ID: 1166342098

View in Genome Browser
Species Human (GRCh38)
Location 19:42144345-42144367
Sequence TCCCATTAGCTCCCTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166342098_1166342108 18 Left 1166342098 19:42144345-42144367 CCTGCAAAAGGGAGCTAATGGGA 0: 1
1: 0
2: 3
3: 17
4: 135
Right 1166342108 19:42144386-42144408 AAGGCGGGAGAAGAAGGCAAAGG 0: 1
1: 0
2: 3
3: 61
4: 587
1166342098_1166342107 12 Left 1166342098 19:42144345-42144367 CCTGCAAAAGGGAGCTAATGGGA 0: 1
1: 0
2: 3
3: 17
4: 135
Right 1166342107 19:42144380-42144402 CCTCACAAGGCGGGAGAAGAAGG 0: 1
1: 0
2: 1
3: 29
4: 286
1166342098_1166342101 2 Left 1166342098 19:42144345-42144367 CCTGCAAAAGGGAGCTAATGGGA 0: 1
1: 0
2: 3
3: 17
4: 135
Right 1166342101 19:42144370-42144392 GCCCACCTGGCCTCACAAGGCGG 0: 1
1: 0
2: 2
3: 23
4: 282
1166342098_1166342109 23 Left 1166342098 19:42144345-42144367 CCTGCAAAAGGGAGCTAATGGGA 0: 1
1: 0
2: 3
3: 17
4: 135
Right 1166342109 19:42144391-42144413 GGGAGAAGAAGGCAAAGGCCAGG 0: 1
1: 1
2: 3
3: 65
4: 676
1166342098_1166342103 3 Left 1166342098 19:42144345-42144367 CCTGCAAAAGGGAGCTAATGGGA 0: 1
1: 0
2: 3
3: 17
4: 135
Right 1166342103 19:42144371-42144393 CCCACCTGGCCTCACAAGGCGGG 0: 1
1: 0
2: 2
3: 26
4: 234
1166342098_1166342100 -1 Left 1166342098 19:42144345-42144367 CCTGCAAAAGGGAGCTAATGGGA 0: 1
1: 0
2: 3
3: 17
4: 135
Right 1166342100 19:42144367-42144389 AGTGCCCACCTGGCCTCACAAGG 0: 1
1: 0
2: 3
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166342098 Original CRISPR TCCCATTAGCTCCCTTTTGC AGG (reversed) Intronic
900282243 1:1878205-1878227 TGCCATTAGCTCGCATTTGTTGG - Intronic
900792339 1:4688888-4688910 GCCCATTATCTCCCTTCTACAGG + Intronic
900821223 1:4890357-4890379 TCTCGTTAGCTCCCCTTTGCAGG - Intergenic
901316965 1:8316074-8316096 TGCAATTAGCTCCCATGTGCAGG + Intergenic
902652071 1:17843637-17843659 GCCCATGAGCTCCCCTTTACTGG + Intergenic
903075828 1:20765313-20765335 TTCCTTTAGCTCCCTTTTCATGG - Intronic
905603629 1:39275855-39275877 TGCCATTAGATCCCTCTAGCTGG + Intronic
905654571 1:39677742-39677764 TGCCATTAGCTTCCTTCTGAGGG + Intergenic
906379222 1:45321496-45321518 TCCTCTTTTCTCCCTTTTGCTGG + Intergenic
906609175 1:47190269-47190291 TGCCCTGAGCTCCCTTTTCCTGG + Intronic
907592440 1:55688206-55688228 TCTCATTATCTCCCTTTCCCAGG - Intergenic
909984779 1:82147263-82147285 TCCCATTATCTCCATTTTACAGG - Intergenic
910373106 1:86539275-86539297 TCCCATCTCCTCCCTTTTCCTGG + Intergenic
912543524 1:110434514-110434536 TCCCATTAGCTGCCTGCTGAAGG - Intergenic
915864813 1:159487781-159487803 TCCCTTTAACTCCTTTTTGGGGG + Intergenic
916678218 1:167082035-167082057 TCCCATTAAATCTCTTTTCCTGG - Intronic
919047896 1:192476342-192476364 TGCCATTAGCTCCCTTTTTCAGG + Intergenic
920503995 1:206503844-206503866 TCACATTACATGCCTTTTGCAGG - Intergenic
922793494 1:228323927-228323949 TCCCTTGAGGTCCCTTTTGAAGG + Intronic
1063568969 10:7197048-7197070 TACCATTACCTCCCGTGTGCAGG + Intronic
1064183150 10:13136703-13136725 TTCCATTAGTTCCATTTTGCAGG - Intronic
1064310098 10:14204630-14204652 GGCCCTTAGCTGCCTTTTGCAGG + Intronic
1065067082 10:21980590-21980612 TCCCATTAACATCCTTTTCCTGG - Intronic
