ID: 1166331202

View in Genome Browser
Species Human (GRCh38)
Location 19:42079038-42079060
Sequence TGGCCCGGAGGTGCGTCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166331202_1166331212 12 Left 1166331202 19:42079038-42079060 CCGGCAGACGCACCTCCGGGCCA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1166331212 19:42079073-42079095 CTCCTGCCCCTGTTGTCCTGGGG 0: 1
1: 0
2: 6
3: 48
4: 337
1166331202_1166331218 29 Left 1166331202 19:42079038-42079060 CCGGCAGACGCACCTCCGGGCCA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1166331218 19:42079090-42079112 CTGGGGTCCCCAGTTGTTCTAGG 0: 1
1: 0
2: 1
3: 14
4: 210
1166331202_1166331219 30 Left 1166331202 19:42079038-42079060 CCGGCAGACGCACCTCCGGGCCA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1166331219 19:42079091-42079113 TGGGGTCCCCAGTTGTTCTAGGG 0: 1
1: 0
2: 1
3: 6
4: 68
1166331202_1166331210 10 Left 1166331202 19:42079038-42079060 CCGGCAGACGCACCTCCGGGCCA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1166331210 19:42079071-42079093 GGCTCCTGCCCCTGTTGTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 331
1166331202_1166331211 11 Left 1166331202 19:42079038-42079060 CCGGCAGACGCACCTCCGGGCCA 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1166331211 19:42079072-42079094 GCTCCTGCCCCTGTTGTCCTGGG 0: 1
1: 0
2: 4
3: 54
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166331202 Original CRISPR TGGCCCGGAGGTGCGTCTGC CGG (reversed) Exonic
900186991 1:1337301-1337323 AGGCCAGCAGGGGCGTCTGCAGG - Intronic
900194977 1:1371501-1371523 TGGGCAGGATGTGGGTCTGCAGG + Intergenic
900480577 1:2896189-2896211 TGGCCCGGGGATGCTGCTGCTGG + Intergenic
901081739 1:6587603-6587625 TGGCCTTGATGTGCATCTGCAGG - Exonic
902341915 1:15789173-15789195 TGGCCCTGAGATGCGTGTTCAGG + Intergenic
905379858 1:37554102-37554124 TGGGCGGGAGGTGCGACTTCTGG + Exonic
907905757 1:58782905-58782927 TGGCGCGGAGGTGCGGCTTCAGG + Exonic
912608598 1:111019213-111019235 AGGCCTGGATGTGTGTCTGCTGG + Intergenic
920886932 1:209938331-209938353 GGGCTCGGAGGTGCGCCGGCAGG + Intronic
921985315 1:221306073-221306095 TGTCCTGGAGGTGCGGCTGCAGG + Intergenic
922579937 1:226689407-226689429 TGGCCCGCAGCAGCGGCTGCTGG - Intronic
922809142 1:228406360-228406382 TGGGCCGCAGGTTCCTCTGCGGG + Exonic
1063680912 10:8187049-8187071 TGACCCAGTGGTGCGTCTGTTGG + Intergenic
1066153584 10:32650929-32650951 TGGCAGGCAGGTGGGTCTGCGGG + Intronic
1069588952 10:69630292-69630314 AGGCCCGGAGTCGCGCCTGCAGG + Exonic
1069590137 10:69636277-69636299 TGCCCCTGAGCTGCCTCTGCAGG + Intergenic
1074051841 10:109887498-109887520 AGGCCTGGAGGTGGGGCTGCAGG - Intronic
1074051968 10:109888297-109888319 TGGCCCAGAGCTGGGTGTGCAGG + Intronic
1076635530 10:131880031-131880053 TAGCCCGGAGGCTGGTCTGCAGG + Intergenic
1077446491 11:2593461-2593483 TGGCCTGGAGGTGATTCTGAAGG + Intronic
