ID: 1166333910

View in Genome Browser
Species Human (GRCh38)
Location 19:42094056-42094078
Sequence GCTGATCCTGAGCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166333907_1166333910 4 Left 1166333907 19:42094029-42094051 CCACATGCTTTCTTCACACTTGC 0: 1
1: 0
2: 3
3: 21
4: 251
Right 1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166333910 Original CRISPR GCTGATCCTGAGCCACAAGC AGG Intronic
900648216 1:3718482-3718504 GCTGACCCTGAGGCCCAGGCGGG + Intronic
901060729 1:6470833-6470855 GCTGAAGCTGAGCGACATGCTGG - Exonic
901238198 1:7678764-7678786 GCTGAGCCTGAGCCCCTTGCAGG + Intronic
902404170 1:16174038-16174060 GCTGATGCTGAGCCCCAGACGGG - Intergenic
902569699 1:17339269-17339291 GCTGGTCCTGAGCAAGAAGTGGG - Intronic
906648631 1:47494200-47494222 TCTGATCCTGAGCCACAAAGAGG + Intergenic
919640219 1:200039223-200039245 GCCGATCCTGAGCCAGAGGGCGG + Intronic
919745386 1:201005421-201005443 GCTGATCCAGTGCCTGAAGCAGG - Exonic
921848388 1:219907855-219907877 GCTGAACCTGAGGAACAGGCAGG + Intronic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
1063175172 10:3544284-3544306 GCAGATCCTAAGACACAGGCTGG + Intergenic
1063421224 10:5914211-5914233 GCTGATTCTGAATCACAAGATGG + Exonic
1071495267 10:86163690-86163712 TCTGGCCCAGAGCCACAAGCAGG + Intronic
1074933195 10:118150571-118150593 CCTGACCCTGAGCACCAAGCAGG - Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG + Intergenic
1077443061 11:2577727-2577749 GCTGTTCCTGAGAGACAGGCCGG + Intronic
1078355962 11:10631599-10631621 GCAGATCGTGAGCCACCATCTGG + Intronic
1078374245 11:10780228-10780250 GCTGATCCTGAGGTATAGGCAGG - Intergenic
1080651366 11:34225283-34225305 CCTGGTCCTGGGCCAAAAGCCGG + Intronic
1082267798 11:50138459-50138481 CCTGACCCTGTGCCTCAAGCAGG - Intergenic
1083414183 11:62514676-62514698 GATGAAACTGAGCCTCAAGCAGG + Intronic
1088094263 11:106079641-106079663 GCTGAACCTGAGCTGCAAGTTGG + Exonic
1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG + Intronic
1090205254 11:124880271-124880293 GCTGCTCCTCAGCCCCAGGCTGG + Intronic
1092114809 12:5992466-5992488 GCTGATTCTGGGCCTCAAACTGG - Intronic
1101397400 12:104360392-104360414 GCAGATGCTGAGCAACAAGTTGG + Intergenic
1101649059 12:106658522-106658544 GCAAATTCTGAGCCACAAGGAGG - Intronic
1109668140 13:65566351-65566373 GCTGATCTTGAACTACAAGTTGG - Intergenic
1113494905 13:110719323-110719345 GCTGATCCGCAGCCAGGAGCTGG + Exonic
1115981893 14:39061811-39061833 GCTGATACTGAGTCACAAACTGG + Exonic
1119563338 14:75608202-75608224 GCTTATCCTGAACCATGAGCCGG - Intronic
1121452257 14:94016479-94016501 GCTGCTCCTGAGCCAAGAGCAGG - Intergenic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1128218874 15:65953752-65953774 GCCAATCCAGAGCCCCAAGCAGG + Intronic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1130036269 15:80364517-80364539 GGTGATGCTGAGCTACCAGCTGG + Intronic
1132634676 16:937920-937942 GCTGATCCTGAACCACGCCCAGG + Intronic
1134114098 16:11535205-11535227 GCTGATGCTGACCCACACCCGGG - Intergenic
1139440891 16:66966324-66966346 GCTGGTCCTTAGCAAGAAGCTGG + Exonic
1139670582 16:68490380-68490402 AGGGATCCTGAGCCACAAGCAGG - Intergenic
1141375700 16:83528043-83528065 GCTGATAATGAGCCAGAAGTGGG + Intronic
1142210464 16:88806073-88806095 GCAGATCTTCAGCCAGAAGCTGG + Exonic
1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG + Exonic
1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG + Exonic
