ID: 1166327891

View in Genome Browser
Species Human (GRCh38)
Location 19:42062400-42062422
Sequence GGGGCAGTGAACCACTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166327887_1166327891 -5 Left 1166327887 19:42062382-42062404 CCCCAGGGTTCTAACTAGGGGGC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG 0: 1
1: 0
2: 3
3: 10
4: 117
1166327888_1166327891 -6 Left 1166327888 19:42062383-42062405 CCCAGGGTTCTAACTAGGGGGCA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG 0: 1
1: 0
2: 3
3: 10
4: 117
1166327882_1166327891 3 Left 1166327882 19:42062374-42062396 CCTGGGTGCCCCAGGGTTCTAAC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG 0: 1
1: 0
2: 3
3: 10
4: 117
1166327889_1166327891 -7 Left 1166327889 19:42062384-42062406 CCAGGGTTCTAACTAGGGGGCAG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG 0: 1
1: 0
2: 3
3: 10
4: 117
1166327880_1166327891 10 Left 1166327880 19:42062367-42062389 CCTGGTGCCTGGGTGCCCCAGGG 0: 1
1: 1
2: 3
3: 49
4: 442
Right 1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG 0: 1
1: 0
2: 3
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166327891 Original CRISPR GGGGCAGTGAACCACTGTGT GGG Intronic
901280094 1:8026830-8026852 GGGGCAGTGAAGGATAGTGTGGG + Intergenic
901280117 1:8026950-8026972 GGGACAGTGAGGGACTGTGTAGG + Intergenic
902876466 1:19343640-19343662 GGGGCAGTAAACGGCTGTGGAGG - Intronic
903442910 1:23401750-23401772 GGGGGTGGGAACCCCTGTGTTGG - Intronic
906481096 1:46199217-46199239 TGGGCAGTGAGCCACCGTGCTGG + Intronic
910788244 1:91022830-91022852 GGGGCAGAGAAACACTGAGTGGG + Intergenic
915596115 1:156897450-156897472 GGGGCTGTGAACCCCTGGGTTGG + Intronic
918036847 1:180881977-180881999 GGGGCAGGGGAGCACTGAGTGGG + Intronic
918194227 1:182206833-182206855 GGGGGAGTGAAGCACTATATGGG - Intergenic
921264998 1:213414910-213414932 TGGGTAGAGCACCACTGTGTGGG - Intergenic
923365964 1:233261763-233261785 TGGGCAGAGAACCAATATGTAGG - Intronic
1064562363 10:16605723-16605745 GGGGCAGTTATCCTCTGTGGTGG + Intronic
1066669981 10:37826967-37826989 AGGGAAGTGAACCAATATGTGGG + Intronic
1067082811 10:43221193-43221215 GCGGGAGCGAACCACAGTGTCGG - Intronic
1067298910 10:44992203-44992225 GGGGCTGTGTCCCACTGTTTTGG - Intronic
1072913617 10:99523606-99523628 GGGGCTGTGAACCACCGTCAGGG + Intergenic
1073626345 10:105101735-105101757 AGGGAAATGAACCAGTGTGTGGG + Intronic
1074116656 10:110461382-110461404 GGGGCAGTGAACTTCTGGATGGG - Intergenic
1074311665 10:112327897-112327919 GGGGCAGTGAAGTCATGTGTGGG + Intergenic
1075906021 10:126082842-126082864 GGGGCAGGGGACCACAGTGTGGG + Intronic
1077077592 11:708502-708524 GGGGCAGTGATACTGTGTGTTGG + Intronic
1088776970 11:113094649-113094671 GGGGCAGTTAACAAGAGTGTGGG - Intronic
1091429834 12:424387-424409 GGGGCAGGGTATCACTCTGTCGG + Intronic
1091970068 12:4779573-4779595 GGGGCAGGAAACCACTGGCTTGG + Intronic
1093129169 12:15368970-15368992 AGGGCAGAGAACCACTGAGGTGG + Intronic
1094194338 12:27730746-27730768 CAGGCAGTGAGCCACTGTGCCGG + Intronic
1101433133 12:104643491-104643513 GGGGCAGTGTGCCACTGTAGTGG + Intronic
1102133102 12:110548998-110549020 GGTGCTGAGAACCACAGTGTAGG + Intronic
1103702758 12:122856218-122856240 GGGGCAGTGATGCCCCGTGTGGG - Intronic
1104103924 12:125641103-125641125 GGGGCAGTGGAGCACTGTGTGGG - Intronic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1114192648 14:20452050-20452072 GTGGGTGTGAACCACTGTATAGG - Exonic