1078341618 11:10501389-10501411 TGGCCCTGAGCTGTGGCTGCAGG + Intronic
1078987060 11:16607066-16607088 TGGCCGGGAGCCGCGGCTGCCGG - Intronic
1082786266 11:57318726-57318748 TGGCCAGGAGGTGCTTCTTGGGG - Intronic
1085032883 11:73283387-73283409 TGTCCTGGAGGTGCCCCTGCCGG + Intronic
1091016727 11:132058250-132058272 TGGGCGGGAGGTGCTGCTGCTGG + Intronic
1092290282 12:7156244-7156266 GGGCCTGGAGGTGCGTGTGTGGG + Intronic
1096208294 12:49741827-49741849 TGGGGCGGAGGCGAGTCTGCGGG + Exonic
1097065757 12:56319319-56319341 TGACCCGGAAGTCCTTCTGCAGG + Exonic
1101466781 12:104957911-104957933 CGGCCCGGAGAGGCGTCCGCAGG + Intronic
1101574753 12:105987175-105987197 TGGCCAGGTGGTTCTTCTGCTGG + Intergenic
1102900295 12:116631316-116631338 TGGCCCTGACGTGGGTCTCCGGG - Intergenic
1104392479 12:128402620-128402642 TGGAACCGAGGTCCGTCTGCAGG - Intronic
1105009341 12:132745031-132745053 TGCCCGGGAGCTGCCTCTGCTGG - Intronic
1105303221 13:19153094-19153116 TGTCCCAGAGGTGCGTGGGCTGG - Intergenic
1105337456 13:19487027-19487049 TAGTCTGGAGGTGCATCTGCTGG + Intronic
1108632740 13:52302430-52302452 TGGTCTGGAGGTGCATCCGCTGG + Intergenic
1108653958 13:52510167-52510189 TGGTCTGGAGGTGCATCCGCTGG - Intergenic
1108654014 13:52510402-52510424 TGTCCTGGATGTGGGTCTGCTGG - Intergenic
1113896681 13:113768929-113768951 TGAGCAGCAGGTGCGTCTGCTGG - Intronic
1114555007 14:23556805-23556827 TGGCACAGAGGAGCGGCTGCAGG + Exonic
1115248394 14:31320175-31320197 TGGCGCGGAGTTGCAGCTGCAGG + Intronic
1118163011 14:63309729-63309751 GGGCCAGGAGGTTCCTCTGCAGG + Intergenic
1120170962 14:81247107-81247129 TGGCCCAGGGGCACGTCTGCTGG + Intergenic
1121645973 14:95517008-95517030 TGGCGCGGAGCTGCCTCTCCGGG + Exonic
1121890232 14:97583396-97583418 TGGCCCTGGGGAGCGTGTGCCGG + Intergenic
1122353505 14:101110812-101110834 TGCCCCGCTGGTGCCTCTGCTGG + Intergenic
1123124760 14:105938266-105938288 TGGCCTGGGTGTGTGTCTGCTGG - Intergenic
1125115044 15:36080746-36080768 TGGCCTGGAGGTGAGTCTGCTGG - Intergenic
1126713215 15:51484080-51484102 TGGCCTGGGGGTGTTTCTGCAGG - Intronic
1127670274 15:61188152-61188174 TGGCCCTGAGGTGTGTCGGGTGG - Intronic
1132407323 15:101551771-101551793 TGCCACTTAGGTGCGTCTGCAGG + Intergenic
1132616367 16:842859-842881 TGGGCCGGGGGTGCGTTGGCTGG + Intergenic
1134098561 16:11435792-11435814 TGGCCGGGAGCTGGTTCTGCTGG - Exonic
1134243362 16:12522051-12522073 TGGCCCCGAGGGGCCCCTGCTGG + Intronic
1137581615 16:49637012-49637034 TGTCCAGCAGGTGCTTCTGCAGG + Exonic
1141018335 16:80470815-80470837 TGGCCTGGAGATGCAGCTGCAGG + Intergenic
1143309424 17:5976233-5976255 TGGCCCAGATGTGTGTCTGTTGG - Intronic
1143487420 17:7262449-7262471 TGGCTCGGAGGTGAGCCAGCAGG + Exonic
1144642520 17:16945378-16945400 TGACCCAGAGTGGCGTCTGCAGG - Intronic
1144957895 17:19028721-19028743 TGACGCGGAGGTGGGTGTGCAGG + Intronic
1144977263 17:19145799-19145821 TGACGCGGAGGTGGGTGTGCAGG - Intronic
