ID: 1166331171

View in Genome Browser
Species Human (GRCh38)
Location 19:42078873-42078895
Sequence GCTCCTGGTGCTCCAGGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166331171_1166331174 -5 Left 1166331171 19:42078873-42078895 CCAGCTCCTGGAGCACCAGGAGC 0: 1
1: 0
2: 4
3: 53
4: 437
Right 1166331174 19:42078891-42078913 GGAGCTGCACCTGAAGATGATGG 0: 1
1: 0
2: 3
3: 22
4: 238
1166331171_1166331176 4 Left 1166331171 19:42078873-42078895 CCAGCTCCTGGAGCACCAGGAGC 0: 1
1: 0
2: 4
3: 53
4: 437
Right 1166331176 19:42078900-42078922 CCTGAAGATGATGGCACCCCAGG 0: 1
1: 0
2: 1
3: 21
4: 212
1166331171_1166331177 7 Left 1166331171 19:42078873-42078895 CCAGCTCCTGGAGCACCAGGAGC 0: 1
1: 0
2: 4
3: 53
4: 437
Right 1166331177 19:42078903-42078925 GAAGATGATGGCACCCCAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166331171 Original CRISPR GCTCCTGGTGCTCCAGGAGC TGG (reversed) Exonic
900364386 1:2304975-2304997 GCTCTGTGTGCTCCAGGAGTGGG + Intronic
901048772 1:6415639-6415661 TCACCTGGTGCCCGAGGAGCAGG + Exonic
901124020 1:6916701-6916723 GGTCCTGGGCCTCCAGGAGTTGG + Intronic
901145968 1:7064821-7064843 GGTCCTGTTGGTCTAGGAGCTGG + Intronic
901155569 1:7135526-7135548 ACTCTTGGTGCTGCAGGACCTGG + Intronic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901727837 1:11256171-11256193 GGTCCTGGTTCTCCGTGAGCTGG - Exonic
902097805 1:13960841-13960863 TCTCCTGGGGCTTCAGGACCTGG + Intergenic
902226002 1:14996798-14996820 GGCCCTGGAGCACCAGGAGCGGG - Intronic
902659681 1:17892382-17892404 GTCCCAGGTGCTCCTGGAGCTGG - Intergenic
902777661 1:18684940-18684962 GCTCCTGGTCCTCTGTGAGCTGG + Intronic
902806006 1:18861778-18861800 CCTCCTGGTGCTGCAGGAAGAGG + Intronic
902806324 1:18863434-18863456 CCTCCTGGTGCTGCAGGAAGAGG + Intronic
903212190 1:21824492-21824514 GCTCTTGGGGCTCCTGGGGCAGG - Exonic
905371215 1:37483545-37483567 GCTCCTGGACCCCCAGCAGCTGG + Exonic
905449216 1:38046380-38046402 GCGCCTGGTGCACCAGGGGGCGG - Exonic
905932843 1:41801773-41801795 GCCCCTAGGGGTCCAGGAGCAGG + Intronic
906944158 1:50281405-50281427 TCTCCTTGTCCTCCAGGAGAAGG - Intergenic
907526826 1:55058601-55058623 GCTCCAGTTTCTCCAGGAGTGGG + Exonic
907666780 1:56439855-56439877 ACAGCTGATGCTCCAGGAGCAGG + Intergenic
908253880 1:62286756-62286778 GGTCCTGGGGCCCCAGGAGGGGG - Intronic
908272798 1:62437135-62437157 GCTCCTGGCTCTCCCGGGGCGGG + Exonic
908351177 1:63287068-63287090 GATCCTGGGTCTGCAGGAGCTGG - Intergenic
908861752 1:68497201-68497223 CGTCCTGGGGCTCCAGTAGCTGG + Intronic
911188802 1:94927557-94927579 GCTATTGGTGTTCCAGCAGCGGG - Intergenic
911292100 1:96069596-96069618 GATCTTGGTGCTCCAGTATCGGG + Intergenic
911612361 1:99970587-99970609 GCTTCTTGAGCTCCAGGTGCTGG - Exonic
912378386 1:109231633-109231655 GGTCCTGGTGTTCCTGGAACAGG + Exonic
912383829 1:109261585-109261607 CCTCGAGGTGATCCAGGAGCAGG + Exonic
912758247 1:112342712-112342734 GCTGCTGGTGCTCCAGCTGTCGG + Intergenic
913122080 1:115751688-115751710 GCTCTAGGTGCTACAGGAGTAGG + Intronic
913156069 1:116099686-116099708 GCTCCTGATGCAGCAGGAGAAGG + Intergenic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
914917518 1:151827713-151827735 CTTCCTGGGGCTTCAGGAGCTGG + Intronic
915517471 1:156421608-156421630 GGCCCTGGCGCTCCAGGGGCGGG - Intronic
915551427 1:156637467-156637489 GCCTCTGCTGCTCCAGTAGCTGG + Intergenic
915724491 1:158007911-158007933 GCTCCAAATGCTTCAGGAGCAGG - Intronic
919142318 1:193588368-193588390 GCCCCTGGTGCACCAGCAGATGG - Intergenic
920227684 1:204450155-204450177 TCTCCTGGTTCTGCAGGAGGAGG - Intronic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
922795814 1:228338919-228338941 GCTCCAGGTGCTGCAGGTGGTGG - Exonic
922810850 1:228414760-228414782 GCTCGTGGTGCTCCTGGCACAGG + Exonic
923051264 1:230392881-230392903 GCTCCTGCTGCTCCAGGCTCTGG - Intronic
924039143 1:239966335-239966357 GTTCCTGGTGCTCTAGGATGAGG - Intergenic
924150411 1:241123908-241123930 TCTCCTGCTTCTCCAGGGGCAGG - Intronic
924694153 1:246382228-246382250 AATCCTGGGGCTACAGGAGCTGG - Intronic
924844416 1:247750515-247750537 GCTATTGGTTCTACAGGAGCTGG - Intergenic
1063347607 10:5326134-5326156 GCTCCTGGTTCTGCAGGCTCAGG - Intergenic
1063782678 10:9344369-9344391 ACTCCTTGTGCTCCAAGACCAGG - Intergenic
1064113439 10:12557785-12557807 TCCCCTGGTGGTCCAGCAGCTGG - Intronic