1114416245 14:22546438-22546460 GGAGCAGAGAACCACTGGGTGGG + Intergenic
1115063208 14:29220287-29220309 GGGGCAGTCAATCACTGTGATGG - Intergenic
1118105995 14:62660231-62660253 GGGGCACTGCACCAGAGTGTGGG - Intergenic
1118596728 14:67441417-67441439 AGCCCAGTGAACCACTGTGTGGG + Intergenic
1119308913 14:73630487-73630509 GGGGGAGCGAACCACTATGGTGG - Intergenic
1119702318 14:76763217-76763239 GGGGCAGGGGACCACTGGCTCGG + Intronic
1123580989 15:21714791-21714813 AAGGCAGTGAACCACGATGTGGG - Intergenic
1123617638 15:22157414-22157436 AAGGCAGTGAACCACGATGTGGG - Intergenic
1128882866 15:71259580-71259602 AGGGCTGAGAACCACTGTGCTGG - Intronic
1130653429 15:85775384-85775406 GTGGCCGTGAATCACTGTGCAGG - Intronic
1131924009 15:97362065-97362087 AAGGCAGTGAACAACTTTGTAGG + Intergenic
1133073499 16:3262608-3262630 AGGGCCCTGAACCACTGTGGAGG + Intergenic
1136459819 16:30402844-30402866 GGGTAAGTGAACCACTCTTTCGG - Intergenic
1140632307 16:76868087-76868109 GAGACAGTGACCCAGTGTGTTGG + Intergenic
1140836170 16:78796247-78796269 GGGTCAGTGAATCACAGTATGGG - Intronic
1141254132 16:82385217-82385239 GGGCCAGTGAACCATGGTGGGGG + Intergenic
1142329864 16:89444966-89444988 GTGGCAGTGTGCCACTGTCTGGG - Intronic
1142433408 16:90042716-90042738 GGGGCAGTGCACTGCTGTCTAGG + Intronic
1142479651 17:211227-211249 TGGGCAGAGACCCACTGTTTGGG + Intergenic
1146087183 17:29840259-29840281 GTGGCAGTGAAACAATTTGTAGG - Intronic
1147552332 17:41452492-41452514 GGTCCACTTAACCACTGTGTTGG - Intergenic
1150461427 17:65356801-65356823 GGGGCACAGTTCCACTGTGTTGG + Intergenic
1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG + Intronic
1151395072 17:73817634-73817656 GCTGCATTTAACCACTGTGTAGG - Intergenic
1151699650 17:75736526-75736548 GGGGCAGACAGGCACTGTGTTGG - Intronic
1152452855 17:80394084-80394106 GGGGCAGTGGCTCACTGTGAGGG - Exonic
1152923400 17:83077013-83077035 GGGGCAGTGTACCAGTGGCTGGG + Intergenic
1154055500 18:11009424-11009446 AGGGCTGAGAACCACTGTGCTGG + Intronic
1156157011 18:34315017-34315039 AGGTCAGTGAACCAATGTGAGGG + Intergenic
1157436923 18:47678141-47678163 GAGGAAATGAAACACTGTGTTGG - Intergenic
1158707808 18:59809499-59809521 GGTGCAGTGACCCCCAGTGTGGG + Intergenic
1161088056 19:2344161-2344183 GGGGCAGGGGAGCACGGTGTGGG - Intronic
1163769127 19:19180090-19180112 GGGGCTGTAAACCACTGTTTTGG + Intronic
1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG + Intronic
1168029032 19:53665127-53665149 GGGGCAGAGAATCAAGGTGTCGG - Intergenic
925249982 2:2424071-2424093 TGGGGAATGAACCACTGTGATGG + Intergenic
929565335 2:42980241-42980263 GGGGCACTGGAGCACAGTGTGGG + Intergenic
930539790 2:52690924-52690946 GGGGCAGGGTATCACTATGTTGG + Intergenic
937239693 2:120452129-120452151 AGGGCTGTGAACCTCAGTGTTGG + Intergenic
945987237 2:216364656-216364678 GGGGCAAGGCACCACTGTTTTGG + Intronic
1170219899 20:13930608-13930630 TGGGCAGTGAACCAGTCTTTTGG + Intronic
1172310708 20:33916088-33916110 GGGGGAGTGAACCACTCAGAAGG - Intergenic
1172943343 20:38669666-38669688 GTGGCAGTGTACCTCAGTGTGGG + Intergenic
1174289468 20:49497492-49497514 GGAGCTCTGAACCACTGTGTAGG + Intergenic
1183433152 22:37778029-37778051 GGGGAAGTCAACCACAATGTAGG - Intergenic
1184650856 22:45918950-45918972 GCAGCAGTGAGCCACTGAGTGGG + Intergenic
949994932 3:9609062-9609084 GAGGCAGGGATTCACTGTGTTGG - Intergenic
950198488 3:11026358-11026380 AGGTCAGTGCAACACTGTGTGGG + Exonic
950964428 3:17136499-17136521 GGGACTGTGGCCCACTGTGTGGG + Intergenic
