ID: 1166329199

View in Genome Browser
Species Human (GRCh38)
Location 19:42069099-42069121
Sequence GCGCAGAGCAGGCCCCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166329199 Original CRISPR GCGCAGAGCAGGCCCCTAGT GGG Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
902184721 1:14716740-14716762 TTGCAGAGCAGGGCCCTAGAGGG - Intronic
902817148 1:18922883-18922905 GAGAAGAGCAGGCCCCATGTTGG + Intronic
903631447 1:24776079-24776101 GCACAGAGCAGGCTCCAAGTAGG - Intronic
906691885 1:47798203-47798225 GCCCAGAGGAGGCACCTAATAGG + Intronic
906746626 1:48226432-48226454 ACACAGAGCAGGCACCCAGTGGG + Intronic
911548014 1:99244180-99244202 GCCCAGAGCAGGCAACAAGTGGG + Intergenic
922145669 1:222941592-222941614 GAGCAGAGCATGCCCATACTAGG - Intronic
1067288064 10:44921836-44921858 GCGCAGTGTAGGCCCTTCGTGGG - Intronic
1070913254 10:80136234-80136256 GTGCACATCAGGCCCCTAGCAGG + Intronic
1072654339 10:97319772-97319794 GCGCAGCGCAGGACCCCAGGGGG - Exonic
1072656545 10:97334232-97334254 GCGCAGCGCAGGGCCCCAGAGGG + Exonic
1074899051 10:117801234-117801256 CTGCAGAGCAGGCCCCTCCTGGG + Intergenic
1076599368 10:131647020-131647042 GCTGAGAGCCGGCCCCTAGCAGG + Intergenic
1077220885 11:1415675-1415697 GGGCAGAGCAGGCCCCGGGCAGG - Intronic
1081675776 11:44968153-44968175 ACGAAGAGCATGCCCCTGGTGGG - Intergenic
1083179725 11:60977398-60977420 GCCCTGAGCAGCCCCCTGGTAGG + Intronic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1084161582 11:67353237-67353259 GCCTAGAGGAGGCCCCTAGAGGG - Intronic
1084494716 11:69497262-69497284 GCTCAGAGCAGGGCCCTGGAAGG - Intergenic
1084696260 11:70757386-70757408 CCGCAGGGCTGGCCCCTAGCTGG + Intronic
1085302042 11:75464460-75464482 GCACGGAGCAGGCCCTTAGTGGG - Intronic
1085347607 11:75778344-75778366 GCGCAGAGGAGGCTCCAAGGAGG - Intronic
1088829162 11:113520587-113520609 GGGCACAGCAGGCTCCTAGAGGG + Intergenic
1091583580 12:1803178-1803200 GCCCAGGGCAGGCCCCAGGTGGG - Intronic
1096789174 12:54034509-54034531 CCGCAGAGCGCGCCCCTAGCCGG + Exonic
1106300788 13:28462854-28462876 GCACAGAGCAGGCCCCTATCTGG + Intronic
1111347333 13:86975139-86975161 GAGCAGAGGAGACCCCTAGTGGG - Intergenic
1113637094 13:111927068-111927090 GAGCAGAGCAGGGTCCCAGTAGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1118347695 14:64951725-64951747 GAGCAGAGCTGTCCCCTTGTAGG + Intronic
1119147535 14:72330729-72330751 TCTCACAGCAGGCCCCTTGTGGG + Intronic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121330547 14:93046911-93046933 GCCCAGAGCAGGCGGCTGGTAGG + Intronic
1122428366 14:101624540-101624562 GCTCACAGCAGGCCCCTTCTCGG - Intergenic
1122822690 14:104355146-104355168 CGGCACAGCAGGCCCCAAGTTGG + Intergenic
1122837077 14:104435615-104435637 GAGCAGAGCAGGCCCAAGGTAGG + Intergenic
1202940900 14_KI270725v1_random:144092-144114 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1128330227 15:66750862-66750884 AGGCAGAGCAAGCCCCTAGCAGG + Intronic
1128661115 15:69501719-69501741 GCACAGAGCAGGACCCTCGGAGG - Intergenic
1132603246 16:783144-783166 CTGCAGAGCAGGGCCCCAGTGGG - Intronic
1132831414 16:1930060-1930082 GCGCAGAGCCTGGCCCTGGTGGG - Intergenic
