ID: 1166328439

View in Genome Browser
Species Human (GRCh38)
Location 19:42065372-42065394
Sequence TCATCCAGGATTGCAGCTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166328432_1166328439 15 Left 1166328432 19:42065334-42065356 CCAAGGCCAGACGCTCACCGCGG 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183
1166328436_1166328439 -8 Left 1166328436 19:42065357-42065379 CCACACACTGTCTGATCATCCAG 0: 1
1: 0
2: 1
3: 19
4: 144
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183
1166328431_1166328439 21 Left 1166328431 19:42065328-42065350 CCAAGGCCAAGGCCAGACGCTCA 0: 1
1: 0
2: 0
3: 16
4: 333
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183
1166328435_1166328439 -2 Left 1166328435 19:42065351-42065373 CCGCGGCCACACACTGTCTGATC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183
1166328429_1166328439 27 Left 1166328429 19:42065322-42065344 CCCGGGCCAAGGCCAAGGCCAGA 0: 1
1: 2
2: 19
3: 109
4: 708
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183
1166328434_1166328439 9 Left 1166328434 19:42065340-42065362 CCAGACGCTCACCGCGGCCACAC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183
1166328430_1166328439 26 Left 1166328430 19:42065323-42065345 CCGGGCCAAGGCCAAGGCCAGAC 0: 2
1: 1
2: 3
3: 30
4: 346
Right 1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG 0: 1
1: 0
2: 2
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166328439 Original CRISPR TCATCCAGGATTGCAGCTGA GGG Exonic
900124802 1:1064631-1064653 TCACCCAGGAAAGCAGCTGGGGG + Intergenic
900151254 1:1180231-1180253 CCCTCCAGGAGGGCAGCTGAGGG - Exonic
901845249 1:11978042-11978064 ACATCCAGGCTTTCACCTGACGG + Intergenic
902129951 1:14251552-14251574 ACATCCCAGATGGCAGCTGAAGG - Intergenic
902982964 1:20138828-20138850 TCCACCAGGATTCCTGCTGAAGG - Intergenic
904440463 1:30526412-30526434 TCGGGCAGGATTCCAGCTGAGGG - Intergenic
908708647 1:66990610-66990632 TCACTTAGGATTGCAGCAGATGG + Intergenic
908944844 1:69482871-69482893 TGATCCAGGAATGCAGTTGCAGG - Intergenic
910516771 1:88070137-88070159 TCAGCCAGGATGGGAGCTGCTGG + Intergenic
910532008 1:88247893-88247915 TCATCCAGAATAGCATCTGCTGG - Intergenic
911743101 1:101409328-101409350 TCATCCAGGTTTGCCTCAGATGG + Intergenic
917060976 1:171039003-171039025 TCATCCACAAGTGAAGCTGATGG - Intronic
917942988 1:179941815-179941837 TCTTCCAGGATGGCAGCTTCAGG + Intergenic
919166216 1:193897143-193897165 TCATCCAACATTGCATCTCAAGG - Intergenic
919499116 1:198314659-198314681 TCAAACAGACTTGCAGCTGAGGG - Intronic
919810946 1:201408510-201408532 TAATCCAGGTTTGCAGAGGAAGG + Exonic
919970855 1:202577042-202577064 GCCCCCAGCATTGCAGCTGAGGG + Intronic
920618781 1:207523698-207523720 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920620563 1:207542269-207542291 GCTTCCAGGATTGCAGCGGTAGG - Exonic
920622345 1:207560826-207560848 GCTTCCAGGATTGCAGCGGTAGG - Exonic
922187638 1:223289776-223289798 TCATCCAGGTTTGGAGTTGAAGG - Intronic
922703348 1:227775115-227775137 GCCTCCAGGAATGCAGCGGAGGG + Intronic
923510328 1:234646080-234646102 TCATCCCAGGATGCAGCTGAAGG - Intergenic
