAGCACTCTCCTCCTCCCTGTGG - Intronic
938089789 2:128423999-128424021 GAGCTCTCTCCCTCTCCCTGGGG + Intergenic
943515716 2:188883670-188883692 TAACCCTTTTTCCCTCCCTGAGG - Intergenic
943697278 2:190950099-190950121 GCTCCCTCTCCCCCTCCCTTTGG - Intronic
944736767 2:202574235-202574257 GCAACCTCTCTGCCTCCCTGTGG + Intergenic
947653251 2:231805308-231805330 GAGGCATCTCGCCCTCCCAGCGG - Intronic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
947913575 2:233818156-233818178 CAGCCCTCTCTCCCTCCCAGAGG - Intronic
949073071 2:242038498-242038520 CAACCCTTTCGCCTTCACTGAGG - Intergenic
1169091859 20:2865732-2865754 GCCCCCTGTGGCCCTCCCTGGGG - Intronic
1169131543 20:3168453-3168475 CTACCCTCTCCCGCTCCCTGTGG + Intronic
1169187572 20:3631643-3631665 GGGCCCTCTCACCTTCCCTGAGG + Intronic
1171849084 20:30295429-30295451 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1172273522 20:33667646-33667668 GCACCCTGTCGCGCTACCTGCGG + Exonic
1176236954 20:64057869-64057891 GAACCACCTGGACCTCCCTGGGG + Intronic
1178599523 21:33983977-33983999 TAACCCTCTTGCCCTTCATGGGG + Intergenic
1180085606 21:45506768-45506790 GAACCCTCCCACCTTCCCTCTGG + Intronic
1180941676 22:19663703-19663725 GAGCCCTCCTCCCCTCCCTGTGG + Intergenic
1182427521 22:30282822-30282844 GAGCCCCCTCCCTCTCCCTGAGG + Intergenic
1184421780 22:44386410-44386432 GAAGCCTTCCTCCCTCCCTGGGG + Intergenic
1184543692 22:45150334-45150356 GAGCCCTCTCTCCCTCCCCCTGG + Intergenic
949188106 3:1218215-1218237 GAACCCTCTTCCCCTTCCTCAGG - Intronic
950678202 3:14567371-14567393 CATCCCTCATGCCCTCCCTGGGG + Intergenic
951958844 3:28291778-28291800 GCTCCCTCTCCCCCTCCCTCAGG - Intronic
954636348 3:52072916-52072938 GTACCCTCACCCCCTCCCCGTGG - Intergenic
954671651 3:52294340-52294362 CAACCCTCCCCTCCTCCCTGAGG + Intergenic
961049361 3:123733765-123733787 AATCCCTCTGGCCCTCCATGGGG + Exonic
965965686 3:174486140-174486162 GTACCCTGTAGCCCTCCATGTGG - Intronic
968068535 3:195772164-195772186 GAACCCTCTCTCCATCGCTCAGG + Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968733057 4:2280739-2280761 GCACCCTCGGGCCCTGCCTGTGG + Intronic
969262345 4:6042120-6042142 GAACCCTCTCCCCCACCCCCAGG + Intronic
976362460 4:84195995-84196017 GAATCCTCTTCCCCTACCTGTGG + Intergenic
977424397 4:96848196-96848218 GAATCCTCTCTTGCTCCCTGTGG + Intergenic
980404964 4:132344381-132344403 GAATCCACTCTCCCTCACTGGGG - Intergenic
981580554 4:146244943-146244965 GAACTCCCTCCCCTTCCCTGGGG - Intergenic
987491103 5:18581228-18581250 AAACCTTCTCGCTCACCCTGGGG - Intergenic
987557887 5:19478808-19478830 AAATCCTCTCTCCCTCCCAGAGG - Intronic
988992471 5:36684754-36684776 GAATCCTCTCGCCCAGTCTGGGG - Intronic
989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG + Intergenic
992157675 5:73971036-73971058 GAGACCTGTCGCCCTCCCTAAGG - Intergenic
993898697 5:93570486-93570508 GGACCCACTCACACTCCCTGGGG + Intergenic
995302775 5:110603419-110603441 GAAACCTCTTGGCCTCCCTTTGG - Intronic
996091470 5:119355939-119355961 GAACCCGCTCTCCCGCCCCGGGG + Intronic
997675051 5:135706700-135706722 TACCCCTCTCGTCCTCCCAGGGG - Intergenic
1000766462 5:165297112-165297134 GAACCCTGTCTCAGTCCCTGTGG - Intergenic
