ID: 1166342340

View in Genome Browser
Species Human (GRCh38)
Location 19:42146222-42146244
Sequence CTGGAGACACAGATGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166342334_1166342340 26 Left 1166342334 19:42146173-42146195 CCATTTTACAGAGGAAAACACTG 0: 2
1: 20
2: 258
3: 1942
4: 7059
Right 1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG 0: 1
1: 0
2: 3
3: 28
4: 303
1166342333_1166342340 27 Left 1166342333 19:42146172-42146194 CCCATTTTACAGAGGAAAACACT 0: 1
1: 12
2: 212
3: 1691
4: 6283
Right 1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG 0: 1
1: 0
2: 3
3: 28
4: 303
1166342332_1166342340 28 Left 1166342332 19:42146171-42146193 CCCCATTTTACAGAGGAAAACAC 0: 1
1: 6
2: 167
3: 1289
4: 4880
Right 1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG 0: 1
1: 0
2: 3
3: 28
4: 303
1166342337_1166342340 -1 Left 1166342337 19:42146200-42146222 CCAGCAAAGTTAAATCACTTGGC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG 0: 1
1: 0
2: 3
3: 28
4: 303
1166342335_1166342340 0 Left 1166342335 19:42146199-42146221 CCCAGCAAAGTTAAATCACTTGG 0: 1
1: 0
2: 2
3: 41
4: 259
Right 1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG 0: 1
1: 0
2: 3
3: 28
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166342340 Original CRISPR CTGGAGACACAGATGGAACC AGG Intronic
900291965 1:1927456-1927478 CTTCAGACACAGCTGGATCCAGG - Intronic
900726211 1:4218012-4218034 CTGCAGCCACAGGCGGAACCAGG - Intergenic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902233399 1:15042667-15042689 CTGGAGACAGAGGGAGAACCTGG - Intronic
903663092 1:24990639-24990661 CTTCAGGCACAGATGGATCCGGG + Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904041067 1:27585605-27585627 CTGAAGACACACAAGGAAACGGG + Intronic
911084705 1:93966668-93966690 CTGGAGACTCAGGAGGCACCTGG - Intergenic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915532171 1:156508998-156509020 GTGGACACAGAGATGGCACCAGG + Intergenic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
916518935 1:165545844-165545866 CTGGAGCCACTGATGTAATCCGG + Intronic
916677221 1:167074231-167074253 CTGGAGTCACAGGTGCACCCAGG - Intronic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918706393 1:187668294-187668316 CTAGGGACACAAATGGAATCAGG + Intergenic
919690895 1:200527504-200527526 CTTCAGACACAGCTGGATCCAGG + Intergenic
923544557 1:234914700-234914722 CTGGAGATACAGCTGTAAACAGG + Intergenic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067268226 10:44766185-44766207 CTGGAGACGAAGATAAAACCGGG - Intergenic
1067467750 10:46513642-46513664 ATGCAGACACATATGGAACCAGG + Intergenic
1067619436 10:47870963-47870985 ATGCAGACACATATGGAACCAGG - Intergenic
1071350346 10:84734460-84734482 CTGGAGATACTGATGGTACCAGG - Intergenic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1076190505 10:128479924-128479946 CTGGCGATCCAGATGGAAGCAGG - Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077209828 11:1364783-1364805 CTGGAAACACTGCTGGTACCAGG + Intergenic
1078021181 11:7656974-7656996 TTGAAGACACACATGGACCCTGG - Intronic
1079125267 11:17714337-17714359 CTGGGGACAGAGAGGGGACCTGG + Intergenic
1081577765 11:44329923-44329945 CTGGAGTCACAGCTGGCACTTGG - Intergenic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1082115297 11:48321481-48321503 ACAGAGACACAGCTGGAACCTGG - Intergenic
1082258378 11:50057805-50057827 ACAGAGACACAGCTGGAACCTGG + Intergenic
1082833160 11:57634348-57634370 CTGGAGATTCAGTGGGAACCTGG - Intergenic
1083193544 11:61069340-61069362 CTGGAGACACACTGGGTACCTGG - Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083398122 11:62405233-62405255 CTGGAGAGACAGGTGGGAACAGG + Intronic