1135809875 16:25577393-25577415 GCACAGAGCAGGCCCCTGGGAGG - Intergenic
1137607555 16:49796678-49796700 GGTCAGAGGAGGCCTCTAGTAGG + Intronic
1141064734 16:80904814-80904836 GGGCAGAGCAGGCCCTTTGGTGG + Intergenic
1142236586 16:88925299-88925321 CAGCAGAGCAGGCCCCTTGTGGG - Intronic
1142247643 16:88977159-88977181 GCGCAGGGCAGGGCCCCAGATGG - Exonic
1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG + Intronic
1142815306 17:2420348-2420370 CCGCAGAGCAGGCCCACAGGGGG + Exonic
1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG + Intergenic
1145964317 17:28906201-28906223 GCGCAGCACAGGGCCCTGGTGGG + Exonic
1146530958 17:33607361-33607383 GCCCAGAGCCTGGCCCTAGTAGG - Intronic
1147924465 17:43938220-43938242 GCGCAGAGCAGGCGTCTGGAGGG - Intergenic
1148561064 17:48606447-48606469 GCGCAGAGCAGCCTCCAACTAGG - Intergenic
1150463384 17:65371468-65371490 GCGGAGATCAGGGCCCTGGTGGG - Intergenic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1152230675 17:79112652-79112674 TGGCAGAGCCGGCCCCTAGACGG - Intronic
1157498283 18:48171689-48171711 GCCCAGAGCAGGCACACAGTAGG + Intronic
1159925046 18:74261873-74261895 GAGCAGAGCGGGCTCCTAGCAGG + Intronic
1160018543 18:75163046-75163068 CAGCTGAGCAGGCCCCCAGTGGG - Intergenic
1160144242 18:76350637-76350659 CCGCAGAGCAGGCCCCTTGACGG + Intergenic
1165141730 19:33703940-33703962 GCACAGCGCAGGCTCCTAGTGGG + Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1168683164 19:58330911-58330933 GCACAGAGTAGGCACCTAATGGG + Intronic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
927859465 2:26551403-26551425 GGGAGGAGCAGGCTCCTAGTTGG - Intronic
932490409 2:72116359-72116381 GGACAGAGCAGGCCCCTCCTTGG - Intergenic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
938583690 2:132669778-132669800 GCGCAGGGCTGGCCCCGAGGTGG + Intronic
938763405 2:134444642-134444664 GCTCAAAGCAGGCTCCAAGTTGG - Intronic
943725220 2:191245684-191245706 GCGCGGAGCAGGCGCCTCGGGGG - Intronic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
944898607 2:204191396-204191418 AAGCAGAGCAGGTCCCAAGTGGG - Intergenic
946748103 2:222865647-222865669 GTGCAGAGCAGGCACAGAGTAGG + Intronic
948278672 2:236729506-236729528 GAGCAGAGCAGGCCTTGAGTGGG - Intergenic
948874989 2:240821263-240821285 GGGCAGCGCAGGCCCCTGCTGGG - Intergenic
1168902423 20:1376267-1376289 GCGTAAAGCTGGCCCCTTGTAGG + Intronic
1171385482 20:24766953-24766975 GCCCAGAGGAGGCCCCTCCTGGG - Intergenic
1171839747 20:30194705-30194727 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1172064127 20:32207487-32207509 GCGCAGACCGGGCCCCGGGTCGG + Intronic
1172637038 20:36416948-36416970 GCGTAGAGTTGGCACCTAGTAGG - Intronic
1176582259 21:8542849-8542871 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1178536594 21:33414939-33414961 ACGCAGAGCAGGTCCTGAGTTGG + Exonic
1178690444 21:34745776-34745798 GCCCAGAGAAGCCCCCTAGGAGG - Intergenic
1180116076 21:45705913-45705935 GCACAGAGCACGTCCCTTGTTGG + Intronic
1180176609 21:46093569-46093591 GCACAGAGCAGGCCCTGACTGGG - Intergenic
1180265094 22:10519897-10519919 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1182897883 22:33873799-33873821 GGGCAGGGCAGGACCCAAGTGGG - Intronic