1065404269 10:25345969-25345991 GCTCCTCATGCTCAAGAAGCAGG - Intronic
1065818753 10:29506519-29506541 ACTGCTGGTGCTGCTGGAGCAGG + Intronic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1065954167 10:30677877-30677899 ACTGCTGGTGCTGCTGGAGCAGG - Intergenic
1067087764 10:43251943-43251965 ACCCCTGGTGATGCAGGAGCAGG + Intronic
1067769131 10:49110932-49110954 CCTCCTGGTGCTGAAGGTGCAGG - Intronic
1069819500 10:71218586-71218608 GGTCCTGGTGCTCCAGGGGGAGG + Intronic
1070393645 10:75992726-75992748 CCCCATGGTGCTCCAGGGGCTGG + Intronic
1070703348 10:78619084-78619106 GCTCCTGGGGGTGCAGAAGCAGG - Intergenic
1070832067 10:79424102-79424124 ACTCCTGCTACTCCAGGAGAAGG + Intronic
1072690568 10:97570214-97570236 CCTCCGTGTGCTCCAGCAGCAGG - Exonic
1072806115 10:98424918-98424940 GCGCCTGGTGTTTGAGGAGCTGG - Intronic
1073081283 10:100862588-100862610 GCTGCTGGTGTTCCAGCAGGTGG - Intergenic
1073480400 10:103783072-103783094 GCGCTTGGTGCCCAAGGAGCAGG + Intronic
1073498817 10:103918112-103918134 GCTCCTGGAGCTGCAGGCGGCGG - Exonic
1073707185 10:105998261-105998283 AATCCTGGAGCTGCAGGAGCTGG + Intergenic
1075999672 10:126905173-126905195 GTTCCTGGAGCTCCCGGGGCTGG - Intergenic
1076823835 10:132957421-132957443 GCTGTTAGTGCTCCAGGTGCGGG - Intergenic
1077426623 11:2482805-2482827 GCTGCAGGTGCACCAGGGGCAGG - Intronic
1077532682 11:3104570-3104592 GCTGCGGGTGCTCCAGGGGTGGG - Intronic
1078724830 11:13920708-13920730 GCTCCTGGACCTGCTGGAGCTGG + Intergenic
1079125106 11:17713456-17713478 GCTCCTGGAGCTGTAGGGGCTGG - Intergenic
1079456359 11:20639747-20639769 CCTCCTGGTACTCCAGAAACAGG + Intronic
1082106720 11:48229007-48229029 GCTGCTGGTGCTGCAGGCCCAGG + Intergenic
1082797726 11:57390106-57390128 GATCCTGGAGCATCAGGAGCTGG - Intronic
1083178919 11:60971939-60971961 GCCACTGGTGCTGGAGGAGCCGG + Intronic
1083662036 11:64255918-64255940 CCCCCTGGCGCTCCAGGACCCGG - Intronic
1083890172 11:65592064-65592086 GCTCCTTGTGGTCCAGGTCCCGG - Exonic
1083927675 11:65818318-65818340 GCTCCCGGCGTTCCAGGAGGGGG - Intergenic
1083961697 11:66018276-66018298 GCTCCTGGTGCTCCCAGGCCTGG + Intronic
1083962278 11:66021070-66021092 TATCCTGGTGCTGCAGGGGCTGG - Intronic
1084147445 11:67272619-67272641 GCTCCTACTGCTCCCGGAGCAGG - Intronic
1084151661 11:67290362-67290384 GCAGCTGGTGCTCCAGTATCGGG + Exonic
1084564371 11:69920897-69920919 CCTCCTGCTGCCCCAGGAGCGGG + Intergenic
1084730811 11:71072264-71072286 GCTGCTGGTCCTGTAGGAGCGGG - Intronic
1085266687 11:75241622-75241644 GCTCCAGGCGCGCCAGGCGCAGG - Exonic
1085392922 11:76191664-76191686 GCACCTGGTGCCCAAGGACCTGG - Exonic
1085415894 11:76318795-76318817 GCTCCTCCTCCTCCAGAAGCAGG - Intergenic
1087218212 11:95517782-95517804 CCTCCTGATCCTCCAGGTGCTGG - Intergenic
1089022223 11:115228133-115228155 GCTCCTGGGACTCCTAGAGCTGG + Intronic
1089315486 11:117588340-117588362 GCACTGGGTGCTCAAGGAGCAGG - Intronic
1089773025 11:120816779-120816801 GGTCCTGCTCCTCCAGTAGCTGG + Intronic
1090282008 11:125464497-125464519 CCTCCTTGCGCTCCAGTAGCTGG + Intronic
1090470559 11:126977430-126977452 GCTCCTGATCCTCCAGGATCAGG + Intronic
1090801819 11:130177681-130177703 GCTCTTGGAGCTACAGGACCTGG + Intronic
1092101001 12:5883673-5883695 GTTCCTGGTGGTAGAGGAGCAGG - Intronic
1093583201 12:20807421-20807443 GGACCAGGTGCTCCTGGAGCAGG + Intergenic
1096114893 12:49050107-49050129 GCTCCTGGACCCCGAGGAGCTGG - Exonic
1096549386 12:52362324-52362346 CCTCCTGGTACTCCTTGAGCAGG + Exonic
1097068312 12:56336894-56336916 CTTCCTGGTGCTGCAGGAGTTGG - Intronic
1100182033 12:92096112-92096134 GCTACATGTGCTCCTGGAGCCGG + Intronic
1101539470 12:105652001-105652023 GATCCATGTGCTCCAGGAGGTGG + Intergenic
1101924634 12:108960954-108960976 GATCCTGGTGCTCCGGGGCCTGG - Exonic
1102687183 12:114734280-114734302 GGGCCTGGTGCTCCAGGAGGAGG - Intergenic
1103212726 12:119178684-119178706 CCTCCTCTTGCTCCAGGAGCTGG - Exonic
1103698683 12:122836039-122836061 GATCCAGGTGCTCCCGGGGCCGG + Intronic
1103729919 12:123020601-123020623 TCTCCTGCTGCTCCCGGAGCTGG - Intronic
1103972357 12:124680032-124680054 GCTCCGGGTGCCCCAGGCCCTGG - Intergenic
1104339732 12:127937132-127937154 GAGCTTGGTGTTCCAGGAGCAGG - Intergenic
1104415581 12:128594540-128594562 GCTCCGGGTTCACCAGGTGCAGG - Intronic
