ID: 1166343444

View in Genome Browser
Species Human (GRCh38)
Location 19:42151591-42151613
Sequence CCGACCTTGCCCAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166343444_1166343454 -10 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343454 19:42151604-42151626 GCAAGGTCGGATGGGGGTGGGGG 0: 1
1: 0
2: 1
3: 55
4: 535
1166343444_1166343459 12 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343459 19:42151626-42151648 GGAAACTGAGGCCCAGAGAGGGG 0: 62
1: 326
2: 763
3: 1467
4: 2499
1166343444_1166343460 18 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343460 19:42151632-42151654 TGAGGCCCAGAGAGGGGAGACGG 0: 1
1: 10
2: 47
3: 239
4: 1213
1166343444_1166343464 30 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343464 19:42151644-42151666 AGGGGAGACGGCCCAGGCCCAGG 0: 1
1: 0
2: 2
3: 51
4: 451
1166343444_1166343458 11 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343458 19:42151625-42151647 GGGAAACTGAGGCCCAGAGAGGG 0: 95
1: 356
2: 997
3: 2066
4: 3630
1166343444_1166343455 -9 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343455 19:42151605-42151627 CAAGGTCGGATGGGGGTGGGGGG 0: 1
1: 0
2: 3
3: 41
4: 494
1166343444_1166343457 10 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343457 19:42151624-42151646 GGGGAAACTGAGGCCCAGAGAGG 0: 107
1: 642
2: 2199
3: 5103
4: 9526
1166343444_1166343456 0 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343456 19:42151614-42151636 ATGGGGGTGGGGGGAAACTGAGG 0: 1
1: 0
2: 9
3: 96
4: 773
1166343444_1166343463 24 Left 1166343444 19:42151591-42151613 CCTTCCAGCTTGGGCAAGGTCGG 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1166343463 19:42151638-42151660 CCAGAGAGGGGAGACGGCCCAGG 0: 1
1: 0
2: 2
3: 37
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166343444 Original CRISPR CCGACCTTGCCCAAGCTGGA AGG (reversed) Intronic
901047885 1:6409561-6409583 GGGACCTTGCCCAGGCTGGAGGG + Intergenic
902078497 1:13805454-13805476 CCCACCTTCCCCAAGTGGGAAGG - Intronic
902642207 1:17774297-17774319 GCGCCCTTGCCCACGCTGGGGGG + Intronic
902768881 1:18634306-18634328 CCGGCCTTGGCCAAGCGGGGTGG - Exonic
903511410 1:23878163-23878185 CCCATGTTGCCCAGGCTGGATGG - Intronic
903851694 1:26310913-26310935 CCGACCACTTCCAAGCTGGAAGG + Intronic
909741843 1:79038628-79038650 CCTACCCAGCCCAAGTTGGAAGG - Intergenic
911233882 1:95388845-95388867 CAGAACTTGCTCAAGGTGGAGGG - Intergenic
912983612 1:114403402-114403424 TCCCCCTTGCCCAGGCTGGAGGG + Intronic
914965216 1:152251279-152251301 CCACCATTTCCCAAGCTGGAAGG - Intergenic
916061150 1:161099267-161099289 CCGCCCTTGCCAAGGATGGATGG - Intronic
916214208 1:162382112-162382134 CCCACACTGCCCAGGCTGGAGGG - Exonic
917943587 1:179947439-179947461 CCTACCCTGCCCAGGGTGGAAGG + Intergenic
919982171 1:202648859-202648881 GCCACTCTGCCCAAGCTGGAGGG - Intronic
920128355 1:203711823-203711845 CAGACCTAGCCCATGCTGCATGG + Intronic
1067713851 10:48671899-48671921 CAAACCTTGCCCAAGCTCGCAGG + Intergenic
1070061243 10:72984842-72984864 GCTACATTGCCCAGGCTGGACGG - Intergenic
1073206004 10:101769762-101769784 CCAACCTTGCCCCAGCTGGTGGG - Intergenic
1074865443 10:117542198-117542220 CCTGCCTCGCCCAAGCTGGTAGG - Intergenic
1075564205 10:123491913-123491935 CCGACTTTGCCCAAGCTCTGGGG + Intergenic
1075935506 10:126337572-126337594 CCGCCCTTTCCCAGGCTGGATGG - Intronic
1076123948 10:127960117-127960139 GCAAGCATGCCCAAGCTGGAGGG - Intronic