1143501542 17:7342295-7342317 CGTGAGCCTGAACCACAAGCTGG + Exonic
1148124174 17:45228436-45228458 GCTGACTCTGAGCCACCACCTGG - Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1150266802 17:63837466-63837488 GCTGCGCCTGGGGCACAAGCAGG + Exonic
1152031654 17:77846733-77846755 GCAGGGCCTGAGCCACAAGTGGG - Intergenic
1154344530 18:13531114-13531136 GCTGGTCCTGAGCCCAAGGCAGG - Intronic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1159378666 18:67628452-67628474 GCTGCTCCTGAGGCTGAAGCAGG - Intergenic
1161335446 19:3710457-3710479 GCTGAGCCTGAGGCATCAGCTGG - Intronic
1162548090 19:11343090-11343112 GCTGTTCCTGAGCCTTACGCTGG - Exonic
1165195846 19:34102605-34102627 GCTGCTCCTAAGCTACAAACCGG - Intergenic
1165341339 19:35214315-35214337 GCCCAGCCTGAGCCACAAGGCGG - Intergenic
1165993422 19:39828452-39828474 GCTGAACCTGACCCGGAAGCTGG - Exonic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
926160663 2:10487207-10487229 GGTGATCCTGAGTCACGAACAGG - Intergenic
926729635 2:16026495-16026517 GCTGACCCTGAGCCTCAGGGAGG - Intergenic
929370941 2:41223123-41223145 CCTGGGCCTGAGCCACTAGCGGG + Intergenic
931711181 2:64989835-64989857 GCTCAGCCTGAGCCGCACGCAGG + Exonic
934176399 2:89582896-89582918 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934286709 2:91657257-91657279 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
935496585 2:103789561-103789583 GCAGATTCTAAGCCAAAAGCTGG - Intergenic
937272535 2:120662089-120662111 GCGGATCCAGACCCAGAAGCTGG - Intergenic
938832320 2:135064334-135064356 GTTGATCCTGACCCACAGGTGGG + Intronic
942460247 2:176163444-176163466 TCTGATCCTGACCCAGAAGTGGG + Intronic
942850008 2:180473196-180473218 GCTGTTCCTAAGCCAAAATCTGG - Intergenic
944298514 2:198094692-198094714 GCAGATCCTGTTCTACAAGCAGG + Intronic
944530881 2:200667060-200667082 GCTGAGCCTTAGCCACACGATGG + Intronic
944550966 2:200844579-200844601 GCTCATCCTGGGCCACACTCAGG - Intergenic
948894450 2:240921768-240921790 GCCCCTCCTCAGCCACAAGCTGG - Intronic
1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG + Intronic
1178493448 21:33068756-33068778 GCTGAACCTGAGGCATAGGCAGG + Intergenic
1180867840 22:19129665-19129687 GCTGATCCTGAGGCCCACCCTGG + Intergenic
1181087709 22:20449982-20450004 GCTCCTCCTGAGCCACCTGCTGG + Intronic
1183078548 22:35441891-35441913 GGAGATCCAAAGCCACAAGCCGG + Intergenic
1183308352 22:37096011-37096033 GCTGATGCTGAGCCCCGAGGTGG - Exonic
1183366139 22:37408045-37408067 GCTGATTCAGTCCCACAAGCAGG + Intronic
1184687477 22:46103194-46103216 GCCGATCCAGAGCCACGGGCAGG - Exonic
955949224 3:64225323-64225345 GCTGATCCTGAGCCAGACCCGGG + Exonic
956121509 3:65970853-65970875 GCTGATCCTTAGCCACACTGTGG - Intronic
959501125 3:107107031-107107053 GCAGACCCTGAGCAAGAAGCAGG - Intergenic
960588882 3:119346303-119346325 GCTGATCCTCAGCAAGAAGGAGG - Intronic
960722756 3:120640892-120640914 GATGAACCTAACCCACAAGCTGG - Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
963042439 3:141079606-141079628 GCTGACCCTTAGCCGGAAGCTGG + Intronic
963100670 3:141600542-141600564 GCTGATCCTGAAGGCCAAGCTGG - Intronic
966072253 3:175893556-175893578 GCTGATTCTGGCCCACAGGCTGG - Intergenic
968910019 4:3472882-3472904 GCTGAAGCTCAGCCACAACCTGG + Intronic
969231932 4:5838216-5838238 GCTGACCCTGAACCCCAGGCAGG - Intronic
969847245 4:9929267-9929289 GCAGAGCCTGAGACACATGCTGG + Intronic