1063023638 10:2155972-2155994 ACATGCAGGATTGCAGTTGTGGG + Intergenic
1063182948 10:3622461-3622483 CCATCCAGGTTTGCAGCCTAGGG + Intergenic
1068157435 10:53220357-53220379 TCATTCAAGATTTTAGCTGAAGG - Intergenic
1069711693 10:70493536-70493558 CCTTCTAAGATTGCAGCTGAGGG + Intronic
1070645232 10:78197475-78197497 TCATCCAGGTTTTCATCTAAAGG - Intergenic
1071860172 10:89664366-89664388 GCAGCAAGGATGGCAGCTGAAGG - Intergenic
1072793427 10:98336002-98336024 CCATCAAGGATTGGAGCTGAGGG + Intergenic
1074273293 10:111976322-111976344 GCAGCCAGCATGGCAGCTGATGG + Intergenic
1074413972 10:113250956-113250978 TCAATGAGGATTGCAGCTAAGGG + Intergenic
1075524292 10:123169720-123169742 TCATCCAGAATTGAATCTGCTGG + Exonic
1075758343 10:124834576-124834598 TCCTCTGGGTTTGCAGCTGAAGG + Exonic
1076199106 10:128544166-128544188 TTATCCAGGATGGGAGCTTAAGG + Intergenic
1076804600 10:132849159-132849181 TCATCCATGAATGCTGCTGATGG - Intronic
1077598121 11:3552113-3552135 TCCTCCACGATTGGAGCAGAGGG - Intergenic
1077718596 11:4605222-4605244 ACATCCAGGAATGGGGCTGAAGG - Exonic
1077773551 11:5247267-5247289 TCTTCCTGGATTGCAGATGGCGG + Intergenic
1079847056 11:25486199-25486221 TAATCCAAGATTGCAACTGGAGG - Intergenic
1080296524 11:30736325-30736347 TCATCTAGGAGTGAAACTGAGGG - Intergenic
1084254197 11:67927985-67928007 TCCTCCACGATTGGAGCAGAGGG - Intergenic
1086420587 11:86633746-86633768 TCCTTCATGATTGCATCTGATGG - Intronic
1087504049 11:98997342-98997364 TCCAACAGGAGTGCAGCTGAAGG + Intergenic
1089770973 11:120802686-120802708 TCGTCCAAGATAGCAGCTGTGGG - Exonic
1092277159 12:7070114-7070136 TCATCCGGGATGGAAGCTGCTGG + Exonic
1094426598 12:30322752-30322774 TCCTGCAGGATGGCAGCTGGTGG - Intergenic
1095212165 12:39507063-39507085 GTATCCAGGACTTCAGCTGAGGG + Intergenic
1096552932 12:52385380-52385402 TCACCCCGGATAGCAGCTGTAGG - Exonic
1099925907 12:89016937-89016959 TCATCCAAGATTGCTGCTGAGGG + Intergenic
1101338501 12:103819185-103819207 ACATCCAGGCTTTCAGGTGATGG - Intronic
1102185665 12:110946474-110946496 ACAGCCATGTTTGCAGCTGAGGG + Intergenic
1102561725 12:113766920-113766942 TTTGCCAGGATTCCAGCTGAAGG + Intergenic
1102704468 12:114869289-114869311 TTATTCAGGATGACAGCTGAGGG + Intergenic
1103506028 12:121442821-121442843 TCTTCCAGGACCGCCGCTGAGGG + Exonic
1104548552 12:129734017-129734039 TGATACTGGATTGCAGCTGTGGG - Intronic
1109613393 13:64796218-64796240 TCATTTAGGATTGAATCTGAAGG + Intergenic
1111947148 13:94677933-94677955 TCATCCAGGCTTGAAGCAGCAGG + Intergenic
1113724687 13:112589279-112589301 TCATGCAGCGTTTCAGCTGAAGG - Intergenic
1116973655 14:51094052-51094074 TCATCCGGTTTTGCAGCAGACGG - Intronic
1117048145 14:51833807-51833829 TCATTCATCATTGCAGCAGATGG - Intronic
1117973115 14:61271815-61271837 ACAGCCAGGTTTCCAGCTGAGGG - Intronic
1123130936 14:105984770-105984792 CCATCAAGGATTGCAGCTGTTGG + Intergenic
1123581164 15:21715991-21716013 CCATCAAGGATTGCAGCTGTTGG + Intergenic
1123617813 15:22158614-22158636 CCATCAAGGATTGCAGCTGTTGG + Intergenic
1130214781 15:81958001-81958023 TCATGCAGAATTCCAGCTGCTGG + Intergenic