1104641767 12:130471717-130471739 GCTCCTGCTGCTCCTGCTGCAGG + Intronic
1104924699 12:132308158-132308180 GCGCCTGGAGCCCCAGGAGCTGG + Intronic
1105014042 12:132775176-132775198 GCTGCTGGTTCTGCTGGAGCAGG + Exonic
1105020475 12:132813381-132813403 GCTCCTCCTTCTCCAGGGGCAGG + Exonic
1105070916 12:133234137-133234159 GCTCCTGCTGGTCCAGGACACGG + Exonic
1105291582 13:19056834-19056856 GTACCTGGTGCCCCAGGAGAAGG - Intergenic
1105440020 13:20407302-20407324 CCTCCGGGTGCTCCAAGGGCAGG + Intronic
1106295834 13:28412956-28412978 GCTCCTCTTGCTCCAGGAAAAGG + Intronic
1109303257 13:60611559-60611581 GCTTTTGGTGCTCTAGGGGCTGG + Intergenic
1112792803 13:103021665-103021687 GCTCCTGGGGCTACAGGCACAGG + Intergenic
1113661199 13:112107479-112107501 GCTCCTGATGCCCCGGGTGCAGG + Intergenic
1113937622 13:114002761-114002783 GCGCCTGGCTCTCCAGGAGTCGG + Intronic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1114528288 14:23379642-23379664 GAGCCTGGTGCTCCAGGATGTGG + Exonic
1115491194 14:33959983-33960005 GCTGCTGATGCTGCTGGAGCTGG - Intronic
1116895318 14:50310565-50310587 GCTTCCTGTCCTCCAGGAGCTGG - Intronic
1116919698 14:50560249-50560271 GGCCATGGTGGTCCAGGAGCTGG - Exonic
1117790061 14:59331239-59331261 CCTCCTGGTGCTCCAGGCGAGGG - Exonic
1118363458 14:65074992-65075014 GCTCCTGGTTCTGCAAGACCGGG + Intronic
1119712103 14:76829779-76829801 GCTCCTGGTGCTCCTGCTGTGGG + Intronic
1121086086 14:91147063-91147085 GCCACAGGTGCTCCAGGAGGAGG - Intronic
1122130744 14:99603518-99603540 GAACCTGGAGCTCAAGGAGCTGG - Exonic
1122647737 14:103206380-103206402 GCTCCTGGGGGTCCTGGTGCCGG - Intergenic
1122836082 14:104431780-104431802 CCTCCTGCAGCTCCAGAAGCAGG + Intergenic
1123097512 14:105773502-105773524 GCTCCTGGAGCTCAGGGAACAGG - Intergenic
1202860541 14_GL000225v1_random:78980-79002 CTCCCAGGTGCTCCAGGAGCCGG - Intergenic
1202862062 14_GL000225v1_random:89438-89460 TTCCCAGGTGCTCCAGGAGCTGG - Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124436418 15:29652733-29652755 GCTCCTGCTACTTCAGGAGCCGG + Intergenic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125506323 15:40269806-40269828 GCTGCTGCTGCTGCAGGTGCTGG - Intronic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125676087 15:41503276-41503298 GCACCTGGTCCTGCAGGACCCGG - Exonic
1127688283 15:61369905-61369927 GCACCCGGTGCTGCAGCAGCTGG + Intergenic
1128113876 15:65093541-65093563 GCTGTTTGTGCTCCAGGTGCAGG - Intronic
1128510969 15:68313747-68313769 GCTCCGGGGGCCCCAGGAGAGGG - Intronic
1129034141 15:72639632-72639654 GCTACTGCTCCACCAGGAGCTGG - Intergenic
1129215741 15:74097584-74097606 GCTACTGCTCCACCAGGAGCTGG + Intergenic
1129409061 15:75338852-75338874 GCTACTGCTCCACCAGGAGCTGG - Intronic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129672594 15:77615603-77615625 GCTCCAGCTCCTCCAGGTGCGGG + Exonic
1129732876 15:77941912-77941934 GCTACTGCTCCACCAGGAGCTGG + Intergenic
1131054196 15:89365926-89365948 GTTCCTGGAGCTGCAGGAGGAGG + Intergenic
1131507381 15:93030257-93030279 GCTGGTCCTGCTCCAGGAGCTGG + Intergenic
1132462800 16:63676-63698 GCCCCAGGTCCTCCGGGAGCTGG - Exonic
1132472366 16:112640-112662 GATCCTGGCGCTCCAGGATGAGG - Exonic
1132549403 16:548155-548177 GCTCCTGGTGGCCCAGCGGCGGG + Exonic
1132897094 16:2234223-2234245 CCTCCTGGTGCTTCTTGAGCAGG - Exonic
1132991512 16:2798174-2798196 GCCCCTGGTGCTGGAGGAGGTGG + Intergenic
1133118011 16:3589279-3589301 GCTGCTGGTGCTCAGGGGGCCGG + Exonic
1133203445 16:4218633-4218655 GCTGCTGGTGATGGAGGAGCAGG - Intronic
1133843779 16:9435576-9435598 GCTCCTGGAGCTCAGGGAACAGG + Intergenic
1134080476 16:11321381-11321403 CCACCTGGAGCTCCAGTAGCCGG + Intronic
1134311252 16:13077096-13077118 GGTCCTGGTGCTGCATTAGCTGG - Intronic
1135638435 16:24099272-24099294 GCTCCTGGTGACCGAGGAGAAGG + Intronic
1136413536 16:30090813-30090835 GCTCCCGGTTCTCCAGGCTCAGG + Exonic
1136608148 16:31350247-31350269 GTGCCTGGTGCTCCAGGGGCTGG - Intergenic
1136671719 16:31864593-31864615 GCTGCTGCTGCTGCAGGAGGAGG - Intergenic
1137270684 16:46900623-46900645 CCTCCTGGAGCTCTAGGAGTGGG + Intronic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1138449096 16:57082450-57082472 GCTCCTGGCTCTTCAGGTGCTGG - Exonic
1138561485 16:57803221-57803243 GCTCTAGGTGCCCCAGTAGCAGG - Intronic