1146409081 17:32566474-32566496 TGGCCTGCAGGTGAGCCTGCAGG + Intronic
1147733393 17:42618313-42618335 TGGCCTGGAGGTGGGCCAGCTGG - Intergenic
1148552067 17:48556322-48556344 TGGCCCGGGGGTGAGGGTGCCGG + Intronic
1148806243 17:50265434-50265456 TGGCCTGCAGGGGAGTCTGCTGG - Intergenic
1149997920 17:61414569-61414591 TGGCCAGGAGGTGTGTCCGTGGG + Intergenic
1152103292 17:78315087-78315109 TTGCCCGGAGGTGGGCCTGGGGG + Intergenic
1152701613 17:81822545-81822567 TGACCCTGAGGTGCTGCTGCTGG - Exonic
1152747459 17:82048002-82048024 AGGCGGGGAGGTGGGTCTGCTGG + Exonic
1155216537 18:23648129-23648151 TGGCCCATAGGAGCATCTGCAGG - Intronic
1155654152 18:28176318-28176340 TTGCCCGGAGGAGTCTCTGCCGG - Intronic
1161379745 19:3958742-3958764 AGGCCCGGAGGAGGGTTTGCGGG - Exonic
1163640689 19:18460447-18460469 TGGCCAGGAGGTGTCTGTGCTGG - Intronic
1165049453 19:33132316-33132338 TGGCCAGCAGGTGCGTGTGCGGG - Exonic
1165739550 19:38197248-38197270 GGGCCCTGAGGTGTGTCTTCTGG + Intronic
1166211633 19:41310252-41310274 TGGGCCGGAGGTTAGTGTGCGGG + Exonic
1166331202 19:42079038-42079060 TGGCCCGGAGGTGCGTCTGCCGG - Exonic
927210713 2:20637438-20637460 GGGCCAGGAGGAGCGACTGCAGG + Intronic
927524107 2:23721482-23721504 TGGCCTGGGGATGTGTCTGCAGG - Intergenic
930090476 2:47528005-47528027 TGTCCCAGAGGTGAGCCTGCTGG - Intronic
934873235 2:97887339-97887361 TGGTCTGGAGGTGTGTCTGCCGG + Intronic
937221215 2:120344272-120344294 TGGCCAGCGGCTGCGTCTGCTGG - Intergenic
939178663 2:138780426-138780448 CGGACCGGAGGTGCCTCTCCCGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
944269046 2:197760392-197760414 TGGCCTGGGGGTGCATCTGCTGG - Intronic
944624759 2:201559364-201559386 TGGCCTGGTGATGTGTCTGCTGG - Intronic
948385132 2:237576226-237576248 TGGCCCGGAGATCCCTCGGCCGG + Intronic
948790605 2:240374644-240374666 TGGCCCCGAGGAGGGTCTGGTGG + Intergenic
1169091339 20:2862987-2863009 GGGGCTGGAGATGCGTCTGCAGG + Intronic
1169205595 20:3738683-3738705 TGTCCCGGAGATGGGCCTGCAGG + Exonic
1169403046 20:5299948-5299970 TGGGCTGAAGGTGAGTCTGCTGG + Intergenic
1175529342 20:59663386-59663408 TGGCCCTGATGTCCTTCTGCTGG - Intronic
1175893872 20:62327516-62327538 CCGCCAGGAGGTGCGCCTGCAGG - Exonic
1176736113 21:10548349-10548371 TGGTCTGGAGGTGCATCTGCTGG - Intronic
1180968965 22:19805072-19805094 TGGCCCGGCTGTGAGCCTGCTGG + Intronic
1183532986 22:38374271-38374293 TGTCCCGGATGTGTGTCTGCTGG + Intronic
1183533034 22:38374506-38374528 TGGTCTGGAGGTGCATCTGCTGG + Intronic
1185087744 22:48749784-48749806 TGGCCCTGGGCAGCGTCTGCAGG + Intronic
949505558 3:4724469-4724491 TGGCCCTGAGGTGAGTGTGCTGG + Intronic
950040844 3:9918193-9918215 TGGCCTGGGGGTCCTTCTGCTGG - Intronic
951705399 3:25539495-25539517 TGGCCAGGTGGTGAGTCTGTGGG - Intronic
954579573 3:51695958-51695980 AGGCCCGGAGGTGTGTCTGAGGG + Intronic
954972444 3:54662620-54662642 AGGCCAGCAAGTGCGTCTGCTGG + Intronic
958980124 3:100709985-100710007 TGGCCAGGAGGCGCGCCTGGGGG + Intronic
963941625 3:151101667-151101689 AGGCCTGGTGGAGCGTCTGCTGG + Intronic
968965200 4:3766101-3766123 GGGCCCGGAGGAGCGGCGGCCGG + Intergenic
969651552 4:8471160-8471182 TGTTCCGGAGCAGCGTCTGCAGG - Exonic
969656904 4:8503902-8503924 TGGCACCGAGGTGCGTGTGAGGG - Intergenic
970186019 4:13454866-13454888 TGGCCTGGGTGTGTGTCTGCTGG + Intronic
971449139 4:26783938-26783960 TGGTCCAGAGGTGCCTCTGGTGG + Intergenic
983542883 4:168931450-168931472 TGGCCCAGGGGTGTGTCTACTGG - Intronic
984024509 4:174526836-174526858 TGGCCCTGTGCTGCGTCAGCTGG + Intergenic
986239964 5:5951998-5952020 TGGCCCTGGGGTGGGTGTGCTGG + Intergenic
986330184 5:6712284-6712306 TGGCCCGGGAGTGCATTTGCGGG + Intergenic
987148773 5:15017823-15017845 AGGCCGGGAGGTGGGACTGCAGG + Intergenic
993904304 5:93605673-93605695 GGGCAGGGAGGTGCATCTGCGGG - Intergenic
998106583 5:139472829-139472851 GGGCCCGGTGGTGCTTCTTCAGG - Intergenic
999431878 5:151531677-151531699 TGGCACGGAGGTGCTGCAGCTGG - Exonic
1002080051 5:176732434-176732456 TGGGCCCGAGGTGCCTTTGCTGG + Intergenic
1003133462 6:3415260-3415282 TGGCCAGGAGATGCCTCTGTGGG - Intronic
1003172842 6:3733668-3733690 GGGCCCGGAGGTGTTGCTGCAGG - Intronic
1004845678 6:19639098-19639120 TGCCCCGGAGCTGCCTGTGCTGG - Intergenic
1005755668 6:28923431-28923453 TGGGCCGCATGTGCCTCTGCGGG + Exonic
1011717887 6:90125990-90126012 TGGCCAGGAGGGCCGGCTGCAGG + Intronic
1015565673 6:134567939-134567961 TGGCCTGGATGTGCCTGTGCTGG + Intergenic
1017756303 6:157532123-157532145 TGGCCCAGGGGTGTGGCTGCTGG - Intronic
1019404414 7:876294-876316 TGGCCCAGAGGCGGGTCCGCAGG - Intronic
1019575773 7:1737008-1737030 TGGGCGGGAGGTGGGGCTGCAGG - Intronic
1019708900 7:2509538-2509560 GGGCCGGCAGGCGCGTCTGCTGG - Intergenic
1022040104 7:26573039-26573061 TGACCCAGATGTGTGTCTGCAGG + Intergenic
1029662217 7:101970356-101970378 TGGCCCGGGGGTGCGTTGGAGGG + Intronic
1038692866 8:29779195-29779217 TGGCCCTGAGGTGCATCTCTAGG - Intergenic
1041244773 8:55879877-55879899 TGGCCCGGAGGCGCCACGGCCGG - Exonic
1049565394 8:143335355-143335377 TGGACAGCAGGTGCTTCTGCCGG - Intronic
1049780319 8:144425840-144425862 CTGCCCGGAGGTGCCACTGCGGG + Intronic
1049808799 8:144553959-144553981 CGGCCCAGAGGTGCAGCTGCTGG + Intronic
1050823605 9:9914730-9914752 TGGCCCGGGAGTGTGTCTGCTGG - Intronic
1053313942 9:37036589-37036611 GGGCCCGGAGGCGCCGCTGCTGG + Intergenic
1057995889 9:99821579-99821601 TCGCCAGGGCGTGCGTCTGCGGG - Intergenic
1060525692 9:124320155-124320177 TGGCCCTGAGGTGGGTGTGCTGG - Intronic
1061294241 9:129668116-129668138 TGGCCCGGATCTGGGTCTACAGG + Intronic
1185724478 X:2408402-2408424 ATGCCAGGAGGTGCCTCTGCTGG - Intronic
1189233328 X:39469264-39469286 TGACCCGAAGGTGGCTCTGCTGG + Intergenic
1202594404 Y:26521515-26521537 TGGTCTGGAGGTGCATCTGCTGG - Intergenic