1084409834 11:69000396-69000418 CTTCAGACACAGCTGGATCCAGG - Intergenic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1088625555 11:111727783-111727805 CTGGAGTCACAGTTGGTCCCAGG + Exonic
1088810484 11:113388366-113388388 CTGGAGAGAAGGATGGAAGCAGG - Intronic
1090947359 11:131443086-131443108 CTGAAGACGGAGATGGAAACAGG - Intronic
1093361748 12:18237759-18237781 CTAGAGACAGAGATGCAAGCTGG + Intronic
1096156194 12:49342633-49342655 CGGCAGGTACAGATGGAACCAGG + Intergenic
1096426793 12:51510751-51510773 CTAGAGAAAGAGATGGCACCAGG + Exonic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1100853416 12:98737156-98737178 CTGGAGGCAGAGATGGCAGCTGG - Intronic
1101045368 12:100799827-100799849 CTGGAGACTCACATAGCACCTGG + Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102955990 12:117059315-117059337 CCGGGGACACAGAGGGACCCGGG - Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1104803048 12:131567841-131567863 CTGGGGACTCAGCTGGACCCTGG - Intergenic
1105964912 13:25374777-25374799 CTGGGGACACTGATGGAAACAGG + Intronic
1106157210 13:27170853-27170875 CTGGACACACGGCTGGAAACGGG + Intronic
1106766285 13:32917001-32917023 CTAGAGACAAAGAGGGCACCAGG + Intergenic
1107856716 13:44623428-44623450 CAGGAGAAACACATGAAACCGGG + Intergenic
1110567489 13:76970747-76970769 CAGGAGAATCAGTTGGAACCGGG + Intergenic
1110593808 13:77295449-77295471 CTTGAGACACAGATGGATCCGGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113274620 13:108714956-108714978 GTGCAGGCAAAGATGGAACCTGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115453693 14:33577540-33577562 ATGGAAACACAGAGAGAACCAGG + Intronic
1118472462 14:66087484-66087506 GTGGAGACACAGAAGACACCCGG - Intergenic
1118752663 14:68817977-68817999 TTGGAGAAACAGCTGGATCCTGG - Intergenic
1118924155 14:70176309-70176331 TTGGAGACAGTGATGGAACCAGG + Intronic
1119040760 14:71272225-71272247 GAGGAGCCACAGAAGGAACCTGG - Intergenic
1119977249 14:79038842-79038864 CCAGAGATCCAGATGGAACCAGG - Intronic
1121024638 14:90606335-90606357 CTGGAGAAACACATGGCAACGGG + Intronic
1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG + Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1124046675 15:26156818-26156840 CTGGAGCCACAAGTGGAAACTGG - Intergenic
1126238241 15:46410295-46410317 CTGGAGTCTGGGATGGAACCAGG - Intergenic
1127327834 15:57912709-57912731 TTGGAAACACAGACAGAACCTGG - Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128786917 15:70404354-70404376 CCTGAGGCACAGATGGATCCAGG - Intergenic
1129111615 15:73340337-73340359 CTGGAGACACGAATGGATGCTGG + Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129596451 15:76967954-76967976 CAAGAGACACAGCTGTAACCTGG + Intergenic
1130092387 15:80831681-80831703 AAGGAGATACAGTTGGAACCTGG - Intronic
1130849838 15:87782172-87782194 CTTCAGGCACAGCTGGAACCAGG + Intergenic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1131982339 15:98006278-98006300 CTGGAGACAGTGATAGAAACAGG - Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1136079686 16:27843678-27843700 CTTCAGACACAGCTGGATCCAGG - Intronic
1136565053 16:31064780-31064802 ATGGTGAGACAGATGGAACCTGG - Exonic
1137291697 16:47055856-47055878 CTGGAGATACTGATGGCAGCAGG - Intergenic
1138332650 16:56227398-56227420 CTGGAGACAGGGTGGGAACCAGG - Intronic
1139937311 16:70580686-70580708 CAGGAGACACACTTGAAACCAGG + Intronic
1139967315 16:70752962-70752984 ATAAAGACACAGAGGGAACCTGG + Intronic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1143539595 17:7561311-7561333 CTGGAGATAGTGATGGAAACTGG - Exonic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148695374 17:49555402-49555424 CTGGGCACACAGGTGGAACCAGG - Intergenic
1149432224 17:56603506-56603528 TTGGAGCCCCAGATAGAACCTGG - Intergenic
1149488058 17:57059882-57059904 CTTCAGACACAGTTGGATCCAGG - Intergenic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1151680646 17:75620992-75621014 CTGGACACTCAGGTGGCACCAGG + Intergenic