1138594227 16:58021152-58021174 GCCCCTGCTGGTACAGGAGCAGG - Exonic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139573665 16:67828317-67828339 GCTGCCGGTACTCCAGGGGCAGG + Exonic
1139593801 16:67947077-67947099 GCTGCTGGTGCTGCTGAAGCTGG - Exonic
1139849303 16:69940990-69941012 CCTCCTGGAGCTCCAGGGGCTGG - Exonic
1139950178 16:70664685-70664707 TCTTCTGGTGCTCCAGGCTCAGG + Exonic
1140207458 16:72945492-72945514 CCTCCAGCTGCTCCAGGAGAAGG + Intronic
1141563371 16:84884975-84884997 GCTCCTGGTACTGCAGCAGTTGG + Intronic
1141608718 16:85169710-85169732 GCTCCTGCTGCTGCAGGAACGGG - Intergenic
1141674727 16:85511770-85511792 ACACCTGGAACTCCAGGAGCTGG + Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142121278 16:88387809-88387831 GCTCCTCTTGCTTCAAGAGCTGG - Intergenic
1142219637 16:88847597-88847619 GGCCCTGGTGCTCCAAGAGCCGG + Intronic
1142242059 16:88952045-88952067 GCTCCTGGGGCTGCTGGGGCCGG - Intronic
1142475110 17:184076-184098 GCTCTTGGCTCTGCAGGAGCTGG + Intergenic
1143109307 17:4544577-4544599 GCTCCAGCAGCTCCAGGACCAGG + Exonic
1143427592 17:6852583-6852605 GCTCCTGATGTTCTAGGGGCAGG + Intergenic
1144021136 17:11240981-11241003 GCGACTGGCGCTCCGGGAGCAGG - Intergenic
1144495343 17:15741976-15741998 GCTCCTATCGCACCAGGAGCAGG + Exonic
1144623553 17:16833089-16833111 GCCCCAAGTGCTCCAGGAACGGG - Intergenic
1145208053 17:20995072-20995094 GCTCCTATTGTACCAGGAGCAGG + Intergenic
1145794749 17:27649192-27649214 GCACCTGGGGCTCCAGCTGCTGG + Exonic
1146484009 17:33228884-33228906 CCTCCCTGTCCTCCAGGAGCTGG + Intronic
1147679019 17:42227618-42227640 GCACCAGGCCCTCCAGGAGCTGG + Exonic
1147686643 17:42289911-42289933 GCACCAGGCCCTCCAGGAGCTGG - Exonic
1147967584 17:44201342-44201364 TCTCACGGTGCTCCAGGTGCTGG + Intergenic
1148093179 17:45034813-45034835 GATCCAGGTGTTCCAGCAGCTGG - Exonic
1148347403 17:46912578-46912600 GCCCCGGGTGCTGCAGGAGGTGG - Intergenic
1149758776 17:59210301-59210323 GATCCTGGGGATCCAGGACCTGG + Exonic
1150069740 17:62140456-62140478 GCTGGAGGTGCTCCAGGCGCGGG - Intergenic
1150265471 17:63829871-63829893 GCTACAGCTGCTGCAGGAGCAGG + Exonic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1150627359 17:66849982-66850004 TCCCCTGGTGCTTCAGGAGGTGG + Intronic
1150744273 17:67803720-67803742 GCTCTGGGTGCTCCCTGAGCAGG - Intergenic
1151250261 17:72828761-72828783 GGTCCAGGTGCTGCTGGAGCAGG + Intronic
1151602332 17:75113924-75113946 GGGCCTGGAGCTCCAGGTGCAGG + Intronic
1151727258 17:75892290-75892312 GATCCGGGAGCTCCTGGAGCAGG - Exonic
1151880626 17:76892482-76892504 GGTCCTGGGGCTCCAGATGCAGG + Intronic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1152124434 17:78437905-78437927 TCTCCTCGTGGGCCAGGAGCTGG - Intronic
1152465486 17:80464033-80464055 GCTCCTTCAGCTCGAGGAGCTGG - Intergenic
1152754024 17:82079509-82079531 GCTCCTGGCGGTCCAGGCCCTGG + Exonic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1152945485 17:83195503-83195525 GGTCATGGAGCCCCAGGAGCCGG + Intergenic
1154040964 18:10855487-10855509 GCACCTGGTGGTCCTGGTGCCGG - Exonic
1154416635 18:14178932-14178954 GCTCGCTGCGCTCCAGGAGCAGG - Intergenic
1156498959 18:37544915-37544937 GATCCTGGGGCTCCAGGGACAGG + Intronic
1156829078 18:41468751-41468773 CCTCCTGGGGCTCCAGGTGGAGG + Intergenic
1157043637 18:44068834-44068856 CCTCCAGGTCCTCCAGGATCTGG + Intergenic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1157491153 18:48124739-48124761 GCTCCAGTTCCTCAAGGAGCAGG + Intronic
1157605252 18:48922375-48922397 TCCCCTGGTACTCCAGCAGCAGG - Intronic
1158490160 18:57902765-57902787 GCTCCTGCTTCTCCTGGAGCTGG - Intergenic
1159955362 18:74515159-74515181 GCTCCGGGTCTTCCAGGAGATGG + Intronic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1160211051 18:76880214-76880236 GCTCCTGGAGCTCTCAGAGCCGG + Exonic
1160297561 18:77651623-77651645 GCTCCTGCTGCTCCCTGACCAGG + Intergenic
1160500051 18:79396878-79396900 GGTCCTGCAGGTCCAGGAGCCGG - Intronic
1160510311 18:79449787-79449809 GGTCCTGGGGCTGCAGGAGTGGG + Intronic
1160701091 19:507773-507795 GCTGCTGCTGCAGCAGGAGCTGG - Exonic
1160790423 19:920394-920416 GTTCCTGGTGCTGCAGGCGCTGG + Exonic
1160817174 19:1041581-1041603 ATTCATGGTGCTCCAGGGGCGGG - Exonic
1161045571 19:2132629-2132651 GCTCCTGGTGACCCAGGCGTCGG - Intronic