1078173515 11:8949919-8949941 CCCATGTTGCCCAGGCTGGAAGG + Intronic
1078575436 11:12498065-12498087 TCACCCTTGCCCAGGCTGGAGGG + Intronic
1079357226 11:19739837-19739859 CAGACTTCGGCCAAGCTGGATGG + Intronic
1081623007 11:44630230-44630252 CAGTTCTTGCCCAGGCTGGAGGG + Intergenic
1081717722 11:45262690-45262712 CCCTCTTTGCCCAGGCTGGAGGG - Intronic
1081856778 11:46308883-46308905 CAGGCCTTGCCAAAGCAGGAAGG + Intronic
1081916224 11:46732425-46732447 CCCATGTTGCCCAGGCTGGATGG + Intronic
1084311187 11:68317260-68317282 TCCACCTTGCCCATGCTGGTGGG + Intronic
1089146158 11:116330919-116330941 CAGTCCTTCCCCCAGCTGGAAGG - Intergenic
1101513348 12:105412057-105412079 CCCTCCTGGCCCATGCTGGAGGG - Intergenic
1102198614 12:111042175-111042197 CCGCCGTCGCTCAAGCTGGACGG + Intronic
1105775109 13:23652692-23652714 GCGACATAGCCCAAGGTGGAAGG + Intronic
1109176802 13:59167277-59167299 CAGGCCTTGCCCAAACTCGAAGG - Intergenic
1109905648 13:68836919-68836941 TCTATGTTGCCCAAGCTGGAGGG + Intergenic
1112049400 13:95631081-95631103 ACAACCTGGCCCAAACTGGAGGG + Intronic
1115951376 14:38726194-38726216 CCTATGTTGCCCAGGCTGGAGGG + Intergenic
1116221698 14:42096106-42096128 CAGGCCTTCCCCAAGCTTGAAGG + Intergenic
1119850738 14:77864876-77864898 CTGACCTTCCCCAAGCAAGAAGG - Intronic
1123076677 14:105670855-105670877 GCCACCTTGCCCAGCCTGGATGG + Intergenic
1124390405 15:29250558-29250580 CACACATTGCCCAAGCTTGAAGG - Intronic
1125721400 15:41846828-41846850 CCCACCCTTCCCAACCTGGAAGG - Exonic
1127695967 15:61448126-61448148 CAGACCTGGCCCATGCTGCAAGG - Intergenic
1128904808 15:71457427-71457449 CCAACCTTGCCCATTCTGGCTGG + Intronic
1131095243 15:89650425-89650447 CTCTCGTTGCCCAAGCTGGAGGG + Intronic
1131214582 15:90526641-90526663 CCTACATTGCACAAGCTGAAAGG + Intergenic
1131673530 15:94647776-94647798 CTCTCGTTGCCCAAGCTGGAGGG + Intergenic
1134623004 16:15703785-15703807 ACTACGTTGCCCAGGCTGGAGGG + Exonic
1135526118 16:23214971-23214993 CCGACCCTGCACAGGCTGGGAGG - Intronic
1136026004 16:27469536-27469558 CCGTCCTTCCCCAAGCTAGAAGG + Exonic
1140030037 16:71328330-71328352 CAGTCCTTGCCAGAGCTGGAAGG - Intergenic
1141148803 16:81550388-81550410 CAGACCTTCCCAAAGCTGGGAGG - Intronic
1141786981 16:86207589-86207611 CGGACATTGCCCAAGCTCCAAGG - Intergenic
1144960884 17:19043252-19043274 CTGACCTGGCCCAGGCTGCAGGG - Intronic
1144974276 17:19131272-19131294 CTGACCTGGCCCAGGCTGCAGGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1152715821 17:81900069-81900091 CCGACCTGGCTCTCGCTGGAGGG + Exonic
1160066423 18:75578825-75578847 CCCATCTTGCCTAATCTGGAAGG + Intergenic
1161761560 19:6176868-6176890 GCGACCATGCCCAGCCTGGAGGG - Intronic
1162636379 19:11970895-11970917 CTCTCCTTGCCCAGGCTGGAGGG - Intronic
1163293768 19:16398678-16398700 ACTACGTTGCCCAGGCTGGAGGG + Intronic
1164835852 19:31354591-31354613 CAGCCCCTGCCCAAGCAGGAAGG + Intergenic
1164904445 19:31955510-31955532 CCTACCTTTTCCAAGATGGAAGG - Intergenic
1165538314 19:36468881-36468903 CCACTCTTGCCCAGGCTGGAGGG - Intronic
1165894207 19:39131714-39131736 CCGACCCTTCCCAGGCTGGGAGG + Intronic
1166343444 19:42151591-42151613 CCGACCTTGCCCAAGCTGGAAGG - Intronic
1166471495 19:43082951-43082973 CTGTCCTTGCCCAACCTGCAGGG - Intronic
927758008 2:25724116-25724138 TCTCCCTTGCCGAAGCTGGACGG - Intergenic
932215136 2:69961558-69961580 CCGGCCTTGGGCAAGCAGGAGGG + Exonic
933704482 2:85279612-85279634 CCGTCCATGGCCAAGCTGTAGGG + Intronic