1183742645 22:39677429-39677451 TCCCAGAGCAGGCCCGTGGTGGG + Intronic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184716125 22:46282763-46282785 GCTCAGAGCTGGCCCCTGCTAGG - Intronic
956989954 3:74751635-74751657 GCGGAGAGCAGGCCTGGAGTGGG + Intergenic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
967828169 3:193895428-193895450 GCACAGAGGAGGGCCCTAATTGG - Intergenic
968731020 4:2269253-2269275 AGGCAGGGCAGGCCCCAAGTCGG + Intergenic
968884601 4:3320963-3320985 GAGCAGAGGAGGCCCCTGGAGGG + Intronic
980745000 4:137001360-137001382 GCTCAGAGGAGACCCGTAGTGGG - Intergenic
983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG + Intronic
989425409 5:41290672-41290694 GTGAAGAGGAGGCCCGTAGTGGG + Intergenic
999767540 5:154752999-154753021 GGGCAGAGCAGGCCCAGGGTAGG + Intronic
1001144297 5:169170368-169170390 AGGAAGAGCAGGCCCCTAGCAGG - Intronic
1001971373 5:175957464-175957486 GCCCAGAGCAGGCTCCTAGGAGG - Intronic
1002246069 5:177886313-177886335 GCCCAGAGCAGGCTCCTAGGAGG + Intergenic
1006041776 6:31261944-31261966 CCGCACAGCAGGTCACTAGTGGG + Intergenic
1006829014 6:36957803-36957825 GCGCAGTGCTGGCACATAGTAGG - Intronic
1010954161 6:82071318-82071340 GCACAGAGCAGGCACCGAGCAGG + Intergenic
1013693170 6:112668572-112668594 GCACAGAGGAGGCCCACAGTGGG - Intergenic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1018845371 6:167551911-167551933 GAACAGAGCAGGCCCCTGGGTGG - Intergenic
1019300640 7:301811-301833 TCGCAGAGCAGGCACGTAGGTGG + Intergenic
1019624031 7:2006769-2006791 GCGCAGAGGAGGCTCCCAGATGG + Intronic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1035291227 7:157840600-157840622 CCACAGAGCAGGCCCCGTGTTGG + Intronic
1037832760 8:22198945-22198967 GGGCAGAGCCTGCCCCGAGTGGG - Intronic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1047795636 8:128252513-128252535 GCGAAGAGTAGTACCCTAGTGGG + Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049225777 8:141449868-141449890 GCCCTGAGCTGGACCCTAGTGGG + Intergenic
1049553594 8:143271716-143271738 GAGCAGAGGAGGTCCCAAGTAGG + Intronic
1050725547 9:8644325-8644347 GCTCAGAGGAGACCCATAGTGGG - Intronic
1051186533 9:14466633-14466655 GGGCAGAGAAGGCCCCTTGCTGG - Intergenic
1057193081 9:93098008-93098030 GCGCAAGGCAGGACCCCAGTTGG - Intronic
1058965176 9:110030841-110030863 TAGCAGAGCAGGCCACTGGTAGG + Intronic
1059455862 9:114399793-114399815 TCACAGAGCAGGCCCTTAGTGGG - Intergenic
1060758111 9:126227298-126227320 GAGCAGAGCCGGCACTTAGTAGG + Intergenic
1061004083 9:127918497-127918519 GCTCAAAGGAGGCCCCTAGGGGG - Intergenic
1062283580 9:135763025-135763047 AGGCAGAGCAGGCCCTGAGTGGG + Intronic
1203612277 Un_KI270749v1:20863-20885 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1187915579 X:24149913-24149935 GCGCCGAGCAGGCCCCGAGGAGG + Intronic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1198825304 X:140692483-140692505 GCGCATGGCAGGCCCCTAAGAGG + Intergenic
1199970676 X:152858462-152858484 GTTCAGAGCAGGCACCTAGGAGG - Intronic
1200243283 X:154508696-154508718 CCGCAGAGCAGGACACAAGTAGG + Intronic
1200418289 Y:2935565-2935587 GCGCCGAACAGGCCCCGAGGAGG + Exonic