1161109916 19:2463261-2463283 GCTCCTGGAGATCCAGGCTCCGG - Intergenic
1161420747 19:4174874-4174896 GCCCCAGGTGCTTCATGAGCCGG + Exonic
1161483375 19:4521891-4521913 CCTCCTGGTCCTGCAGGAGCTGG - Intergenic
1161526943 19:4762015-4762037 GCTCCTGCTGTTCCCGGAGCAGG - Intergenic
1161948785 19:7455576-7455598 GGTCCTGGTGACCCAGGAGCAGG + Intronic
1161953833 19:7482205-7482227 GCTCCTGGTCCTGCAGGAGGAGG - Exonic
1162032274 19:7922710-7922732 GCTCCAGGGGCACCAGGAACGGG - Exonic
1162143285 19:8597230-8597252 GCACCTGGTCCTCCGTGAGCAGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162572529 19:11481327-11481349 GCTCCTCCAGCTCTAGGAGCTGG - Intronic
1162718515 19:12648249-12648271 CCTCCTGCTCCGCCAGGAGCCGG + Exonic
1163006746 19:14401657-14401679 GACCCTGATGATCCAGGAGCGGG + Exonic
1163550768 19:17965489-17965511 GCTCCTGGTGGTCCAGGCAGGGG + Intronic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164477552 19:28586964-28586986 GCTCCAGGTCATGCAGGAGCAGG + Intergenic
1164640881 19:29824829-29824851 CCTCCTGGTGCCCCCTGAGCTGG + Intergenic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1165016207 19:32881947-32881969 CCTCCTGCTGCTCCAGCAGACGG + Exonic
1165355310 19:35300295-35300317 CCTCCTCCAGCTCCAGGAGCAGG - Exonic
1165860677 19:38907613-38907635 GCTACTGCTGCTGCAGGGGCCGG - Exonic
1166186265 19:41141136-41141158 GATCCTGGGGCTCCAGAGGCAGG + Intergenic
1166232219 19:41431528-41431550 CCGCCTGGTGCTTCAGGAGCTGG + Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166334899 19:42099788-42099810 GCTCCTCCAGCTCCAGCAGCTGG - Exonic
1166545745 19:43634185-43634207 GCTCCCTGAGCTTCAGGAGCGGG - Intronic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1167042085 19:47028313-47028335 GTTCCTGGAGCTCCAGGCGGAGG + Intronic
1167070602 19:47220096-47220118 GCTCCAGGTGCTCCTCCAGCTGG + Intergenic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167233074 19:48297503-48297525 GCTCCTGGAGCTCCACCTGCAGG + Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167492208 19:49799366-49799388 TCTCCCGGTGCTGCAGGAACTGG - Exonic
1167603153 19:50466130-50466152 CCTCCTGGGGCTTCAGGAGGAGG + Intronic
1167705618 19:51079384-51079406 GCTCCTGGGTCTCCAGGAGGTGG - Intronic
1168134727 19:54342657-54342679 GCTCCTGGTGTCCCAGGGCCAGG + Intergenic
925230112 2:2225662-2225684 CCTCCTGCTCCTCCATGAGCCGG + Intronic
926116736 2:10218158-10218180 GGTCCTGGTGGTACAGGAGGAGG + Intergenic
927696262 2:25241684-25241706 GCTCCTGGTGCTGAAGGACTTGG - Exonic
927980446 2:27371319-27371341 GCTCGTGCAGCCCCAGGAGCTGG - Exonic
927980447 2:27371322-27371344 GCTCCTGGGGCTGCACGAGCAGG + Exonic
930089224 2:47519839-47519861 GTTCCTGGTGCTGCAGGCCCTGG + Exonic
932039586 2:68285134-68285156 GCTCCTGGGGCACCAGATGCAGG + Intronic
934777478 2:96948691-96948713 GCTCTTGTTCCTCCAGGGGCTGG + Intronic
935318225 2:101859049-101859071 GCAGCAGCTGCTCCAGGAGCAGG + Exonic
935623445 2:105148295-105148317 GCTCCTGGTGCTGCTGCTGCTGG - Intergenic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
938381512 2:130838824-130838846 GCCCCAGAAGCTCCAGGAGCAGG + Intronic
940112903 2:150173765-150173787 GCTACTGTTGCCCCAGTAGCGGG - Intergenic
940453682 2:153871699-153871721 GCTCCAGCTGCTTCTGGAGCTGG - Intergenic
942449617 2:176100721-176100743 GCGCGTGGTGCTTCGGGAGCAGG + Exonic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945692028 2:213048104-213048126 GCTCTTGGTGATGCAGTAGCTGG + Intronic
946369156 2:219270123-219270145 TCCCCTGGGGCTCCAGCAGCTGG + Intronic
947065198 2:226216799-226216821 GCCCTAGGTGCTCCAGGGGCAGG - Intergenic
947748877 2:232522788-232522810 GCTCCTGGGGCTCCTGGGGCAGG - Exonic
948347974 2:237315057-237315079 CCTCCTTAGGCTCCAGGAGCAGG - Intergenic
948408000 2:237737101-237737123 ATTCCTGGTCCTCCAGGGGCAGG - Intronic
948585347 2:239015634-239015656 GCTCATGGCCCTGCAGGAGCTGG + Intergenic
948614006 2:239186727-239186749 TCTTCTGGTGCCCCAGGAGCTGG - Intronic
1169141258 20:3228511-3228533 GGCCCTGCTGCTCAAGGAGCAGG - Exonic
1170920055 20:20669522-20669544 GCTCCTGGTTGTCCAGCACCTGG - Intronic
1171988967 20:31681019-31681041 GCTTGAGGTGCTCCAGGAACAGG + Intronic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1172632488 20:36388405-36388427 GTTCTGGGGGCTCCAGGAGCTGG - Intronic
1172705456 20:36879163-36879185 GCTGCTGGTGCTCAGGGACCAGG + Exonic