938624921 2:133097754-133097776 CCCACCTTGCCCTAGCTGACTGG + Intronic
941670099 2:168283946-168283968 TCTACCATGCTCAAGCTGGAGGG + Intergenic
942251590 2:174051873-174051895 CCTGCCTGGCCCAAGCTGGGTGG + Intergenic
942650861 2:178165994-178166016 CTGACCTTCCCCAAGCAAGAAGG + Intergenic
947842890 2:233219799-233219821 CCTCTGTTGCCCAAGCTGGAGGG - Intronic
948681022 2:239634750-239634772 CTGACATTGCCTATGCTGGATGG + Intergenic
1172192012 20:33067743-33067765 CCCAGCTTCCCCATGCTGGAGGG - Intronic
1175740933 20:61419374-61419396 ACGAACTTGCCTAAGCTGTAAGG - Intronic
1176136281 20:63523398-63523420 CCGCCCTTGGCTGAGCTGGAGGG + Intergenic
1176217693 20:63956055-63956077 CGGACCTGGCCCAAGCCGGCAGG - Intronic
1182417232 22:30229245-30229267 CGGACCTGACCCCAGCTGGAGGG - Intergenic
1184685246 22:46093896-46093918 CCGATGTTGGCCAAGCTGCAGGG - Intronic
1185039521 22:48497232-48497254 CGGACCTTGCCCTGGGTGGAGGG + Intronic
1185177371 22:49335586-49335608 CCTCTCTTGCCCAGGCTGGAGGG - Intergenic
955229492 3:57086185-57086207 CTGGCCTTGCCCAACCTGGTAGG + Intergenic
957391232 3:79573245-79573267 CCTATCTTGCCCATGCTGGCTGG + Intronic
966925795 3:184643831-184643853 CCCACCTGGAGCAAGCTGGAAGG + Intronic
967230870 3:187336393-187336415 CTGACCTTTCTCAATCTGGATGG + Intergenic
967307655 3:188074808-188074830 CCGCCGTTGCCCAGGCTGGATGG - Intergenic
969635813 4:8369064-8369086 GAGACCTTGCCCATGATGGAGGG - Intronic
974387209 4:61217268-61217290 CAGACCTTGCCTGAGCTGGGTGG + Intronic
978275650 4:106946767-106946789 CTGAGCTTCCACAAGCTGGATGG + Intronic
982232649 4:153223071-153223093 CGGACCTTGCCCGGGCGGGAGGG - Intronic
993003441 5:82405828-82405850 CCGATTTTGCCCAACCTAGAGGG - Intergenic
995369460 5:111402645-111402667 ATGACCTTGCCCTAGCTGCAAGG - Intronic
1002088782 5:176792605-176792627 CCCACCTGGCACAAGCTGGAGGG + Intergenic
1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG + Intergenic
1003904742 6:10689009-10689031 ACCACATTGCCCAGGCTGGAGGG + Intronic
1005636183 6:27755617-27755639 CCTATATTGCCCAGGCTGGAGGG - Intergenic
1006065464 6:31458966-31458988 CTGACCTTCCCCAAGCAAGATGG + Intergenic
1007752662 6:44079868-44079890 CCGACCTTGCCCCAACTAGTGGG + Intergenic
1011546594 6:88487960-88487982 CCTCCGTTGCCCAGGCTGGAGGG - Intergenic
1017090488 6:150754700-150754722 CTGTCATTGCCCAGGCTGGAGGG + Intronic
1019077907 6:169405216-169405238 CAGTCCTTGCCCACGCTGCAAGG + Intergenic
1024068758 7:45768565-45768587 CCGACCCTGCCCAGGATGAACGG + Intergenic
1024241915 7:47442304-47442326 CCTACCTTGCCCTGACTGGAGGG - Intronic
1032134212 7:129260040-129260062 CTCACGTTGCCCAGGCTGGAGGG - Intronic
1032475411 7:132208438-132208460 CAGACCTGGCCCATGGTGGATGG + Intronic
1033339591 7:140481350-140481372 TCGCTCTTGCCCAGGCTGGAGGG - Intergenic
1037772409 8:21810320-21810342 CTGACCTCCCCCAAGCTGGAGGG - Intronic
1040531483 8:48269926-48269948 CCTCCCTTGCACAAGCTTGATGG + Intergenic
1047953846 8:129958121-129958143 CACTCTTTGCCCAAGCTGGAGGG - Intronic
1057871741 9:98723268-98723290 GCCCCCTTCCCCAAGCTGGAGGG + Intergenic
1061369892 9:130192321-130192343 CCGCCCTTGTCCAAGGTCGAGGG + Intronic
1187441112 X:19321075-19321097 CTGACCTTCCTCAAGCAGGAAGG - Intergenic
1188784778 X:34332277-34332299 CGCTCGTTGCCCAAGCTGGAGGG - Intergenic
1191761509 X:64652588-64652610 CCAACCATGCCCAAGAAGGAAGG - Intergenic
1192461521 X:71321223-71321245 CCTCTGTTGCCCAAGCTGGAGGG + Intergenic