1133255734 16:4514616-4514638 CCATCCAGGCCAGCAGCTGAAGG - Exonic
1133373992 16:5268554-5268576 TCCTCCACGATTGGAGCAGAGGG + Intergenic
1135702434 16:24643907-24643929 TCATCCACTATGGAAGCTGAAGG - Intergenic
1139281963 16:65778947-65778969 TCAGCCATCCTTGCAGCTGAGGG - Intergenic
1140924550 16:79569908-79569930 CCCTCCCGGATTCCAGCTGATGG - Intergenic
1141888096 16:86907022-86907044 TCAGGGAGGATGGCAGCTGAGGG + Intergenic
1143440141 17:6964997-6965019 TCCACCTGCATTGCAGCTGAGGG - Intronic
1146629643 17:34460539-34460561 CCATCCAGGAGTGCAGGTGCGGG + Intergenic
1148232419 17:45944695-45944717 TCATTCCGGTTTACAGCTGATGG + Intronic
1152062182 17:78085421-78085443 TCCTCCATGATTACAGATGAAGG + Intronic
1153584153 18:6604023-6604045 TGTCCCAGGATTTCAGCTGAAGG - Intergenic
1154048044 18:10926182-10926204 TCAGCCAGGAATGCCCCTGAGGG - Intronic
1159604579 18:70461742-70461764 TTTTCCAGAATTGCAGCAGAAGG - Intergenic
1160070621 18:75624822-75624844 TCTTCCAGGATTACAGCTTTGGG + Intergenic
1160074580 18:75660734-75660756 ACATCAAGAATTGCAGATGAAGG + Intergenic
1162063687 19:8111761-8111783 TCATCCAGGTCTGCAGGAGATGG + Exonic
1162722026 19:12668263-12668285 AAGTCCAGGATGGCAGCTGAAGG + Exonic
1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG + Exonic
1167279260 19:48557127-48557149 TAATTCAGGATAGCAGCTCAAGG + Intronic
1167527749 19:49995470-49995492 TGATCCAGGTCTGCAGGTGATGG + Intronic
927191050 2:20517208-20517230 TCGGTCAGGCTTGCAGCTGAAGG - Intergenic
927607026 2:24494616-24494638 TCTGCCAGGAAAGCAGCTGATGG - Intronic
928175965 2:29034610-29034632 TGACCCAGGCTTGGAGCTGAAGG + Intronic
928620998 2:33087625-33087647 TCTTCCATGATTGAAGCTGGGGG - Intronic
929732336 2:44509202-44509224 TCAGCCAGGATTTGAGCTCAGGG + Intronic
933600470 2:84324287-84324309 TAGCCCAGGATTGCAGCAGATGG + Intergenic
934136741 2:89002866-89002888 CCAACAAGGACTGCAGCTGAGGG + Intergenic
934647092 2:96065335-96065357 TCATCCAGACTTGAAGATGATGG - Intergenic
935325198 2:101929347-101929369 TCCTCCCTGATTGCAGCTCAGGG + Intergenic
935368060 2:102315366-102315388 TCAGCCAAGATTGCAGCAAAAGG - Intronic
935389623 2:102536688-102536710 GCATCCAGTAGTGCAGCAGAGGG + Intergenic
937010913 2:118561833-118561855 GCATCCAGGATTACAGGTGCTGG - Intergenic
937362294 2:121237685-121237707 GCATCCTGGATCGAAGCTGATGG + Exonic
938228035 2:129634758-129634780 TATTCCAGGATTGAGGCTGAAGG + Intergenic
939672574 2:145031477-145031499 TCTTCCAGGATTGCAGCACCAGG - Intergenic
941100263 2:161287066-161287088 TCCAACAGGCTTGCAGCTGAGGG + Intergenic
944916963 2:204370696-204370718 TCATCGTGCAGTGCAGCTGAGGG - Intergenic
948248265 2:236504564-236504586 TCATCCAGGTTTGCCAGTGAAGG - Intronic
1168793776 20:597592-597614 ACAGCCAGGATTCCAACTGAGGG - Intergenic
1171845923 20:30274674-30274696 ACATCCAGGAGTGCTGTTGATGG - Intergenic
1175283317 20:57819970-57819992 TCATCCAGGAGTGCAGCCCAAGG - Intergenic
1175342889 20:58246018-58246040 TGATCCAGGGTAGCTGCTGATGG + Intergenic
1176199162 20:63852488-63852510 CCCTCCAGGATGGCAGCTGCTGG + Intergenic
1176264621 20:64202730-64202752 TCATGCAGGATGCCAGCTGAGGG + Intronic
1178714863 21:34954992-34955014 TCACCCAGGAATCAAGCTGAAGG - Intronic
1178851151 21:36213412-36213434 TTATCCAGGGCTCCAGCTGATGG + Intronic
1179677414 21:42993123-42993145 TCAGCCTGGATTGCAGAGGAAGG + Intronic
1180097080 21:45560799-45560821 GCACCCAGGCTTGGAGCTGAGGG + Intergenic
1180637074 22:17269809-17269831 CCACCCAGGCTTGCAGCAGAGGG + Intergenic
1181059243 22:20274012-20274034 TTAGCCAGGATTCCTGCTGACGG + Intronic
1185399030 22:50606515-50606537 TCTTCCAGAATTGCATCTCAGGG + Intronic
949991426 3:9582485-9582507 TCAACCAGGAGTGCAGCAGACGG + Intergenic
950499698 3:13355809-13355831 CCAGCCAGGATTGCATCTGGGGG - Intronic
950752335 3:15139761-15139783 TCCTCCACGATTGGAGCAGAGGG + Intergenic
955487032 3:59445510-59445532 TCATTCTGGACTGTAGCTGAAGG + Intergenic
956307669 3:67843853-67843875 TAATACAGAATTGCATCTGATGG + Intergenic
956311237 3:67882910-67882932 TCAGCCAGGGCTGCAGCTGTTGG + Intergenic
957068272 3:75544530-75544552 TCCTCCATGATTGGAGCAGAGGG - Intergenic
957657162 3:83094880-83094902 GCAACCAGGACTGCTGCTGAGGG + Intergenic
962101807 3:132350692-132350714 TTATGCTGGATGGCAGCTGAAGG + Intronic
962159830 3:132987494-132987516 TCATCCAGGAGTGAGGCTGCAGG + Intergenic
964253458 3:154747498-154747520 TCTTCCTGGATTGCAGATGGTGG - Intergenic
964862842 3:161221324-161221346 ACAGCCAGGTTGGCAGCTGACGG + Intronic
969012625 4:4079105-4079127 TCCTCCACGATTGGAGCAGAGGG - Intergenic
969741239 4:9028668-9028690 TCCTCCACGATTGGAGCAGAGGG + Intergenic
969800579 4:9561555-9561577 TCCTCCACGATTGGAGCAGAGGG + Intergenic
970734244 4:19147519-19147541 TCATTCAGGTTTGCAGCAGATGG + Intergenic
970736287 4:19172629-19172651 TCATCCAAGCTTGTAGCTCAGGG + Intergenic
972212076 4:36850290-36850312 TCATCTATGATTGGAGTTGAAGG + Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
976295493 4:83466897-83466919 TCATCCAGGATCCAGGCTGAAGG - Intronic
976951378 4:90835689-90835711 TCATCCAAGATGACAGCTTAGGG + Intronic
979512578 4:121571124-121571146 TGAACCAGGCTTGCAGCTCAGGG - Intergenic
980640421 4:135570297-135570319 TGAGCCAGGATTTCAGCTGAGGG - Intergenic
981658181 4:147136056-147136078 TCATCCAGAAATGCAGATGTAGG - Intergenic
986320880 5:6632335-6632357 TCTTCCAGGAGGGAAGCTGAGGG - Intronic
989256761 5:39374371-39374393 CCTCCCAGGATTTCAGCTGAGGG + Intronic
995005845 5:107194513-107194535 TCATCGAGGATGGCAGCTAGGGG + Intergenic
995091871 5:108187640-108187662 TCTTCCCGGCTGGCAGCTGAGGG - Intronic
995712732 5:115051423-115051445 TCTACCAGGATGGCAGCGGAAGG + Intergenic
996262802 5:121494045-121494067 TCATCCAGGATTACAGCAGAAGG - Intergenic
997278710 5:132623129-132623151 TCATCCAGGACAGAAGATGAAGG - Intronic
997524674 5:134544582-134544604 CCATCCAGGCTTCCAGCTCAGGG - Intronic
999274361 5:150319164-150319186 TCCTCCTGGAATGCAGCTGGAGG - Intronic
1003867989 6:10381074-10381096 ACATACATCATTGCAGCTGAAGG - Intergenic
1006520656 6:34569133-34569155 TCCTTAAGGATGGCAGCTGAAGG - Intergenic
1007359051 6:41342330-41342352 TCCTGCAAGTTTGCAGCTGAAGG - Intronic
1011686682 6:89829452-89829474 TCATCCAGGAACGCGTCTGAGGG + Intergenic