1172987124 20:39000684-39000706 GCTCCTGGGTTTCCTGGAGCAGG + Intronic
1173819024 20:46008947-46008969 GGTCCTGGTGCTCCTGGTGCTGG + Exonic
1174021670 20:47535311-47535333 GCCACTGGGGCTTCAGGAGCTGG - Intronic
1174172855 20:48627951-48627973 GCTCAGGGTGCTCCTGCAGCAGG + Exonic
1174224325 20:48984753-48984775 GATCCAGTTTCTCCAGGAGCAGG + Exonic
1174425734 20:50430581-50430603 TCACCTGGTGCCCCAGGAGGTGG + Intergenic
1175276367 20:57773896-57773918 GTCCCTGGAGCTCCTGGAGCTGG + Intergenic
1175872304 20:62214275-62214297 GCTCCAGGGGCCCCAGGAGAGGG - Intergenic
1175872306 20:62214278-62214300 TCTCCTGGGGCCCCTGGAGCAGG + Intergenic
1175886687 20:62295922-62295944 GCTCCTGGTATTTCAGGGGCTGG + Exonic
1175892190 20:62320849-62320871 GTTCCAGGTCATCCAGGAGCAGG + Exonic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1176177441 20:63735383-63735405 GCTCCTGGGGCCCTAGAAGCCGG + Exonic
1177265275 21:18775123-18775145 CCTCCCATTGCTCCAGGAGCAGG - Intergenic
1178915003 21:36701165-36701187 GCTCCCGGGGCTCCAGAGGCCGG - Intronic
1180081820 21:45490651-45490673 ACTCCTGGCGCTCCGGGAGTGGG - Intronic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180228289 21:46411482-46411504 GCTCCTGGTCAGCCAGCAGCCGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181459419 22:23077576-23077598 GCTCCAGGTGTTGCAGGAGTGGG + Intronic
1182122723 22:27797872-27797894 GCTCCTGGGGCCCCAGGACCCGG - Exonic
1183218736 22:36498121-36498143 GGTGGCGGTGCTCCAGGAGCCGG + Exonic
1183371667 22:37436000-37436022 GCTCCTGGTTCTCCTGCAGCAGG - Intergenic
1183834501 22:40441150-40441172 TTTCCTGCTGCCCCAGGAGCTGG + Intronic
1183850888 22:40586896-40586918 GCTGCTGGTGCTGCTGGTGCTGG + Intronic
1183978203 22:41525273-41525295 GCTCCAGGAGCTGCAGGCGCTGG - Exonic
1184504756 22:44893919-44893941 GCTCCTGGGCTTCCGGGAGCTGG - Intronic
1184676089 22:46044276-46044298 ACCCCTGGTGCTCCAGGAGAAGG - Intergenic
1185059667 22:48599719-48599741 GCCCCTGGTTCTGCTGGAGCAGG + Intronic
1185069836 22:48649935-48649957 CCTCCTGGTGCCTCAGGAGCCGG + Intronic
1185148863 22:49153107-49153129 CCACCTGGAGCTCCAGGTGCTGG - Intergenic
1185391886 22:50566454-50566476 GCTCCTGGTGGTGGTGGAGCTGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950183180 3:10929136-10929158 GCTCCTGGTGGCCCAGGCTCTGG - Intronic
950403271 3:12787632-12787654 GATCCTGCTGCACCTGGAGCTGG - Intergenic
950408003 3:12816555-12816577 CCTGGTGGTGCTGCAGGAGCTGG + Exonic
950469184 3:13174110-13174132 GCTCTGGGTGCTCCTGGGGCAGG + Intergenic
950476023 3:13215359-13215381 GCTCCGTGTGCTCCTGGAGCAGG - Intergenic
950711958 3:14819435-14819457 GCCCCTGCTGCTCCGGGTGCAGG + Exonic
953023953 3:39134244-39134266 GGTCCAGGTGCCCCTGGAGCAGG - Exonic
954200551 3:49021098-49021120 GCCCCTGGTGCTCCGGGCGCTGG - Exonic
954263884 3:49458969-49458991 GATCCTTGTCCTCCAGCAGCTGG + Intergenic
954296174 3:49675566-49675588 GCTAGAGGTGCTCCAGAAGCTGG + Intronic
954363723 3:50135526-50135548 GTCCCTGGGGCTCCAGGATCAGG + Intergenic
954912269 3:54120843-54120865 GCACCTGGCGCTCCTGGAGAGGG + Intergenic
955402382 3:58601948-58601970 GCTCCTGGAGGTCAAGGAACTGG + Intronic
955835747 3:63053227-63053249 CCTCCTGGTGTTGCAGGAGTGGG + Intergenic
958524407 3:95236818-95236840 GATCCTGATGCTCCAGCAACGGG + Intergenic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
961336051 3:126180373-126180395 GCTCCAGGGGCTCCAGGACTCGG - Intronic
963335812 3:143972338-143972360 GCGCCTGGTGCCCCCGAAGCTGG + Exonic
964129756 3:153273506-153273528 GCTCCAGTTGTTCCAGCAGCAGG + Intergenic
965360555 3:167734516-167734538 GCCCCTGGTGCCCCGGGAGAGGG - Intronic
966431467 3:179835071-179835093 GTTCCTGGGGCTACAGAAGCTGG + Intronic
966861374 3:184232750-184232772 GCTCCTGATGGTTCAGGAGCAGG + Intronic
967118386 3:186361890-186361912 GCACCGGGTGCTCCCTGAGCCGG + Intronic
967171090 3:186824435-186824457 GCTCCTGGTGCCACAGGTGAGGG - Intergenic
968083651 3:195864056-195864078 GCTCCTGCTGCTCCCGGGGATGG - Exonic
968509606 4:989648-989670 GCTGCTGGTGCTGCTGGCGCTGG - Exonic
968674447 4:1870425-1870447 CCTCCAGGTGCTGCCGGAGCCGG - Intergenic
969321783 4:6417069-6417091 GCTGCCGGTGCTGCAGGACCTGG - Intronic
969411593 4:7031951-7031973 GCTCCTCGAGGTGCAGGAGCAGG + Exonic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
