ID: 1166328904

View in Genome Browser
Species Human (GRCh38)
Location 19:42067581-42067603
Sequence AGGGACTCCTGGGGCAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166328904 Original CRISPR AGGGACTCCTGGGGCAAATC AGG Intronic
900992524 1:6104496-6104518 AGGGTCTCCTGGGCCAGCTCAGG + Exonic
903338919 1:22642341-22642363 AGGGACTCCTAGGGCCAAGTGGG + Intergenic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905975794 1:42172745-42172767 AGGCACGCCTGGGGCAGATGTGG + Intergenic
906946280 1:50297091-50297113 TTGGACTCCTGGGCCAGATCAGG - Intergenic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
912450589 1:109765333-109765355 AGGGACTCCTGGGGGGGCTCTGG + Intronic
913001613 1:114586248-114586270 AGGGACTTCTGAGGCAAAAGAGG - Intronic
913384151 1:118241382-118241404 GGGGACTCAGGGGGCAAACCTGG + Intergenic
914752619 1:150545827-150545849 AGGGACTCCTGGTGACAACCTGG - Intergenic
915289176 1:154871365-154871387 AGAGCCCCATGGGGCAAATCAGG - Intergenic
916865333 1:168850238-168850260 TGGCACTCCTGTTGCAAATCAGG + Intergenic
920310126 1:205043786-205043808 AGGGACTTCTGGGGCAGGCCAGG - Intronic
924462832 1:244274560-244274582 AGGAGATCCTGGGGCACATCTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1068496273 10:57788808-57788830 AAGAAGTCCTGGGGCAACTCAGG + Intergenic
1073536256 10:104279373-104279395 AGGCACTCCTTGGTCAAATGTGG - Exonic
1074115710 10:110456398-110456420 AGGGACACCTGGAGCAGCTCTGG - Intergenic
1075829920 10:125399893-125399915 AGGGGCTCCTGGGGACACTCAGG + Intergenic
1075898201 10:126016696-126016718 AGGGACACCTGGGAGAAATCTGG - Exonic
1076454450 10:130580078-130580100 AGGCTCCCCTGGGGCAAACCTGG - Intergenic
1076994701 11:292302-292324 AGGGGGTCCTGGGCCAAAGCAGG - Intronic
1077101220 11:823461-823483 AGGGATTCCAGGGGCAGAACGGG + Intronic
1077532043 11:3101900-3101922 GGGGACTTCTGGGGCAACTCAGG - Intronic
1078348925 11:10576363-10576385 AGGGACTCCTGGTGGAGCTCAGG - Exonic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1089082703 11:115790363-115790385 AGGGGCTTCTGGGGCAAAAAAGG - Intergenic
1089688242 11:120170241-120170263 AGGGGCTCCCGGGGCATCTCTGG - Exonic
1089700856 11:120242965-120242987 AGAGACACCTGGGGCAAACCAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1098885126 12:75953316-75953338 ATGGACTCCTGTAGCAGATCAGG - Intergenic
1102073076 12:110037703-110037725 AGGGACTCCTGGGCCCATCCAGG + Exonic
1106414801 13:29537507-29537529 AAGGACACCTGGGGAAAATGAGG + Intronic
1108727863 13:53201427-53201449 AGGGCCTCCTGGTGCACAGCGGG - Intergenic
1111648066 13:91057128-91057150 ATGAACTCCTGTGGCTAATCAGG - Intergenic
1111831944 13:93340940-93340962 AAGGACTCCAGGGGGAAATTTGG - Intronic
1112977684 13:105341206-105341228 ATGGATTCCTGGGGCAGAACTGG - Intergenic
1113887054 13:113666490-113666512 GGGTACACCTGGGGCACATCTGG - Intergenic
1119768504 14:77205736-77205758 AGGGGCTCCTGGGGCCAAGAGGG + Intronic
1122320374 14:100851803-100851825 GGGGACTGCCGGGGTAAATCTGG + Intergenic
1123973092 15:25527670-25527692 AGCGAGGCCAGGGGCAAATCAGG - Intergenic