1071458637 10:85870662-85870684 TGCCAATAGCTCCCTGTTCCAGG + Intronic
1076216355 10:128696889-128696911 TCCCATTCTCTTCCATTTGCTGG + Intergenic
1076441386 10:130483572-130483594 TCCCATTAGCTCGCCATTGCGGG + Intergenic
1080219675 11:29886840-29886862 TTACATTTGCTTCCTTTTGCTGG + Intergenic
1081188747 11:40077956-40077978 TCAGATTATCTCCCTTTTTCTGG - Intergenic
1082763817 11:57150770-57150792 TCCCCTTAGCTCCTGCTTGCTGG + Intergenic
1082838319 11:57667964-57667986 TCCCATTGGCTCCCTAGTCCGGG - Exonic
1088035064 11:105301309-105301331 TCCCATTAGAAACATTTTGCTGG + Intergenic
1088531851 11:110819273-110819295 TCCCACCAGCTGCCTTTTGCTGG + Intergenic
1088562499 11:111129945-111129967 TCCCCTAAACTCCATTTTGCTGG - Intergenic
1090080583 11:123609665-123609687 TCCCATTGGCTTCCTTTTGGGGG + Intronic
1092549927 12:9487204-9487226 CCCCCTTAGATCCCTTTTTCTGG - Intergenic
1096936601 12:55286850-55286872 TCCAATTAACTCCCATTTGTTGG - Intergenic
1102872846 12:116427464-116427486 TCCCATTACCTCCCCATTCCAGG - Intergenic
1103143254 12:118570813-118570835 TCTCATTACCTCCTTTTTGTGGG + Intergenic
1103736613 12:123064745-123064767 TCCCACTAGCTTTTTTTTGCAGG - Intronic
1104592321 12:130094461-130094483 TCCTATCATCTCGCTTTTGCTGG - Intergenic
1117112282 14:52470870-52470892 TCCTTTTTGTTCCCTTTTGCAGG + Intronic
1120112221 14:80570668-80570690 TTCCATTAGTTCCATTTTGCTGG - Intronic
1120677294 14:87435388-87435410 TCCAAATGGCTCCCTTTTTCAGG + Intergenic
1130068904 15:80629831-80629853 CCTCATTAGCTTCCTTTTGCAGG - Intergenic
1131183512 15:90256401-90256423 TCCCACTAGCCCCGTTTTCCTGG + Intronic
1133603523 16:7363652-7363674 AGCCATCAGATCCCTTTTGCTGG + Intronic
1134508060 16:14824086-14824108 TCTCGTTATCCCCCTTTTGCAGG - Intronic
1134851176 16:17480231-17480253 TCTCATTCGCTGCATTTTGCTGG + Intergenic
1134976067 16:18571837-18571859 TCTCGTTATCCCCCTTTTGCAGG + Intergenic
1135602098 16:23792246-23792268 CCCCATTTGCTCCCTTGTGGGGG - Intergenic
1136471184 16:30481581-30481603 TCGCGTGAGTTCCCTTTTGCAGG + Exonic
1136606163 16:31335318-31335340 TCTCATTAGCCACCTTTTGAGGG - Intergenic
1137094182 16:36232624-36232646 TCCCATTCGATTCCTTTTGATGG + Intergenic
1138538341 16:57672544-57672566 TATTATTAGCTCCATTTTGCTGG + Intronic
1138784038 16:59824770-59824792 TCCAATAAGCTCCCTTTCACTGG - Intergenic
1143505828 17:7364585-7364607 TATCATTAACTCCATTTTGCAGG - Intergenic
1144345784 17:14347922-14347944 ACCAATTAGCACCCTTATGCAGG - Exonic
1144732451 17:17536586-17536608 TCCCATGAGGTCACCTTTGCTGG - Intronic
1146569195 17:33938431-33938453 TCCTACTAGCTCCCTTCTTCTGG + Intronic
1148043385 17:44726352-44726374 TGCCCTCAGCTCCCTCTTGCAGG - Intronic
1148957667 17:51366870-51366892 TACCATTAGCTCCATTTTACAGG - Intergenic
1150127488 17:62647816-62647838 TCCCATGAGCTCCCTTTGTGAGG + Intronic
1150286129 17:63955268-63955290 TGCCAGTAACTCCCTTTGGCAGG + Intronic
1151339439 17:73460937-73460959 TTTTATTAGCTCCATTTTGCTGG + Intronic
1151719688 17:75847999-75848021 ACCCAGTAGCTCCCATCTGCAGG - Intronic
1152221784 17:79072752-79072774 TCCCATCAGCTTCCTGTTGCAGG - Intergenic
1154402257 18:14051343-14051365 TCCCCTTAGCTCCAAGTTGCAGG - Intergenic
1157527267 18:48393304-48393326 CCCCCTTGGCTCCCTTCTGCAGG + Intronic
1166342098 19:42144345-42144367 TCCCATTAGCTCCCTTTTGCAGG - Intronic
1168347884 19:55659759-55659781 TCCCAAGAGCTCCCTTCTCCTGG - Intronic
926939220 2:18117464-18117486 TCACATTTGCTCCATTTTTCTGG + Intronic
929549795 2:42882499-42882521 TCCCATTGGTTCTCTTTTTCAGG + Intergenic
933261607 2:80137518-80137540 TCCCATTACCTCCCTAGTCCAGG - Intronic
933426903 2:82125592-82125614 TCCTATTGGTTCCGTTTTGCTGG - Intergenic
933989132 2:87621123-87621145 CCCCATGACCTCCATTTTGCAGG - Intergenic
934077304 2:88439195-88439217 TCCCCTTAGCACCCTTTGTCTGG + Intergenic
934680769 2:96282424-96282446 TCCCTTGAGCTCACTCTTGCTGG - Intronic
935302019 2:101701307-101701329 TACCATTAGCACAGTTTTGCAGG - Intronic
936304711 2:111329703-111329725 CCCCATGACCTCCATTTTGCAGG + Intergenic
936673316 2:114684650-114684672 TCCCATTTGCCACATTTTGCCGG + Intronic
938400433 2:130986798-130986820 TCCCAATAGTTCCCTTTCTCTGG + Intronic
938592723 2:132755121-132755143 TCCCATTAGCTCCTTCTTACTGG + Intronic
941335863 2:164242470-164242492 TCCCACTAACTCCCCTTTGTTGG - Intergenic
942111138 2:172683781-172683803 TCCCATTCAGTCACTTTTGCTGG - Intergenic
943596922 2:189869314-189869336 ATCCATTAGCCCCCTTTAGCAGG + Intronic
944635194 2:201669205-201669227 TCCCATTTGTTCCCTAATGCAGG + Intronic
947088975 2:226488926-226488948 TGCAATCTGCTCCCTTTTGCGGG + Intergenic
948966386 2:241383802-241383824 TCCCATGGGCTCCCTAGTGCAGG - Intronic
1169063372 20:2677660-2677682 TCCCCTAAGTCCCCTTTTGCCGG - Intergenic
1169755616 20:9040106-9040128 TCCCAGTGGCTTCCTCTTGCTGG + Intergenic
1171163351 20:22948978-22949000 TCCCATTCTCTGTCTTTTGCAGG - Intergenic
1171207213 20:23290461-23290483 TCCCAGGAGCTCCCTCTTGCTGG + Intergenic
1172212736 20:33212459-33212481 TCCTCTGAGCTCCCTTCTGCAGG + Intergenic
1172673677 20:36652091-36652113 TCCTATGAACTCCCTTTTGTAGG - Exonic
1172877605 20:38175380-38175402 CCCCACCAGCTCCTTTTTGCTGG - Intergenic
1174038155 20:47680760-47680782 CCCCATTAGCTGCCGGTTGCTGG - Intronic
1178018650 21:28382503-28382525 TCTCATTATCTCCATTTTACAGG - Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1182956064 22:34427722-34427744 TCCCATCTGCTCCCATGTGCAGG + Intergenic
1183633680 22:39048169-39048191 TCCCAACAGCTCCCTCCTGCAGG + Intronic
1184064374 22:42108926-42108948 TTCCATCACCTCCCTTTTGAGGG + Intergenic
950308540 3:11935745-11935767 TCCCAAATGCTCCCTGTTGCAGG - Intergenic
951993637 3:28703202-28703224 TACCATGAGCACCATTTTGCAGG - Intergenic
956489823 3:69758876-69758898 TGCCATTAGCTCCATTTTATAGG - Intronic
963543422 3:146624272-146624294 TCACAGTAGCTCCATTTTACTGG - Intergenic
963682328 3:148393965-148393987 TCCCAGAAGCTCAGTTTTGCTGG - Intergenic
967360223 3:188622148-188622170 TACCATTATCTGCCTTTTACTGG - Intronic
967466522 3:189812638-189812660 TCCCATTTGTTCCCATTTGTAGG - Intronic
969839218 4:9868342-9868364 TCCCATAAACTCCCTTGGGCAGG + Intronic
970101752 4:12531274-12531296 TATCATTAGCTTCCTTTGGCAGG + Intergenic
972011879 4:34193035-34193057 TCCCATTATTTCCATTTTACAGG + Intergenic
974032116 4:56785406-56785428 TCCCATTGCCTGCCTTCTGCGGG - Intergenic