970165489 4:13232719-13232741 GCTCCTCCTGCTTCAGTAGCTGG - Intergenic
971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG + Intergenic
971616863 4:28801820-28801842 GCTCCTGGTAATCCAGGAAATGG + Intergenic
972630463 4:40837357-40837379 CCTCCTGGTGCTCTGGAAGCCGG - Intronic
972773343 4:42218867-42218889 GCTGCTTGTTCTTCAGGAGCAGG + Intergenic
973605100 4:52579065-52579087 GCTGCTGGTGCTGCTGGTGCTGG + Intergenic
976161971 4:82211256-82211278 GCAGCTGGTACTCCAGGGGCAGG - Intergenic
977507536 4:97921262-97921284 GATCCTGGGGCTGCCGGAGCAGG - Intronic
977795348 4:101158237-101158259 GCTGGTGATGCACCAGGAGCAGG - Intronic
978391815 4:108235218-108235240 GCTACTGGTGCCCCAGCACCTGG + Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
982088992 4:151864232-151864254 GCTCCTGGTGCTGCAGCAAGAGG + Intergenic
983309765 4:166044358-166044380 TCTCCTGGTGCTCCTGCTGCAGG - Intronic
983334897 4:166379054-166379076 GAGCCTGGTGCCCCGGGAGCTGG + Intergenic
984951278 4:185009549-185009571 GCCCCTGGAGCCCCAGAAGCTGG + Intergenic
985971268 5:3380601-3380623 GCACCTGGAACTCCAGAAGCTGG + Intergenic
985992990 5:3578569-3578591 GTACGTGGTGCTGCAGGAGCTGG - Intergenic
986287875 5:6373361-6373383 GATCCTGGAGCTCAAGCAGCCGG + Intronic
987062770 5:14258296-14258318 GTGCCTGCTGCCCCAGGAGCTGG - Intronic
990327800 5:54695389-54695411 GCACCTGTTGCTACAGGTGCAGG - Intergenic
990889360 5:60632158-60632180 GCCCCTGGTGCCCCAGGTTCAGG - Intronic
991559760 5:67937412-67937434 ACTCCTGGTCCTCCAGGCGATGG - Intergenic
992084847 5:73269284-73269306 GCTCCAGCTGCTCCAGGACCTGG - Intergenic
992467008 5:77016047-77016069 GCTCAGGGTGCTCCAGGAGCAGG - Intergenic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
996538364 5:124602249-124602271 AATTCTGGTCCTCCAGGAGCTGG + Intergenic
996584837 5:125074727-125074749 GCACCTGGAGCTCCAGGAAGGGG + Intergenic
996693299 5:126364895-126364917 GCCCCTGGTGCTCCAGGTGTGGG + Intronic
997292631 5:132748278-132748300 ACTCCTGGTCCCCCAGCAGCAGG - Intronic
997303481 5:132823086-132823108 CCTCCTGCCGCTGCAGGAGCCGG + Exonic
997437201 5:133884131-133884153 GCTCCCTCTGCTCCAGGAGAAGG + Intergenic
1001776542 5:174332967-174332989 CCTCCTCCTGCTCCAGGAGTGGG - Intergenic
1002047266 5:176549159-176549181 GCTCCTGGCGCTCCTGGGGCTGG - Intronic
1002255204 5:177953372-177953394 GCTCCGGGGGCTGCAGGAGGTGG - Intergenic
1002417336 5:179127345-179127367 GCTCCTTGTCCTCCAGGTGTGGG + Intronic
1002433560 5:179218215-179218237 GCTGCTGGTGCTCCAGGCTTTGG - Intronic
1002482932 5:179515362-179515384 GCTCCGGGGGCTGCAGGAGGTGG + Intergenic
1002690707 5:181048069-181048091 GCTCCTGCTGCTCCTGGTACAGG - Exonic
1003319081 6:5036470-5036492 GCATGTGCTGCTCCAGGAGCTGG + Intergenic
1006255424 6:32828935-32828957 CCTCCTGGAGCACCAGGATCTGG + Intronic
1007373811 6:41443216-41443238 GCTCCTGTTTCTCCAGGTGCTGG - Intergenic
1007406043 6:41637064-41637086 TGTCCTAGTGCCCCAGGAGCCGG - Intronic
1013366946 6:109443860-109443882 CCTCCTGCTGCCCCAGGAGTAGG - Exonic
1017687237 6:156925856-156925878 GCTCATGGTGCTCAAAGAACAGG - Intronic
1018144038 6:160866148-160866170 GCTCCTGGTGTTCCATGACTTGG + Intergenic
1018633921 6:165843913-165843935 GCTCCTGCTGCTCCAGGTGTGGG - Intronic
1019004978 6:168789382-168789404 CCTCCTGGAGCTCCAGGACAGGG - Intergenic
1019287331 7:230259-230281 GCTCCTGGAGCCCCCAGAGCTGG + Intronic
1019705998 7:2497685-2497707 GCTCGTGGGTGTCCAGGAGCTGG + Intergenic
1020000835 7:4754641-4754663 GCACCTGGTGACCCAGGATCGGG + Intronic
1020212817 7:6168555-6168577 GCACCTGCTGCTCTAGGGGCTGG - Intronic
1021610630 7:22454578-22454600 GCCCCAAGTGCTACAGGAGCTGG + Intronic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1023353066 7:39339682-39339704 GCTGCTGCTGCTGCTGGAGCTGG - Exonic
1024279917 7:47710372-47710394 TCTGCTGGTGCTGCAGGAGTTGG - Intronic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027414643 7:77962212-77962234 ACTCCTATTGCTCCAGGAGAAGG + Intergenic
1028909523 7:96192440-96192462 GATTCTGGTGCTCCACGAGCAGG + Intronic
1029110520 7:98211282-98211304 GCGCCTGGGGCTCCCGGACCAGG - Intergenic
1029537013 7:101163037-101163059 GCTCCTCCTGCTCCTGCAGCCGG + Exonic
1029596036 7:101538066-101538088 GGCCCTGGTGCTCCTGGGGCTGG - Intronic
1029676627 7:102074331-102074353 TCTCCCTGTGATCCAGGAGCAGG - Intronic