1152351300 17:79785310-79785332 CTGGAGCCACAGGTGCCACCGGG - Exonic
1152581623 17:81167885-81167907 CTGAAGACACAGACTGAACGAGG - Intergenic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154459949 18:14572914-14572936 CTGTAGACAAACATGGACCCTGG + Intergenic
1154971380 18:21413163-21413185 CTGGACACACAGAGGGCAGCAGG - Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158529023 18:58241465-58241487 CTGAAGGCACACATAGAACCGGG - Intronic
1160229436 18:77035150-77035172 CTGGAGAAGCAGAGGAAACCTGG - Intronic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160503422 18:79413715-79413737 CAGGAGACGAAGAAGGAACCAGG - Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1160870888 19:1277345-1277367 CTGGAGACTCAGCAGGACCCTGG + Intronic
1162439534 19:10683871-10683893 CCGGAGACACTGCTGGACCCCGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1163518532 19:17778972-17778994 CTGGAGACACAGCCAGGACCAGG + Intronic
1163669887 19:18621147-18621169 CTGGAAACCCAGGTGGCACCAGG + Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165067648 19:33238444-33238466 CTGCAGACACAGACGGGAGCAGG + Intergenic
1165435656 19:35793317-35793339 CAGGACACAGAGATGGAACCTGG - Intergenic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166122715 19:40694960-40694982 CTGGAGACACAGCAGTGACCTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167109203 19:47448923-47448945 CTGGGGACACAGCAGTAACCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1167774590 19:51546360-51546382 CTGGAGAAACAGGTGCCACCTGG + Intergenic
1168070413 19:53947204-53947226 ATTGATAAACAGATGGAACCAGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925106897 2:1299461-1299483 GTGGAGACAGGGATGGAAGCTGG - Intronic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926577680 2:14600348-14600370 CTGGATTAACAGATGGATCCTGG + Intergenic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
933337860 2:80983276-80983298 AAAAAGACACAGATGGAACCTGG + Intergenic
935869338 2:107428086-107428108 GTGGAGACACAGAAAGAAACAGG + Intergenic
935976604 2:108584844-108584866 TTGGGGACATAGATGGAGCCAGG + Intronic
937238629 2:120446143-120446165 CTGGAGGCTGAGGTGGAACCTGG - Intergenic
937542885 2:122981199-122981221 CTGGAGATACAGATCAAATCAGG + Intergenic
940299927 2:152166078-152166100 CTGTAGTCCCAGATTGAACCTGG + Intronic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
943473809 2:188329700-188329722 ATGGGGACAAAGATGGAAGCAGG + Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
944818166 2:203401069-203401091 CTGGAGGAACAGATGATACCTGG - Intronic
948360779 2:237418655-237418677 CTGGAGACTGTGATGGAACTCGG - Intergenic
1169191687 20:3662163-3662185 CTGGAGACAGAGAAGGTGCCTGG + Intronic
1170566557 20:17611230-17611252 CTGGAGCCTGACATGGAACCTGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172749952 20:37243819-37243841 CTGCAGACTCAGATGGGAGCTGG + Intergenic
1172776899 20:37413211-37413233 GTGGAGAGAGAGATGGATCCGGG - Intergenic
1173183737 20:40823237-40823259 CTGGAAACATAGAATGAACCAGG - Intergenic
1173585176 20:44176911-44176933 CTGGAGTCACACATGGAGGCTGG - Intronic
1174531627 20:51219146-51219168 CTGGGGACTCAGAAGTAACCTGG - Intergenic
1175228460 20:57459163-57459185 CTTCAGGCACAGATGGATCCAGG + Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176814166 21:13579914-13579936 CTGTAGACAAACATGGACCCTGG - Intergenic
1179838436 21:44053744-44053766 CTGGAGGCACATGTGGAACAAGG - Intronic
1180196314 21:46196511-46196533 CTGCAGACACAGCTGCAAACAGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181437815 22:22920532-22920554 CTGGTGACACATGTGGGACCAGG - Intergenic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182251804 22:29006556-29006578 CTGGAGACTGATAAGGAACCAGG - Intronic