970860176 4:20693411-20693433 GCTGCTCCGGAGGCAGAAGCAGG + Intergenic
972747169 4:41946879-41946901 TGTGATCCTGACCCAAAAGCAGG - Intronic
975735461 4:77376883-77376905 GCTCATCCTGAGTCACAAAGAGG + Intronic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
977448250 4:97159785-97159807 CCTGAGCCTGAGCCACAAACTGG + Intergenic
980850070 4:138370726-138370748 TCTGATCTTGAACCCCAAGCAGG + Intergenic
986376414 5:7136521-7136543 GCTGATCACTAGCCACCAGCAGG + Intergenic
986909101 5:12532472-12532494 GCTGAGGCTGTGCTACAAGCAGG - Intergenic
989055129 5:37359268-37359290 GTTCATCCTTAGCCATAAGCAGG - Intronic
991020764 5:61977745-61977767 GCTGTACCCGAGCCACAAGGAGG - Intergenic
998452980 5:142249233-142249255 GCTGAGGCCAAGCCACAAGCTGG - Intergenic
1000199051 5:158989355-158989377 GCTGCTCCTGAGCCAAATGATGG + Intronic
1000397674 5:160792639-160792661 GGTATTCCTGAGTCACAAGCTGG - Intronic
1002314134 5:178332372-178332394 CATGATCCTGAGCCAGCAGCTGG + Intronic
1005743082 6:28810808-28810830 GCAGGTCCTGAGCCAAGAGCTGG - Intergenic
1009826370 6:68870290-68870312 GCGGCTCCTGAGCCACCAGTTGG - Intronic
1014484729 6:121984871-121984893 CCTGAGCCTGAGCCTCTAGCAGG - Intergenic
1015099997 6:129466336-129466358 AGTGACCCTGAGGCACAAGCTGG + Intronic
1017051787 6:150400129-150400151 GCTGCCCCTGAGCCACAGGAGGG - Exonic
1019327739 7:446495-446517 GCTGATCCTGAGCCCCCGTCAGG - Intergenic
1020959615 7:14786683-14786705 GCTGAGCCTGTGTCACAACCTGG + Intronic
1021899045 7:25264763-25264785 GATGATCCTGAGCATGAAGCTGG + Intergenic
1022705325 7:32796640-32796662 ACTGAACCTGAACCACAGGCAGG - Intergenic
1022872818 7:34497299-34497321 GCTCATCCTCAGCCACATTCAGG - Intergenic
1023259167 7:38341294-38341316 GGTCTTCCTGAGTCACAAGCAGG + Intergenic
1023709114 7:42973259-42973281 TCTGCTGCTGAGCCAAAAGCAGG + Intergenic
1028464218 7:91131645-91131667 ACTGATCCTGAGTCAAAGGCTGG - Intronic
1029363455 7:100102659-100102681 GGTGATGCTGAGACACAGGCAGG - Exonic
1029379552 7:100204101-100204123 CCTGCTGCTGAGCCTCAAGCAGG + Exonic
1035671386 8:1420201-1420223 GCTGATGCAGAGACTCAAGCTGG - Intergenic
1035775793 8:2187020-2187042 TCTGCACCTGAGCCACACGCTGG + Intergenic
1036644774 8:10605500-10605522 GCTTAGACTGAGCCACATGCAGG - Intergenic
1037386398 8:18347373-18347395 GCTGTTCCTCAACCACAGGCAGG + Intergenic
1041416080 8:57609927-57609949 GCTGTTCGGGAGCCACAGGCTGG - Intergenic
1041743108 8:61177333-61177355 ACTGGGCCTGAGCCACTAGCAGG + Intronic
1042940730 8:74105155-74105177 GCTGATTCTGAGACATCAGCAGG - Intergenic
1048750438 8:137667584-137667606 GCTAAGCCTGAGCAACAAGTAGG - Intergenic
1048951940 8:139503742-139503764 GCTGCTCCTGAGCCACCACCAGG - Intergenic
1052321594 9:27173318-27173340 GGTGTTCCTGTGCCACAGGCTGG + Exonic
1052659873 9:31415227-31415249 GCTGCTCTTGAGCTACAAGAAGG - Intergenic
1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG + Intronic
1057139721 9:92719066-92719088 GCTCATCCTGGGCCACACTCAGG + Exonic
1061034791 9:128107474-128107496 GCTGATCCTGGGCCGCAGCCTGG + Exonic
1062592353 9:137280069-137280091 GCTGATCCGCACCCACCAGCCGG - Exonic
1062637428 9:137498868-137498890 GCCTAGCCTGAGCCACAGGCAGG + Intronic
1187338249 X:18399371-18399393 CCTGATCCAGAGGCACAAGTAGG - Intergenic
1187861967 X:23691526-23691548 GCTGTTCCTGAGCCTAAGGCAGG + Intergenic
1194002834 X:88453101-88453123 GCTGAATCTGAAGCACAAGCAGG + Intergenic
1195037463 X:100982837-100982859 GATGATGCTGAGACACAATCAGG + Intronic