1034166410 7:149028363-149028385 GCTCCTGCTGCTCTTGGGGCTGG - Exonic
1034225478 7:149477672-149477694 GGGCCTGCTGCTCCTGGAGCTGG + Exonic
1034546952 7:151795317-151795339 GCTGCTGGTCCTCGAGGAGACGG - Intronic
1034602445 7:152273773-152273795 TATCCTTGTGCTGCAGGAGCCGG - Exonic
1034902318 7:154915178-154915200 GCACCCGGGGCTCCAGGCGCAGG + Intergenic
1034937985 7:155211995-155212017 GAGGCTGGTGCTGCAGGAGCTGG - Intergenic
1036806042 8:11834488-11834510 GCACCTGGGGCTCAAAGAGCCGG - Intronic
1037949057 8:23007049-23007071 CATCCTGGTGCTGCAGGAGCGGG + Exonic
1038145563 8:24892080-24892102 GCTGCTGGTTCCCCTGGAGCTGG + Intergenic
1041431567 8:57786990-57787012 TCTCATGGTTGTCCAGGAGCTGG - Intergenic
1043695634 8:83213123-83213145 GGACCTGCTGCTCCAGGAACTGG - Intergenic
1043866397 8:85380081-85380103 GCTCTTGGTTTTCCAGTAGCTGG - Intronic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1044621672 8:94196592-94196614 GCTACTTGTGATACAGGAGCTGG + Intronic
1044740093 8:95317296-95317318 GCTCCTGTAGCTCCTTGAGCAGG + Intergenic
1045737994 8:105318795-105318817 ACTCCAGGTGCTCCGGGCGCTGG - Exonic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1049160331 8:141093716-141093738 GCTCTTGATGCTCCAGGCCCAGG - Intergenic
1049295292 8:141830084-141830106 GAGCCTGGAGCTCCAGGTGCCGG + Intergenic
1049461541 8:142731710-142731732 GGCCCTGCTGCTGCAGGAGCGGG - Intronic
1049463706 8:142741601-142741623 GCGCCTGGTGCCCCAGGACTGGG + Intronic
1049597611 8:143491966-143491988 GCGCCTGGTGCACCAGGTGGAGG - Intronic
1049616451 8:143577691-143577713 GCTCCTGGTGGTGCAGCTGCTGG - Exonic
1049788233 8:144461534-144461556 GCAGCCAGTGCTCCAGGAGCCGG - Intronic
1049847015 8:144807738-144807760 ACTTCTGGTGCTGCAGCAGCCGG - Exonic
1052363901 9:27589788-27589810 GCTCATGGTGCTCAAGCAGTGGG + Intergenic
1052826076 9:33176077-33176099 GCTCCCCCTGCTCCAGGGGCAGG + Intergenic
1054777040 9:69132465-69132487 GGGCCTGGTGCTGCAGGAGAAGG + Intronic
1057135835 9:92687197-92687219 GCAGCAGGTGCTCCAGGAGTAGG - Intergenic
1057254743 9:93536363-93536385 GAGCCTGCTGCTCCAGCAGCTGG + Intronic
1057258171 9:93567650-93567672 CCTACTGGAGCTTCAGGAGCGGG - Intergenic
1057354585 9:94323054-94323076 GGTCCTGGAGCTTGAGGAGCAGG + Intronic
1057592802 9:96388302-96388324 GCTCCCGCTGCTCCTGCAGCCGG + Exonic
1057653172 9:96934581-96934603 GGTCCTGGAGCTTGAGGAGCAGG - Intronic
1058967247 9:110049239-110049261 CCTCCCGGTGCTCCCGGGGCAGG - Intronic
1060219028 9:121754747-121754769 GCTCCTGGGGTTGCAGGACCAGG + Intronic
1060918848 9:127406562-127406584 GCTCCTGGTCCTCTGGGACCTGG - Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061509229 9:131050254-131050276 GCTCAGGGTGCCCCGGGAGCGGG - Intronic
1061849346 9:133405292-133405314 GCTCCTTGATCTCCTGGAGCAGG - Exonic
1062126431 9:134865380-134865402 GCCCCTGGTCCACCACGAGCAGG - Intergenic
1062192045 9:135253129-135253151 GCTCCTGGAGCTGGAGGAGCAGG + Intergenic
1062400597 9:136370990-136371012 GCTCCTGGTGCTTGCGCAGCAGG + Exonic
1062482247 9:136757942-136757964 CCTCGTGGTGCTCCGGGCGCAGG - Exonic
1062495593 9:136830124-136830146 GCTCCTGGTGCTCCGGGCACTGG - Intronic
1062572668 9:137192814-137192836 GTTCCGGGGGCTCCAGGAGGGGG + Intronic
1062606076 9:137349447-137349469 CCTCCTGGTGCAGCAGGTGCTGG - Exonic
1185543927 X:926555-926577 ACACCTGGAGCCCCAGGAGCTGG - Intergenic
1186468646 X:9804196-9804218 GCTCATGGTGCAGCAGGAGGTGG + Intronic
1186785946 X:12956012-12956034 GCTTCTGCTGCTCCTGGTGCAGG - Intergenic
1187217011 X:17287002-17287024 GCTGCAAGTGCTTCAGGAGCAGG + Intergenic
1188746649 X:33852824-33852846 ACTCCTTGTGCTCAAAGAGCTGG + Intergenic
1189245626 X:39561282-39561304 GCTCCTGGTGCTGGAGGGCCAGG - Intergenic
1191197506 X:57740740-57740762 GAGCCTGGTGCTACAGGGGCTGG + Intergenic
1192382783 X:70635769-70635791 GATCCTGGGGCTGCAGGGGCTGG - Intronic
1192788137 X:74354401-74354423 GAGCCTGGGGCTGCAGGAGCTGG - Intergenic
1195069283 X:101263748-101263770 GTTTCTGGTGCTCCAGGAAATGG + Exonic
1196081523 X:111637775-111637797 GCCCCTGGTGCCTCAGGAACAGG - Intergenic
1199737008 X:150693920-150693942 CCTCCCGGGGTTCCAGGAGCTGG - Intronic
1200018369 X:153181927-153181949 GTTCCTGGAGCTCCAGGAAGAGG - Intronic
1200236042 X:154468200-154468222 CCACCCGGTGCTCAAGGAGCTGG + Exonic
1201177130 Y:11315979-11316001 CTTCCAGGTGCTCCAGGAGCCGG + Intergenic