1002070376 5:176675839-176675861 GAACCCTCACGCCCTGCTGGTGG - Intergenic
1003092311 6:3114538-3114560 CACCCTTCTCGCCCTCCCTCTGG - Exonic
1005502889 6:26445468-26445490 GATCCCTCTCCTCCTCCCTCTGG + Intronic
1005926815 6:30451660-30451682 GCACCCTCTCGGCCTCGCAGGGG - Intergenic
1006153238 6:32000525-32000547 AAACCCACTCGCCCTCCTCGCGG - Intronic
1006159546 6:32033262-32033284 AAACCCACTCGCCCTCCTCGCGG - Intronic
1006396544 6:33791048-33791070 GAACCCTGTTGTCTTCCCTGTGG + Intergenic
1010666603 6:78638112-78638134 AAAGCCTCTTGTCCTCCCTGTGG - Intergenic
1013301579 6:108809377-108809399 CAGCCCACTGGCCCTCCCTGCGG + Intergenic
1014205598 6:118651874-118651896 AATCCCTCACGCCCTCCCTCCGG + Intronic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1018857836 6:167688209-167688231 GCACCATCCCGCCCTCTCTGCGG - Intergenic
1018915078 6:168128169-168128191 GGCCCCTCTAGCCATCCCTGGGG - Intergenic
1019576527 7:1740267-1740289 GATGCCTATTGCCCTCCCTGGGG + Intronic
1019612919 7:1945977-1945999 GAACCCACTGGCCCTTCCTCTGG - Intronic
1020347665 7:7182783-7182805 GCTCCCTCTCGCCCCTCCTGGGG - Exonic
1022320471 7:29283411-29283433 GAATCCTCTCCCCTTCCATGTGG + Intronic
1022800047 7:33768037-33768059 GAACTCTCTGCCCCTCCCTAGGG + Intergenic
1025829537 7:65037923-65037945 GAACCCTCGGCCCCTCCCTCTGG - Intergenic
1025916759 7:65872841-65872863 GAACCCTCGGCCCCTCCCTCTGG - Intergenic
1026775965 7:73231329-73231351 GAACCACCTCGCCCAGCCTGTGG + Intergenic
1026836153 7:73640825-73640847 GAACCCTCTCCCTCTTCTTGAGG + Intergenic
1028986937 7:97016673-97016695 GAGCTCTCTAGCCCTCCCGGAGG - Intergenic
1033661692 7:143407476-143407498 GCCTCCTCTCCCCCTCCCTGAGG + Intronic
1034785730 7:153924488-153924510 AAACCATCGCTCCCTCCCTGTGG + Intronic
1034962677 7:155372482-155372504 GTAGCCTCCCGCGCTCCCTGGGG + Intergenic
1041797460 8:61760443-61760465 GAACCCTCTCTCCCGCCTTTTGG + Intergenic
1047226052 8:122956212-122956234 GAACCCTATTGTCCTCTCTGGGG - Intronic
1053786806 9:41658149-41658171 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1054158255 9:61656046-61656068 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1054478028 9:65587051-65587073 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1060706769 9:125809639-125809661 GAAATCTTTCGCCCACCCTGAGG - Intronic
1060948106 9:127582094-127582116 AATCCCTCTCTCCCTCCCTCAGG + Intergenic
1061802354 9:133119544-133119566 GTTCCCTCTCTCCGTCCCTGAGG - Intronic
1061812681 9:133171501-133171523 GCATCCTCTCTGCCTCCCTGGGG - Intergenic
1061919091 9:133772361-133772383 GGAGCCTCTCCTCCTCCCTGTGG + Intronic
1061926131 9:133806912-133806934 GGACCCCCTCGCCTGCCCTGCGG - Intronic
1062025428 9:134338127-134338149 GACACCTCTGTCCCTCCCTGTGG - Intronic
1062070043 9:134550422-134550444 GGACCCTCTTGCTTTCCCTGGGG + Intergenic
1062706883 9:137950503-137950525 GAATCCCCTCACCCTCCATGGGG - Intronic
1187932992 X:24311241-24311263 GAACCCTGTGGCCCTGGCTGAGG + Intergenic
1187939219 X:24364921-24364943 GAACCCTGTGGCCCTGGCTGAGG - Intergenic
1192317257 X:70062671-70062693 GAGCCATCTCGGCCTCCATGCGG - Exonic
1199316353 X:146382745-146382767 GAATCCTCCCTCCCTCCCTCTGG - Intergenic