953989720 3:47475143-47475165 GGGGCAGTGAGTCGCTGTGGGGG - Intronic
960962684 3:123083224-123083246 GGTGCAGTGAAGCTCTGTGAGGG + Intronic
961334210 3:126160557-126160579 GGGTCAGAGAAGCTCTGTGTGGG + Intronic
963060250 3:141219847-141219869 AGGGCTGGGAACCACTGTGGAGG - Intergenic
966173171 3:177105822-177105844 GGGACTGAGAACCACTGGGTGGG + Intronic
966655848 3:182358149-182358171 GGGGCATTTAGCCACTGTCTGGG - Intergenic
968569440 4:1331745-1331767 GGGACAGTGACCCTGTGTGTGGG + Intronic
972349930 4:38227038-38227060 GCGGCAGAGAGCCACTGTTTTGG - Intergenic
972687308 4:41363263-41363285 GGGGCAGTGAATCCCCGGGTGGG + Intronic
978563745 4:110060431-110060453 GGGGCATTGAAGAACAGTGTTGG - Intronic
978738759 4:112114030-112114052 GGGGCAGGGAAAAACTGAGTGGG - Intergenic
981746392 4:148056243-148056265 AGTGCAGTTAACCACTGTGGTGG + Intronic
981927803 4:150158445-150158467 GGGGCAGTGTGCCTCTGTGGTGG - Intronic
983446140 4:167855401-167855423 GGGGCAGGGAACGACTGTCATGG + Intergenic
983489845 4:168375896-168375918 GGGGCAGCAAAGCACAGTGTTGG - Intronic
988738634 5:34047478-34047500 GGGACAGTCAAGAACTGTGTTGG + Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
990247195 5:53874677-53874699 GGGGCTGTGAAGCAATGGGTTGG + Intergenic
992085032 5:73270578-73270600 GGGGTAGGGAAACACTGTGATGG - Intergenic
999149106 5:149415004-149415026 GGGGCAGTGGACAGCAGTGTGGG + Intergenic
1001237182 5:170039940-170039962 GAGGCAATGAACCACTGCATCGG - Intronic
1001240916 5:170069266-170069288 GGGCAAGTGAACCACGGTGGGGG - Intronic
1004733312 6:18380243-18380265 GGAGCAGAGAACCACTGCATGGG - Intergenic
1005806079 6:29475603-29475625 GAGACAGAGACCCACTGTGTCGG + Intergenic
1008865482 6:56204646-56204668 GGGTCAGGGACCCACTGTGGAGG - Intronic
1013646267 6:112144665-112144687 GGGGCTGAGAACTACTGAGTTGG + Intronic
1023820375 7:43977349-43977371 GGTGCAGAGACACACTGTGTGGG + Intergenic
1023891456 7:44394850-44394872 TGGCCAGTGAAACCCTGTGTTGG - Intronic
1029748659 7:102530870-102530892 GGTGCAGAGACACACTGTGTGGG + Intergenic
1029766606 7:102629954-102629976 GGTGCAGAGACACACTGTGTGGG + Intronic
1031159427 7:118148576-118148598 GTGGCAGTGAACCTTTATGTTGG - Intergenic
1032833652 7:135653409-135653431 GGGGCAGTGGAGAAGTGTGTGGG + Intergenic
1034462054 7:151203454-151203476 GGAGCAGTCCACCACTGTGCGGG - Exonic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039922266 8:41901689-41901711 GGGGTAGTGACCCCCTTTGTGGG - Intergenic
1041281313 8:56212477-56212499 GGGGACGTGAACCACTGGATGGG + Intronic
1043035817 8:75197450-75197472 GGTACAGAGGACCACTGTGTGGG - Intergenic
1043411125 8:79996737-79996759 GTGGCAGTGAAGCTCTGTGGAGG - Intronic
1046854439 8:119015211-119015233 GGGGAGGTGAAGCATTGTGTAGG + Intronic
1051276151 9:15400859-15400881 GGGACAATGAACCACTGAGAGGG - Intergenic
1053131021 9:35615818-35615840 GGGGCAGTGAACCAGAGTGGTGG - Intronic
1053593403 9:39534669-39534691 GGGGCACTGACCCACAGGGTTGG + Intergenic
1053851137 9:42289377-42289399 GGGGCACTGACCCACAGGGTTGG + Intergenic
1054572903 9:66830608-66830630 GGGGCACTGACCCACAGGGTTGG - Intergenic
1054749147 9:68886778-68886800 GGAGCAGAGGACCACTCTGTTGG - Intronic
1058795812 9:108497528-108497550 GGGTCAGTGGACCACAGGGTCGG - Intergenic
1197281035 X:124536343-124536365 GGGGCAGTGACCAACTGAGTAGG - Intronic
1197870614 X:131059300-131059322 GGGGGAGTGAAGGACAGTGTGGG - Intronic
1198427392 X:136533595-136533617 GGGCCAGTGAACAACTTTGGAGG - Intronic
1200081421 X:153578638-153578660 GGGGCAGAGGGCCACTGTGCCGG + Intronic