1182294398 22:29304687-29304709 CTGGAGCCTCAGAGGAAACCAGG - Intergenic
1182330656 22:29549483-29549505 ATGGAGACACACATGGTGCCTGG - Intronic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1183056508 22:35309895-35309917 CTGGCCACAGAGATGGAAGCGGG - Intronic
1183232934 22:36594088-36594110 CTTCAGGCACAGATGGATCCAGG + Intronic
1183478751 22:38051285-38051307 CTGGGGACAGAGATGTGACCTGG + Intergenic
1183756729 22:39774054-39774076 CTAGAGACATAGACAGAACCAGG + Intronic
1184806337 22:46796963-46796985 GTGGGGACACAGCAGGAACCAGG - Intronic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185224080 22:49643239-49643261 CTGGACACACAGTTTGACCCAGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949944747 3:9180978-9181000 CTGGAGACACGGAGGCAGCCGGG + Intronic
952463177 3:33551340-33551362 CTGGCCAAACAGATGGATCCAGG - Exonic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
955511484 3:59685327-59685349 CTTCAGGCACAGATGGATCCAGG + Intergenic
955662533 3:61316506-61316528 CTGGAGCCACAGTTGCAAACTGG + Intergenic
955707927 3:61747736-61747758 TTGAAGACAAAGATGGGACCAGG - Intronic
955809087 3:62767608-62767630 TTTGTGACACAGATGGAAGCTGG + Intronic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
956733111 3:72214764-72214786 CTGGAGCCACTGAAGCAACCTGG + Intergenic
958595454 3:96216526-96216548 CTGGTTACATAGATAGAACCAGG - Intergenic
959605878 3:108241652-108241674 CTGGTGACCCAGATGGAATTGGG + Intergenic
960307418 3:116078847-116078869 TTGGAGAAACAGCTGGTACCAGG - Intronic
960485796 3:118251450-118251472 TTGGAGCCACAGATGGGACTGGG - Intergenic
961609311 3:128123929-128123951 CCGGAGACACAGACGGAAGTGGG - Intronic
961639565 3:128356719-128356741 GTGGATACACAGAAGGAATCAGG - Intronic
962742309 3:138370613-138370635 CCGGGGCCACAGCTGGAACCTGG + Intronic
966264098 3:178016901-178016923 GTTGAGACACAAATGGAACCTGG + Intergenic
966862812 3:184239874-184239896 CTGGAGACACTGTGGGGACCTGG + Exonic
967039173 3:185673618-185673640 AGGGAGACAAAGATGGAAGCAGG - Intronic
967839848 3:193996422-193996444 CTGGAGACTCAGCAGGCACCTGG - Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
972984669 4:44749265-44749287 CTGGTGACACCGAGGGAAACAGG - Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
981761306 4:148198505-148198527 ATTGAGACCCAGATGGACCCTGG - Intronic
982306638 4:153939112-153939134 CTGGGGACACAGATATAAACAGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
994104481 5:95931160-95931182 CTGGAGCCAGAGTTGGAAACTGG - Intronic
994921794 5:106054673-106054695 CTGTAGACATACTTGGAACCAGG + Intergenic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
996493888 5:124130872-124130894 CTGCAAACACACATGGGACCAGG + Intergenic
997601419 5:135141228-135141250 CTGGAGACCAAGGTGGAGCCAGG - Intronic
998918227 5:147039432-147039454 CTGAAGACCCAGATAGATCCCGG + Intronic
1001560434 5:172665588-172665610 CTGCAGACACCGCAGGAACCAGG - Intronic
1001854176 5:174996351-174996373 ATGGAGACAGATATAGAACCAGG + Intergenic
1002000004 5:176192117-176192139 ATGGAGACACAGGAGGGACCTGG + Intergenic
1002075263 5:176704754-176704776 CTGGCCACACAGATAGAAGCAGG + Intergenic
1003142597 6:3483952-3483974 CGGGAAACAAAGATGGAAGCAGG + Intergenic
1003917811 6:10804005-10804027 CCTGACACACAGATGGAACAGGG - Intronic
1005009343 6:21321381-21321403 CAGGAGCCAGTGATGGAACCAGG - Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006893470 6:37449877-37449899 GTGGAGACACAGAAGTAAACAGG - Intronic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1012096571 6:94970087-94970109 GTGGGGACATAGATGGAGCCGGG + Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1014705243 6:124738086-124738108 ATGGAGACAAATATGGAACCAGG - Intronic
1014705292 6:124739182-124739204 ATGGAGATAAATATGGAACCAGG + Intronic