1124624116 15:31298494-31298516 AGGGACTCCTGGGTAGAATCAGG - Intergenic
1125890061 15:43259028-43259050 GGGGCCTCCTGGGTCACATCAGG - Intronic
1126270541 15:46812333-46812355 AGTGACTCCTTGTGCAATTCTGG + Intergenic
1130419897 15:83734765-83734787 AGTGACCCCTGGGGGCAATCTGG - Intronic
1132459225 16:42082-42104 AAGGAGTCCTGGGGCAAAGGAGG + Intergenic
1132722240 16:1322161-1322183 ACGGACTCCTAGGGCACAGCAGG - Intronic
1133997007 16:10756041-10756063 ATGGACTTCAGGGCCAAATCTGG - Intronic
1136551156 16:30983314-30983336 CCGGACTGCTGGGGCAAGTCTGG - Intronic
1136569587 16:31088678-31088700 AGGGACTGCTGGGGCAGAGATGG + Intronic
1137052397 16:35725208-35725230 AGAGACACCTGGGCCACATCAGG - Intergenic
1138150850 16:54655494-54655516 AGGGACGGCAGGGGCAAATGGGG - Intergenic
1139372117 16:66475441-66475463 AGGGATCCCTGGGGAAAGTCAGG - Intronic
1139726307 16:68902075-68902097 TGGGGCTCATGTGGCAAATCAGG + Intronic
1142174647 16:88639518-88639540 AGGGTCCCCTGGGGAAATTCTGG + Intronic
1153601535 18:6785474-6785496 AGGGACCCCTGGGCCAAAGAAGG - Intronic
1156702470 18:39841810-39841832 AGGGTCTCCTGCGGCAGACCAGG - Intergenic
1160446949 18:78935470-78935492 AGGGACTCCTGGACCCAAGCAGG - Intergenic
1161140000 19:2641565-2641587 TGGGGCTCCAGGGGAAAATCTGG - Intronic
1161442858 19:4302341-4302363 TGGGCCTCCTGGTGCAGATCTGG - Exonic
1163386325 19:17002234-17002256 AGGGACCCCTGGGGCACACTGGG - Intronic
1163899048 19:20084511-20084533 TGGGGCTCCTGGGTCAAATGAGG + Intronic
1164371340 19:27646930-27646952 AGGGACTCCTGGGCAAATGCAGG - Intergenic
1164379011 19:27716512-27716534 AGAGACTCCTGGCCCAATTCAGG - Intergenic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1167283652 19:48586423-48586445 AGAGACTCCAGGGGAGAATCTGG - Intronic
1167724082 19:51199331-51199353 AGGGCCCCCTGGGGCAAGGCTGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168707407 19:58477853-58477875 AGGGACTCCTGGAGGAAGTGTGG + Intronic
926167098 2:10528051-10528073 AAGGACTATTGGGGGAAATCAGG + Intergenic
926467504 2:13208888-13208910 AGGCTCTCATGGGCCAAATCTGG + Intergenic
928400559 2:30975139-30975161 AGGGTGTCCTGGGGAATATCAGG + Intronic
928676265 2:33654638-33654660 AGGAAGTCCTGGGGCAACTGAGG + Intergenic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929457645 2:42077457-42077479 AGGGATTCCTGGGGCACAGGAGG - Intergenic
931761520 2:65421469-65421491 AGGGATTCCCTGGGGAAATCTGG - Intronic
932152768 2:69387649-69387671 AGGGAATCCTGGGGAACATAAGG + Intergenic
932627456 2:73308980-73309002 AGGGGCTCTTGAGGGAAATCTGG - Intergenic
932926572 2:75982158-75982180 ATGGCCTACTGGGGCAAAGCAGG - Intergenic
935749582 2:106219454-106219476 AGGCACTGATGGGGCAAATGAGG + Intergenic
936121716 2:109751863-109751885 AGGCACTGATGGGGCAAATGAGG - Intergenic
936222979 2:110619609-110619631 AGGCACTGATGGGGCAAATGAGG + Intergenic
937294589 2:120802157-120802179 ATGGACTCCTAGGGGAAGTCAGG - Intronic
938465515 2:131522324-131522346 AGGGACTTCTGGGGAAAGACTGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
947535011 2:230934737-230934759 TGGGACTCCTGGGGGGACTCTGG + Intronic
948863857 2:240765679-240765701 GGGGACTCCGGGGGCCAGTCAGG - Intronic
1168841388 20:912187-912209 TGGGACACCTGGGGCAACTGGGG + Intronic
1169809029 20:9590374-9590396 TGTGACTCATGGGCCAAATCTGG + Intronic
1171250736 20:23645141-23645163 GGGGTCTCCTGAGGCACATCTGG + Intergenic
1172002299 20:31788693-31788715 AAGGACTCCTGGGGCAGAGGTGG + Intronic
1174749595 20:53098805-53098827 AGGGACTCTTGGGATAGATCAGG - Intronic
1175862716 20:62158877-62158899 GGGGACTCCTGGGACATATCTGG - Intronic
1175862724 20:62158910-62158932 GGGGACTCCTGGGACATATCTGG - Intronic
1175862759 20:62159046-62159068 AGGGACTCTCGGGACATATCTGG - Intronic
1176422595 21:6527993-6528015 AGGGGCTCCTGGCCCAAATCAGG + Intergenic
1179698088 21:43136309-43136331 AGGGGCTCCTGGCCCAAATCAGG + Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1181069266 22:20322435-20322457 GGGGACTCCTGGGCCACCTCTGG + Intergenic
1182429459 22:30291344-30291366 AGGGGCTCTTGGTGCAAATCCGG + Intronic
1183507206 22:38215712-38215734 ATGGACTGCTGTGGCAAATAGGG + Exonic
1184839526 22:47044312-47044334 AAGGACTCCTGGGGAAAGGCAGG - Intronic
1185034131 22:48462433-48462455 AGAGACTCCTGGGGCTGATCAGG - Intergenic
951846405 3:27089296-27089318 AGGGACACGTGAAGCAAATCTGG - Intergenic
952407026 3:33014081-33014103 AAGGTGTCCTGGGGCAAGTCTGG + Exonic
952833517 3:37585141-37585163 AGAGACCCCTGTGGCAAAGCAGG - Intronic
952857121 3:37781427-37781449 TAGGACTCATGGGTCAAATCTGG - Intronic
959466437 3:106693035-106693057 AGGAACTCATTGGGCATATCTGG + Intergenic
961557253 3:127704834-127704856 AGGGATTGCTGGGTCAAATGGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961641133 3:128365362-128365384 AGGGTCTCCTGGGGCATCCCAGG + Intronic
961752918 3:129107845-129107867 AGGGACTCGTGAGGCCAGTCTGG - Intronic
963447676 3:145435761-145435783 AGAGAATCCTGGGGTAAAGCAGG + Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
967190371 3:186979458-186979480 AGGAACTCCTTGGGCAGACCTGG + Intronic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968597993 4:1495180-1495202 AGGGGCTCCCGGGGGAATTCTGG - Intergenic
968789386 4:2648960-2648982 AAAGACTCATGGGGCAGATCCGG - Intronic
969620444 4:8276222-8276244 AGAGACTTCTGGGGCAGAGCTGG - Intronic
973548029 4:52001772-52001794 AGGGACTCCAGGAGCCATTCTGG + Intronic
976922474 4:90456537-90456559 AGGAGGTCCTGGGGCAAATGAGG - Intronic
982525352 4:156470959-156470981 AGGTCCTCCTGGGGCAGATGGGG + Intergenic
987261093 5:16204113-16204135 AGGGCCTCCTGGGTCAGAACTGG + Intergenic
988020077 5:25610273-25610295 AGGAGGTCCTGGGGCAAATGAGG - Intergenic
988807104 5:34750747-34750769 AGGGACACCCGGGGCCATTCTGG - Intronic
992762547 5:79963210-79963232 AGGGACTCCTGGGAAAACTGAGG + Intergenic
997261937 5:132472051-132472073 AGGGACTCCCAGGGCAGGTCTGG + Intronic
997946069 5:138202609-138202631 AGGGCCTCCCTGGCCAAATCTGG + Intronic
998867659 5:146521515-146521537 AGGGACGCCTGGTCCAAACCAGG + Intergenic
1000215863 5:159155360-159155382 GGGGCCTTCTGGGGGAAATCTGG - Intergenic
1002965022 6:1956353-1956375 TAGGACTCATGGGCCAAATCTGG - Intronic
1003292095 6:4788562-4788584 AGGAACCCTTGGGGCAAATAAGG + Intronic
1004075301 6:12339500-12339522 AGGCATTACTGGGGCAAATCTGG + Intergenic
1004157676 6:13184450-13184472 TGGGACTCATGGGGCACAGCAGG - Intronic
1004162288 6:13225334-13225356 AAAGACTTCTGGGGCCAATCAGG - Intronic
1005286540 6:24333797-24333819 GGAGACTACTGAGGCAAATCAGG + Intronic
1005465385 6:26107791-26107813 AGGGAATCCTGGTGCAAACCAGG - Exonic
1007351633 6:41277740-41277762 GGGGACTCCTGGGTCACATTTGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1025639498 7:63353624-63353646 AGGGACTTAAGGGGCAAGTCGGG - Intergenic
1025643201 7:63394468-63394490 AGGGACTTAAGGGGCAAGTCGGG + Intergenic
1026324387 7:69296130-69296152 AGGGGCTCTTGGGTGAAATCTGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030596948 7:111551620-111551642 AAGGGCTCCAGTGGCAAATCAGG + Intronic
1031201754 7:118697286-118697308 TGGGACTGCTGGCGCAAACCTGG - Intergenic
1034689983 7:153006589-153006611 AGAGACAGCTGGGGCCAATCTGG + Intergenic
1035029647 7:155848875-155848897 AGGAATTCCTGGGGCAACCCTGG - Intergenic
1035305824 7:157930671-157930693 AGAGCCTCCTTGGGCAAAGCTGG + Intronic
1036774385 8:11600052-11600074 ATGGACTCCTGTGCCAAATAAGG - Intergenic
1037916199 8:22774937-22774959 AGGGGCTCCTGGGGAAGAGCTGG - Intronic
1040278562 8:46026168-46026190 AGGCACTCGTGGTGCAAACCAGG + Intergenic
1042544892 8:69942565-69942587 AGCCACTCCTGGGGAAAATCCGG + Intergenic
1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG + Intronic
1046165663 8:110431585-110431607 TGGGATTCCTGGGGCATATGTGG - Intergenic
1047026870 8:120833979-120834001 AGGTACTACTGGGGCAAGACAGG + Intergenic
1048351623 8:133621178-133621200 AAAGACTCCTGGGGGAAATCAGG - Intergenic
1052943656 9:34150048-34150070 AGGGACTCCTGCATCAAAGCAGG - Intergenic
1053199324 9:36142062-36142084 AGGGACCCCAGGGGGATATCAGG - Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059434202 9:114266572-114266594 AGGGACCCCAGGGGCCAATTGGG + Exonic
1060069235 9:120532075-120532097 GGGGACTCCTGTGGCCAAGCTGG + Intronic
1061326350 9:129867115-129867137 AGGGACTGCTGGGGCTGATTTGG + Intronic
1061570210 9:131473519-131473541 AGGGACTCCTGGGGCATCATGGG - Exonic
1061595080 9:131623740-131623762 AGGGACTCATGGGGCTGCTCCGG + Intronic
1061790848 9:133058070-133058092 AGGGCCTCCTAGGGCCATTCCGG - Exonic
1062694705 9:137867488-137867510 AGGGTCCCCTGGGGAAAATCTGG - Intronic
1187550364 X:20296798-20296820 AGGGAATTCTGGGGGAAATAGGG + Intergenic
1189492493 X:41481114-41481136 AGAGACTCGAGGGGGAAATCTGG + Intergenic
1190620600 X:52283880-52283902 AGGGAGTCATGGGCAAAATCTGG - Intergenic
1191229695 X:58084286-58084308 AGGGACACCTGGCTCAACTCAGG - Intergenic
1191233703 X:58117547-58117569 AGGAACACCTGGGGGAACTCAGG + Intergenic
1191236353 X:58137465-58137487 AGAGACTCCTGGTGCACATTCGG + Intergenic
1191240549 X:58186875-58186897 AGAGACACCTGGGGGATATCAGG + Intergenic
1191247292 X:58237969-58237991 AGGGACTCCTGTGGGACATCAGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1199157085 X:144562998-144563020 TGGGACTCCTGGGTCAAAGACGG - Intergenic