975010474 4:69344376-69344398 TCCAAATAGGCCCCTTTTGCTGG + Intronic
977175643 4:93816495-93816517 TCCTATTAGTTCTCTTTTCCTGG + Intergenic
977352338 4:95904316-95904338 TTCAGTTAGCTCCCTGTTGCAGG - Intergenic
985090792 4:186360821-186360843 TCCCATTAAGTCCCTATTTCTGG + Intergenic
989443119 5:41495273-41495295 TCTCATTAGCTCTCTTCTACAGG - Intronic
992766333 5:80004219-80004241 TCCCATTTTCTCCATTTTGCAGG - Intronic
994402889 5:99304594-99304616 TCTCATTAACTCCATTTTGGTGG + Intergenic
998351120 5:141502055-141502077 TCCCATTAGCCCCCTTCACCTGG + Intronic
1000627016 5:163550289-163550311 TCCCAGAAGCTTCCTTTAGCAGG + Intergenic
1000860240 5:166448897-166448919 TCTGATTGGCTTCCTTTTGCGGG + Intergenic
1001652873 5:173328005-173328027 TCCCAGTAGCTCCCGGCTGCGGG + Intronic
1002254398 5:177948665-177948687 TACCATCAGCTCCATTTTTCAGG + Intergenic
1002483595 5:179519147-179519169 TACCATCAGCTCCATTTTTCAGG - Intergenic
1003495644 6:6660976-6660998 ACCCTTTAGCTCCCTCTTCCTGG - Intergenic
1004269721 6:14184020-14184042 GCCCATGAGCTGCCTCTTGCAGG - Intergenic
1005407149 6:25501431-25501453 TACTATTATCTCCATTTTGCAGG - Intronic
1006300804 6:33192742-33192764 TCCCATTCCCTCCCTCTTGGGGG + Intergenic
1007165584 6:39826537-39826559 GCCCAATAGCTCCCCTTTCCTGG + Intronic
1008456999 6:51722601-51722623 TTCCAATAGCTCCCATTTACTGG - Intronic
1014888133 6:126807597-126807619 TCCCATTCCCTCCTTTTTTCAGG + Intergenic
1016597159 6:145815158-145815180 TCCCTTTAGCTCATTTTTGGAGG + Intergenic
1017166882 6:151416746-151416768 TCCAATTAGCTCCGTCATGCAGG - Intronic
1018193309 6:161330521-161330543 TCCCTTTTTTTCCCTTTTGCTGG - Intergenic
1028682149 7:93547876-93547898 TCCCATAAGCTCCTTTTTTAGGG - Intronic
1030100969 7:105944868-105944890 TCCCATTGGTTCTCTTTTTCTGG - Intronic
1033047669 7:137977216-137977238 TCCCACTTTCTTCCTTTTGCTGG - Intronic
1036988101 8:13559434-13559456 TGACATTAGCTCTCTTTTCCAGG + Intergenic
1041091899 8:54309889-54309911 ACCCGTTAGCTCCCTTTGGCTGG + Intergenic
1043039759 8:75248006-75248028 ATCCATTTGCTCCCTTTTCCAGG - Intergenic
1048163476 8:132041475-132041497 TCCCATGAGCTCACTTTTTTTGG + Intronic
1048622628 8:136151535-136151557 TCCCCTGAGCTCTCTTTGGCTGG + Intergenic
1051179558 9:14395983-14396005 TCCTTGTAGCTCCCTGTTGCCGG + Intronic
1051521044 9:17988638-17988660 TCAAATTGGCTCCCTTTGGCAGG - Intergenic
1055945117 9:81687117-81687139 TCCCATTGTTTCCCTTTTGCCGG - Intronic
1056974655 9:91240780-91240802 TCCCATGAGCTCCCTTTTGGTGG + Intronic
1060075210 9:120584768-120584790 TCCCATTAATTCCCTTTTGCTGG + Intergenic
1061207400 9:129172984-129173006 TCCCAGCAGCTCCATGTTGCTGG + Intergenic
1062177298 9:135170899-135170921 TTCCATTAGCTCTCATTAGCTGG + Intergenic
1191932316 X:66387719-66387741 TTACATTAGCTTCCTTTTGTTGG + Intergenic
1192371231 X:70514653-70514675 ACCCATTTCCTCCATTTTGCAGG - Intergenic
1194344346 X:92744685-92744707 GCACATTAGCTCCTTTTTGCTGG - Intergenic
1198079882 X:133229484-133229506 TTGCATTAGCTCCTTATTGCAGG + Intergenic
1198191185 X:134307920-134307942 TCCCAATTTCTCCATTTTGCCGG - Intergenic
1200652691 Y:5861326-5861348 GCACATTAGCTCCTTTTTGCTGG - Intergenic