1012889464 6:104882122-104882144 TCACCCAGGCTGGCTGCTGATGG - Intergenic
1015378781 6:132542744-132542766 TTATCCAAGATTGCAGATGATGG - Intergenic
1016435689 6:144034889-144034911 TGATCTAGGACTACAGCTGAAGG + Intronic
1016648823 6:146440676-146440698 TCATGCAGGGTTGCCGCTGTGGG + Intergenic
1016956058 6:149627804-149627826 TCATTCAGCACTGGAGCTGAGGG + Intronic
1019568240 7:1695307-1695329 TCCTCCAGGGCTGCAGCTCAGGG + Intronic
1019856186 7:3610631-3610653 TAATCCACAATTGAAGCTGATGG - Intronic
1020658130 7:10951627-10951649 ACATCTAGAATTGCAGCTGCAGG + Intergenic
1022796368 7:33734710-33734732 GCATCCAGGATTGCAGGAGGAGG - Intergenic
1023359719 7:39403118-39403140 TCACCCATTAATGCAGCTGAGGG - Intronic
1029071273 7:97900724-97900746 TCCTCCACGATTGGAGCAGAGGG - Intergenic
1029417894 7:100454985-100455007 TCATCCAGGCTTGACGCTGTGGG - Intergenic
1029619820 7:101683238-101683260 TCATCCAGGAATCCAGCGAAAGG + Intergenic
1030069373 7:105685744-105685766 CCATCCAGGATGGAAGCTCAGGG - Intronic
1030452573 7:109731256-109731278 TCATCCATGGCTGGAGCTGATGG + Intergenic
1032197975 7:129800189-129800211 TCATCCAGAGTTGCAGCCCATGG + Intergenic
1033270768 7:139930854-139930876 TCAGCCAGGGTGGCAGCTGTGGG + Intronic
1033652876 7:143355459-143355481 CCAGGCAGGGTTGCAGCTGAGGG - Exonic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1034761765 7:153679273-153679295 TCATTCAGGTTTGCCCCTGAGGG + Intergenic
1036180387 8:6579465-6579487 TAATGCAGGATTGCACCAGAGGG - Intronic
1036246439 8:7121257-7121279 TCCTCCACGATTGGAGCAGAGGG + Intergenic
1036254361 8:7193159-7193181 TCCTCCATGATTGGAGCAGAGGG - Intergenic
1036887833 8:12572742-12572764 TCCTCCACGATTGGAGCAGAGGG - Intergenic
1036895428 8:12630851-12630873 TCCTCCACGATTGGAGCAGAGGG - Intergenic
1038462542 8:27729125-27729147 TCATCCAAGATGGCATCTAAGGG + Intergenic
1040818289 8:51531498-51531520 TCATTCAGGCCAGCAGCTGAGGG - Intronic
1041643661 8:60229510-60229532 TCATCCAGGGTGGCAGCAGGAGG - Intronic
1043586758 8:81779110-81779132 TCATCCAGGAGGTCAGCTTAAGG - Intergenic
1043918910 8:85958565-85958587 TCATCCAGGATTACAGGTACTGG + Intergenic
1045989562 8:108289791-108289813 TCATGCTGGAATGCAGCTAACGG - Intronic
1047050141 8:121101955-121101977 TCATCCCAGGGTGCAGCTGAAGG - Intergenic
1052294332 9:26880717-26880739 TCACCCAGGAGTGCAGTTGTGGG + Intronic
1052398762 9:27974247-27974269 TCATGGAGGATTGCAGCTTGAGG - Intronic
1052412253 9:28136889-28136911 TCATTCAGGACTTCAGCAGATGG - Intronic
1061039818 9:128133912-128133934 TCATCCAGGAGTGAAACTGCTGG + Intergenic
1185811377 X:3113587-3113609 TCATCCATGTTGACAGCTGAGGG + Intergenic
1185934209 X:4237359-4237381 TCATCTACCATTGCATCTGAGGG + Intergenic
1186535613 X:10344055-10344077 TCATGCAGGACTCCAGTTGAAGG + Intergenic
1187111613 X:16307424-16307446 TCAGCCAGCACTTCAGCTGATGG - Intergenic
1188296062 X:28450635-28450657 GCATAGAGTATTGCAGCTGATGG + Intergenic
1190383841 X:49865255-49865277 TCATCCAGGACCACAGCTGTTGG - Intergenic
1195127074 X:101818919-101818941 TGATCCAGGCTTGCATCTCAGGG + Intergenic
1196548496 X:116994220-116994242 TCAGCCTGGTTTGCAGCTGTAGG + Intergenic