1016629458 6:146211289-146211311 CTGGAGACACACAAGTCACCAGG - Intronic
1016996237 6:149964069-149964091 CGGGAGGCACAGAAGGAACGCGG - Exonic
1017233664 6:152098178-152098200 TTGGAGACATGGATGGAAGCTGG + Intronic
1021297779 7:18930167-18930189 CTGGACATAGAGATGGAACGGGG - Intronic
1022598991 7:31738773-31738795 CAGGTGACACAGGTGGCACCTGG - Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023275350 7:38513376-38513398 CAGGAGACACCCATTGAACCTGG + Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024181626 7:46901105-46901127 TTAGAGAGACAGCTGGAACCTGG + Intergenic
1024483928 7:49894729-49894751 CTGGAGACACAGGAGCAGCCAGG + Intronic
1024530163 7:50384633-50384655 CTGGAGACAAAGGTGGTACCTGG + Intronic
1024996659 7:55277852-55277874 CTGGTGACAGAGATGGGAGCTGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026671188 7:72392035-72392057 CAAGAGAAACAGATGGAACCCGG - Intronic
1029309753 7:99651873-99651895 CTGCAGCCACAGATAGGACCAGG + Intronic
1029933094 7:104394288-104394310 CCAGAGGCACAGATGCAACCTGG - Intronic
1030289084 7:107854665-107854687 ATGTAGACACAGGTGGAAACTGG - Intergenic
1032987903 7:137359277-137359299 CTGGATACATAGATATAACCAGG - Intergenic
1033670842 7:143491258-143491280 CTGGAGACTAAGCTGGAACAAGG + Intergenic
1033881548 7:145890200-145890222 TTGCAGACACAGAAGAAACCTGG - Intergenic
1034054779 7:148022578-148022600 CAGGGCACACTGATGGAACCCGG - Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034127742 7:148688978-148689000 CTGCAGACACACTTGAAACCAGG - Intergenic
1036049535 8:5180451-5180473 CTTGAGAGACAAATGCAACCGGG - Intergenic
1037399211 8:18476731-18476753 CTTCACACACAGGTGGAACCAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037623121 8:20584478-20584500 GTGGAGACAGAGATGCCACCAGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1041782625 8:61594403-61594425 CAGGAGACACTGATGCAAGCTGG - Intronic
1042101626 8:65280813-65280835 TTGGAGACACACAGGGAAGCAGG - Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1043335853 8:79175928-79175950 TTGGAGACTCAGCTGGAACCTGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044316707 8:90757536-90757558 TTGGAGCCAGACATGGAACCGGG + Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045822127 8:106351528-106351550 GTGGAGACACAGATGCATTCGGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1047670066 8:127136402-127136424 CTGGAGACACGGTTTGAACATGG - Intergenic
1048219172 8:132525811-132525833 CTGGCGACACAGATAAAGCCAGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050035369 9:1430013-1430035 CTGGGTACACAAATGTAACCTGG - Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051701296 9:19826893-19826915 CAGGACTCACACATGGAACCAGG - Intergenic
1052464516 9:28813599-28813621 CAGGAGACACACATTGAACAAGG + Intergenic
1052877081 9:33575377-33575399 CTGCAGCCCCAGATGGCACCTGG + Intergenic
1052932857 9:34069939-34069961 CTGGAGTCAGAGATGGCACTAGG - Intergenic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053498924 9:38569017-38569039 CTGCAGCCCCAGATGGCACCTGG - Intronic
1054966857 9:71038680-71038702 CCAGGGATACAGATGGAACCTGG + Intronic
1057678371 9:97153509-97153531 CTGCAGCCCCAGATGGCACCTGG - Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060751061 9:126169860-126169882 CTGGGGACAGAGGAGGAACCTGG + Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1062010488 9:134264273-134264295 CTGCAGACGCAGCTGGTACCTGG + Intergenic
1062277282 9:135736932-135736954 CTGGAGACACGGCAGGAAGCAGG - Intronic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196475113 X:116074968-116074990 CTGGAAACATAGAATGAACCAGG + Intergenic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1198377942 X:136058105-136058127 CTGGAGAATCTGATGGACCCAGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic