ID: 1166345944

View in Genome Browser
Species Human (GRCh38)
Location 19:42165839-42165861
Sequence GAGTAGTAAGTGAAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166345940_1166345944 -10 Left 1166345940 19:42165826-42165848 CCATAAATGCTGTGAGTAGTAAG 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1166345944 19:42165839-42165861 GAGTAGTAAGTGAAGGTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 232
1166345939_1166345944 0 Left 1166345939 19:42165816-42165838 CCATCAGCAGCCATAAATGCTGT 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1166345944 19:42165839-42165861 GAGTAGTAAGTGAAGGTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166345944 Original CRISPR GAGTAGTAAGTGAAGGTGGT GGG Intronic
900975144 1:6012030-6012052 GAGGTGAAAGTGGAGGTGGTGGG + Intronic
902148343 1:14421838-14421860 GTGTAGTAAGTGAAAGAGGCCGG - Intergenic
902977611 1:20100311-20100333 GAGTGGTTAGTGAACGTGTTGGG - Intergenic
904075865 1:27841973-27841995 GAATAGTAAATGCAGGTGGGTGG - Intronic
904637066 1:31890427-31890449 GAGTAAAAAGTGAAGATGGGTGG + Intergenic
904891209 1:33780989-33781011 GAGTGGTGAGTGATGCTGGTCGG + Intronic
904963164 1:34350569-34350591 CAGTGGTAAGTGTAGGGGGTAGG + Intergenic
905172626 1:36118230-36118252 GGCTAGGAAGTGAAGGAGGTGGG + Intronic
905300404 1:36982804-36982826 GAGCAGGAAGTGGGGGTGGTGGG + Intronic
905770313 1:40633676-40633698 GAATGGCAAGTGATGGTGGTTGG + Intronic
907291940 1:53420606-53420628 GAGTGGTGGGTGAAGGTGGGAGG - Intergenic
907395277 1:54185414-54185436 GAATAGCAAGTGAACATGGTAGG + Intronic
908704077 1:66931034-66931056 GCCTGGAAAGTGAAGGTGGTGGG - Intronic
908721384 1:67129793-67129815 GATTGGTAAGTGAAGGCTGTGGG - Intronic
908961688 1:69705615-69705637 GAGTGGTAAGTGAGGATGGTAGG + Intronic
909484493 1:76158194-76158216 GGGTAAGAAGTGAAGGAGGTAGG - Intronic
910153548 1:84186079-84186101 GATTGGTGAGTGATGGTGGTGGG + Intronic
910154120 1:84193594-84193616 GATTGGTGAGTGATGGTGGTGGG + Intronic
911211167 1:95139285-95139307 GAGTGGTGAGTGAAAGTGGAGGG + Intronic
913716584 1:121540650-121540672 GAATGGTGAGTGATGGTGGTGGG + Intergenic
916810616 1:168302345-168302367 AAGTATTAAGCGAAGGCGGTGGG + Intronic
918661353 1:187092541-187092563 AAGAAAGAAGTGAAGGTGGTAGG + Intergenic
918719343 1:187832668-187832690 GAGTTGTAAATGAATGTGCTAGG - Intergenic
919888996 1:201956410-201956432 GAGTAGTAATTTAAGGTCCTGGG - Intronic
920286359 1:204882551-204882573 GAGACGTAAGTGCAGGTAGTGGG - Intronic
920873679 1:209815119-209815141 GAATAGAAATGGAAGGTGGTAGG + Intergenic
921249547 1:213283568-213283590 GAGCAGCAACTGAAGGTGGAAGG + Intergenic
922554395 1:226521866-226521888 GGGTATGAAGAGAAGGTGGTAGG - Intergenic
1066600657 10:37102825-37102847 GAGTAGTGATTGAATGTGGATGG + Intergenic
1066601541 10:37113409-37113431 GAGTAGTGATTGAATGTGGATGG - Intergenic
1067404143 10:46005275-46005297 GAGTATTATATAAAGGTGGTGGG - Intronic
1067464436 10:46486708-46486730 GACTAGTGAGGGATGGTGGTGGG - Intergenic
1067622760 10:47897949-47897971 GACTAGTGAGGGATGGTGGTGGG + Intergenic
1068962532 10:62880161-62880183 TAGTAGGAAGAGATGGTGGTGGG - Intronic
1070154992 10:73827815-73827837 GGGTAGGATGTGAAGCTGGTAGG - Intronic
1070953376 10:80448555-80448577 GAGTGGGAAGGGAAGGTGGGAGG - Intergenic
1070972381 10:80578304-80578326 GAGTATTAAATGAAGGTTGTTGG - Intronic
1071713025 10:88068227-88068249 AAGTAGTAAGTGGATGAGGTAGG + Intergenic
1072137473 10:92560899-92560921 GAGGATGGAGTGAAGGTGGTGGG - Intronic
1072423928 10:95313452-95313474 GAGTAGCAATTCTAGGTGGTAGG - Exonic
1073580558 10:104661851-104661873 GAGAAGTATGTGTAGGTGGAAGG + Intronic
1074931512 10:118131354-118131376 GAGCAGAATGTGAAGGTGGTTGG + Intergenic
1075576687 10:123582823-123582845 GAGTAGTCAGTGCAGGTAGGAGG - Intergenic
1075866219 10:125721444-125721466 GAGTTTTAAGTGAGGGTGGAGGG - Intronic
1077841017 11:5974715-5974737 GGCTAGTAAGTGATGGTGCTAGG - Intergenic
1078703421 11:13713429-13713451 GAGTAATAAATGAAGGAGTTAGG + Intronic
1078932457 11:15922743-15922765 GATTAATAAGTGAATGTGGGTGG + Intergenic
1079305703 11:19319473-19319495 GAGTATTAAGTGTGGGAGGTAGG + Intergenic
1080127575 11:28755134-28755156 TAGTAGTAAGTGAATGGGGAGGG - Intergenic
1081824183 11:46031443-46031465 GAGTAGGAAGGGAAGGTAATGGG + Intronic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1085219049 11:74857603-74857625 AAATATTAAGTTAAGGTGGTTGG - Intronic
1085235177 11:75009070-75009092 GAATAGTAAGAAAAGGGGGTTGG + Exonic
1085690835 11:78662482-78662504 GACTAGAAAATGAAGGTGGCCGG - Intronic
1086111185 11:83200194-83200216 GAGTAGTAAGAGAAGCTGAAAGG - Intronic
1086331202 11:85756050-85756072 GAGGAGTAAGGGCAGGAGGTGGG - Intronic
1089221368 11:116874768-116874790 GAGTAGGAAGAGAAGGTTGTGGG - Intronic
1090268151 11:125367816-125367838 GAGAAGAAAGGGGAGGTGGTGGG - Intronic
1091565529 12:1645524-1645546 GAGTAGAAAGTGAAAGTGCCTGG + Intronic
1093540420 12:20276866-20276888 GAGTACTACGTGGAGGTGGCAGG + Intergenic
1093553802 12:20447194-20447216 GAGGTGACAGTGAAGGTGGTAGG + Intronic
1093824492 12:23666969-23666991 AAGGAGAAATTGAAGGTGGTGGG - Intronic
1094110527 12:26857083-26857105 GAACAGTAAGAGAAAGTGGTAGG + Intergenic
1094140148 12:27172571-27172593 GACTGGTGAGTGAAGGTGGTGGG - Intergenic
1097902831 12:64890284-64890306 GGGCTGTAAGTGAAGGAGGTGGG + Intergenic
1099465875 12:82987555-82987577 GAGTAGTAAGAGAAGTTCCTAGG + Intronic
1100332563 12:93598325-93598347 GGGTAGAAGGTGAAGGTGGGAGG + Intergenic
1101212153 12:102545249-102545271 GACCAGAAAGTGAAAGTGGTGGG + Intergenic
1102521968 12:113483585-113483607 GAGTAGTAAGAGATGGGGGAAGG + Intergenic
1104328282 12:127820482-127820504 GAGCAGCAAGCGAAGGTGGATGG + Intergenic
1107108632 13:36673326-36673348 GACTGGTAACTGAAGTTGGTCGG + Intergenic
1108678762 13:52761582-52761604 GAATAGCAAGTGAAGGCAGTCGG - Intergenic
1109267685 13:60219924-60219946 GATTATTAAGTGAAGGGGGTGGG + Intergenic
1111555739 13:89879244-89879266 GACTGGTAAGTGATGATGGTGGG - Intergenic
1111832264 13:93344121-93344143 AAGTAGGAAGTGGAGGAGGTGGG - Intronic
1115382701 14:32757754-32757776 GAGTAGGATGTGGATGTGGTTGG + Intronic
1116013599 14:39380050-39380072 GAGTTGTAAGTGAAGGCTTTCGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118436901 14:65779783-65779805 GAGTGGAGACTGAAGGTGGTTGG - Intergenic
1122442176 14:101739653-101739675 GACTAGGAAGTGGAGGAGGTGGG + Intergenic
1123487170 15:20751745-20751767 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1123543660 15:21320800-21320822 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1124827524 15:33113663-33113685 GAGAAGTAACAGAAGGTGGGTGG - Intronic
1126380156 15:48038272-48038294 AGGTAGTAAGTGGAGGAGGTGGG + Intergenic
1126631672 15:50742675-50742697 GAGAAGTAAGTGTATGTGGGAGG - Intronic
1127698238 15:61472691-61472713 GAGTATTAACTTAAGGTGGTGGG + Intergenic
1127762669 15:62154267-62154289 AGGTAGTAAGTGAAGGAGCTGGG - Intergenic
1127976458 15:64000803-64000825 GAGTGTAAAATGAAGGTGGTGGG + Intronic
1128178497 15:65579228-65579250 GAGAAGGATGTGAAGGTGGTTGG - Exonic
1130155425 15:81346132-81346154 GACTAGTAAGTGATGGTGCTGGG - Intronic
1130516580 15:84630484-84630506 GAGTGGTAAGTGAGGGGGGGAGG + Intergenic
1202951977 15_KI270727v1_random:47926-47948 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1133412359 16:5579307-5579329 GACTGGAAAGTGAAGGTGGGTGG - Intergenic
1134898629 16:17913822-17913844 GGGAAGTATGTGAAGGTGGGAGG + Intergenic
1135107456 16:19662662-19662684 AAATAGTAAGTGAATGTGGGGGG - Intronic
1137551296 16:49439441-49439463 GATGAGTAAATGAGGGTGGTGGG + Intergenic
1138453657 16:57108404-57108426 GGGAAGTAAGTGGGGGTGGTGGG - Intronic
1141085464 16:81092129-81092151 AAGTAGTTAGTAAAGATGGTAGG - Intronic
1141661312 16:85443141-85443163 GAGGTGGAAGTGAATGTGGTTGG + Intergenic
1141840448 16:86570988-86571010 GAGGAGGAAGTTAAGGAGGTAGG + Intergenic
1143111702 17:4556450-4556472 GAGTGGGAGGTAAAGGTGGTGGG + Intergenic
1143231049 17:5355475-5355497 GAGCAGTAAGTGAGGCTGGAAGG - Intronic
1144074005 17:11700861-11700883 GAGTAGCAGGTTAAGGGGGTGGG - Intronic
1144188077 17:12815047-12815069 GAGAAGTAAAAGCAGGTGGTGGG - Intronic
1144777814 17:17793597-17793619 GAGGAGTAGGTGGAGGAGGTGGG - Exonic
1147486234 17:40817463-40817485 GAGTACTAAGTAATGTTGGTTGG + Intergenic
1148840607 17:50493994-50494016 GACTGGTGAGTGAAGGTGGTGGG - Intergenic
1155032913 18:22000166-22000188 AACTAGTAAGTGAAGGGGCTGGG + Intergenic
1162126604 19:8502703-8502725 GAGGAGGAAGGGAAGGAGGTGGG + Exonic
1162287704 19:9751855-9751877 AAGGAGTCAGTGAAGATGGTGGG - Intergenic
1162331160 19:10030699-10030721 GAGTTGTAAGCGGAGTTGGTAGG + Intergenic
1166251881 19:41576953-41576975 GAGTAGGAACTGAAGGCAGTGGG + Intronic
1166345944 19:42165839-42165861 GAGTAGTAAGTGAAGGTGGTGGG + Intronic
1168322335 19:55517835-55517857 GTGGAGTGAGTGATGGTGGTGGG - Exonic
1168322384 19:55518015-55518037 GTGGAGTGAGTGATGGTGGTGGG - Exonic
1168397507 19:56061464-56061486 GAGTCGTAATTGACGGTAGTTGG + Exonic
925997787 2:9306306-9306328 GGGTTGTGAGTGAAGGAGGTCGG + Intronic
927465573 2:23333982-23334004 GGGTAGTAAGTAAAGCTGATTGG + Intergenic
928400517 2:30974889-30974911 GAGGGATAAGTGAAGGTGGGAGG + Intronic
928902531 2:36335826-36335848 TAGTAGTACGTGGAGGTGGAGGG + Intergenic
931658100 2:64528570-64528592 CAGTAGTAAGGGAGGTTGGTGGG + Intronic
932150513 2:69367107-69367129 GAGGAGTAAGTGAATGGGATGGG - Intronic
932476847 2:72011657-72011679 GAGGAGGAAGGGCAGGTGGTAGG + Intergenic
932659646 2:73641270-73641292 GAGTCTGAAGAGAAGGTGGTGGG - Exonic
936141645 2:109946949-109946971 GAGGAGTCAGTGAAGTTGGTTGG + Intergenic
936178333 2:110244897-110244919 GAGGAGTCAGTGAAGTTGGTTGG + Intergenic
936203045 2:110424535-110424557 GAGGAGTCAGTGAAGTTGGTTGG - Intronic
936675402 2:114708504-114708526 AATTAGTAAGTGCCGGTGGTGGG - Intronic
936872630 2:117150762-117150784 CAGTAGTAACTGAAAGTGTTAGG - Intergenic
939694656 2:145309695-145309717 GAGTGGTAAGTGAATGTGAAGGG - Intergenic
939866803 2:147482017-147482039 GAGCAGTCAGAGAAGGAGGTAGG + Intergenic
940277087 2:151950797-151950819 GAGTAGAAAGAGAAGGGAGTGGG + Intronic
940339614 2:152566474-152566496 GAACAGTAAGTGAAGGAGGCAGG + Intronic
940739698 2:157493212-157493234 GATTGGTGAGTGATGGTGGTAGG + Intergenic
941420855 2:165281545-165281567 GAGAAGGAAGTGAGGGGGGTGGG + Intronic
945134603 2:206613882-206613904 CATTAGTAGGTGATGGTGGTAGG + Intronic
946106599 2:217375830-217375852 GAGTAGGAACTGATGGTGGGAGG - Intronic
946140936 2:217690116-217690138 GAGTATTTAGTGATGGTGGGTGG - Intronic
946275490 2:218628579-218628601 GAGTACCAAGTGAAGGAGCTAGG - Intronic
947154343 2:227146380-227146402 GTGAAAGAAGTGAAGGTGGTGGG - Intronic
947342669 2:229156557-229156579 TAGCAGTAATTGAATGTGGTTGG - Intronic
947351249 2:229247934-229247956 GAGTAGTAAGAGAAGGAGGTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169006194 20:2209123-2209145 GGGTAGTAGGAGAAGGTGGCAGG + Intergenic
1169297614 20:4413472-4413494 GAGTCATCAGGGAAGGTGGTTGG + Intergenic
1169329667 20:4706393-4706415 GAGTGGGAAGAGAAGGGGGTAGG + Intergenic
1169843981 20:9970131-9970153 GAATAGTAAGTGATGGTGGAAGG + Intergenic
1170281262 20:14651510-14651532 GAGTAATAAGTGATGGAGGTAGG + Intronic
1171088939 20:22266303-22266325 GGCTAGTATGTGGAGGTGGTGGG - Intergenic
1172211925 20:33205880-33205902 GATTAGTAAGTGCTGGAGGTGGG + Intergenic
1172350948 20:34240193-34240215 GATTGGTGAGTGATGGTGGTAGG + Intronic
1173306769 20:41858030-41858052 GACTAGCGAGTGATGGTGGTAGG + Intergenic
1173964087 20:47098686-47098708 GAGTTGGAGGTGAAGGTGGCTGG - Intronic
1174614194 20:51823378-51823400 GAGGAGGATGTGAAGTTGGTGGG + Intergenic
1174719646 20:52798233-52798255 GAGGACCAAGTGAAGGTGGTGGG - Intergenic
950112105 3:10425825-10425847 GAGTACGAATTGAGGGTGGTGGG - Intronic
952190530 3:31018402-31018424 GATTAGTAAGTGGTGATGGTAGG + Intergenic
952399792 3:32952818-32952840 AGATAGGAAGTGAAGGTGGTTGG + Intronic
954577199 3:51683075-51683097 GAGGAGTAAGTGGAGGTAGAGGG + Intronic
956083986 3:65590184-65590206 GAGAAGTATGTCAAGGTGCTGGG - Intronic
956240950 3:67130104-67130126 GAGTAGTAAAGGAAGGAGGAGGG - Intergenic
956537993 3:70300319-70300341 ATGTTGTAAGAGAAGGTGGTAGG - Intergenic
956789624 3:72670572-72670594 GGGAAGTAAGTGATCGTGGTTGG - Intergenic
958263900 3:91414681-91414703 GAGAACTAAGAAAAGGTGGTTGG - Intergenic
959631529 3:108512591-108512613 GAGTAGTGAGAGAAGGAGATGGG + Intronic
961016859 3:123475235-123475257 GAGGAGTAAGTCCAGGTGGAAGG - Intergenic
961228881 3:125282131-125282153 GAGTAGTGAGAGAAGCGGGTAGG + Intronic
963574723 3:147045713-147045735 AAGAGGTAAGTGAAGGAGGTTGG - Intergenic
965193278 3:165559541-165559563 GTATAGTAAGTGAAAGTGGAAGG + Intergenic
965437828 3:168674443-168674465 GAGTTGTAAGTGGATGTGGACGG + Intergenic
969129833 4:4983243-4983265 GACAAGCAAGTGAAGGCGGTTGG - Intergenic
969335855 4:6509868-6509890 GAGCAGTAAGTGCACTTGGTGGG + Intronic
970316878 4:14837582-14837604 CACTATTAAGTGAAGATGGTGGG + Intergenic
971515761 4:27484225-27484247 GAGTAGAAAGGGATGGTTGTGGG + Intergenic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972727194 4:41755231-41755253 GAGAGGTAAGTGGTGGTGGTGGG - Intergenic
973122972 4:46545675-46545697 AATTATTAAGTGAAGGAGGTAGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975298137 4:72757686-72757708 GAGCAGGAAGTAAAGGTGATGGG + Intergenic
976776235 4:88709132-88709154 GGGGAGTGAGTGGAGGTGGTAGG + Intergenic
976979766 4:91212881-91212903 GAGTAGGGAGAGAAGGAGGTGGG - Intronic
977908431 4:102502158-102502180 GAGGAGAGAGGGAAGGTGGTTGG + Intronic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
978871872 4:113588640-113588662 GAGTTGTAAGTGAATGTTTTAGG - Intronic
979877979 4:125917505-125917527 GAGTAGTAAGTGATGACGGGGGG - Intergenic
980535982 4:134124363-134124385 AATTGGTAAGTGAGGGTGGTGGG - Intergenic
981082631 4:140650439-140650461 GGGTAGGGAGTGAAGGTGGTAGG - Intronic
981127227 4:141120707-141120729 AAGTAGTAAGTGAGGGAAGTGGG + Intronic
989961971 5:50427047-50427069 GACTGGTGAGTGATGGTGGTGGG - Intronic
990362771 5:55038123-55038145 GAGAAATAAGTGAAAGTGATTGG + Intergenic
992008685 5:72505808-72505830 GAGTAGTTAGGGGAGGTGGTAGG + Intronic
993300448 5:86202932-86202954 GACTGGTAAGTGACAGTGGTAGG + Intergenic
994273303 5:97807550-97807572 AAGTAGAAACTGAAGATGGTTGG + Intergenic
995676514 5:114668510-114668532 CAGAAAGAAGTGAAGGTGGTGGG - Intergenic
996110671 5:119562844-119562866 GACTGGTAAGTGACGGTGGTAGG - Intronic
996210290 5:120799760-120799782 GGGTAGTCAGTGAAGGTAGCAGG + Intergenic
996354886 5:122584828-122584850 GAGTGGGAAGGGAAGGGGGTTGG + Intergenic
998519890 5:142790722-142790744 GAACAGTAAGAGAAGGTGGCGGG - Intronic
999256388 5:150212020-150212042 CAGGAGGAAGTGAAGCTGGTGGG - Intronic
999645750 5:153715376-153715398 GAGGAGTAATTGGAGTTGGTTGG - Intronic
1000948297 5:167449349-167449371 GAGCAGGAGGTGAAGGTGGGTGG + Intronic
1007492206 6:42232241-42232263 CAGAAGTAAGCGAAGGTGGTAGG + Intronic
1008686218 6:53928877-53928899 AAGAAGTGAGTGAAGGTGGTGGG - Intergenic
1008991531 6:57608294-57608316 GAGAACTAAGAAAAGGTGGTTGG + Intronic
1009751946 6:67886431-67886453 GAGTTGTAAGGGAAGTTGGTAGG + Intergenic
1009767376 6:68098016-68098038 GAGTGGTAAGTGAATGTGAAGGG - Intergenic
1012899118 6:104986849-104986871 GAGTTGTAAATGAGGGTAGTAGG - Intronic
1014044150 6:116864565-116864587 TAGTAGTAAGTGAATGTTGAAGG + Intergenic
1017077630 6:150633443-150633465 GAGTCGCAGGTGAAGCTGGTGGG + Intronic
1017138459 6:151168582-151168604 GAGTGGTTAGGGAAGGTGGGAGG + Intergenic
1017657843 6:156646915-156646937 GAGCAGTCAGTGACTGTGGTAGG - Intergenic
1018441101 6:163814116-163814138 GAGAAGAAAGAGAAAGTGGTGGG - Intergenic
1018505896 6:164468257-164468279 CAGTAGTAAGTCAAGGGGTTGGG - Intergenic
1020506531 7:8996162-8996184 AAGTAGTAACTGAAATTGGTGGG + Intergenic
1021254436 7:18373252-18373274 GTGTAGTAAGAAAAGGTGGGTGG + Intronic
1021739049 7:23667173-23667195 CAGTAGAGAGTGAAGGTGATGGG - Intergenic
1026374749 7:69739141-69739163 GGGAGGGAAGTGAAGGTGGTGGG - Intronic
1026405887 7:70065153-70065175 GAATAGCTAGTGAAGGTGGTGGG - Intronic
1028231718 7:88313600-88313622 GGGGAGCAAGTGAAGGAGGTGGG - Intergenic
1028703004 7:93804882-93804904 GAGGAGAAATTGAAGGTGGGTGG + Intronic
1028966467 7:96807204-96807226 GAGGAGAAAGTGAAGGGGGAAGG + Intergenic
1029519872 7:101053159-101053181 GAGTTGGAAGAGGAGGTGGTAGG - Intronic
1030729346 7:112966976-112966998 GGGTTGTAAGTGAAGGTATTTGG - Intergenic
1031417066 7:121507540-121507562 GAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1032159668 7:129501015-129501037 GAGAAGAAAGTGCAGGTGGAGGG + Intergenic
1034275920 7:149823844-149823866 GAGTGGTGAGTGATGGTGGAAGG + Intergenic
1034588033 7:152113541-152113563 AAGTACTAGGTGAAGGGGGTGGG - Intronic
1035021194 7:155801465-155801487 GAGTCCTAAGAGAAGGTTGTTGG + Exonic
1037945759 8:22988463-22988485 GAGTAGTAAGAAAAGGGGGAAGG - Intronic
1040692143 8:49951947-49951969 GAGTAGTAAGGGTAGGTACTGGG + Intronic
1042055724 8:64763505-64763527 GAATAGCAAGCGAAAGTGGTCGG - Intronic
1045189024 8:99865219-99865241 TAGTAGAAAGTGAGGGTGTTGGG - Intronic
1045226306 8:100249482-100249504 AAGTAGTAAGTGAAAGAAGTGGG + Intronic
1045771053 8:105741111-105741133 GAGCAGTCAGTGAAGGTAGAAGG + Intronic
1047345922 8:124028518-124028540 AAATAGGAAGTGAAGGTGGGCGG + Intronic
1048720578 8:137319780-137319802 GAGAAGAAAGTGGTGGTGGTAGG - Intergenic
1050847320 9:10238331-10238353 GATTGGTAAGAGATGGTGGTGGG - Intronic
1051309615 9:15756528-15756550 GAGTAGGGAGTGAAAGAGGTGGG - Intronic
1051391154 9:16565364-16565386 TAGTAATATGTGAAGGTGCTGGG - Intronic
1051394498 9:16605470-16605492 GAGTAGGTAGTGAAGTTGATCGG - Intronic
1053463438 9:38288142-38288164 GAGTGGCCACTGAAGGTGGTGGG + Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057068270 9:92074678-92074700 GAGTTGTAAGGGGAGTTGGTAGG - Intronic
1059643052 9:116235909-116235931 CAATAGTAAATGAAGGAGGTTGG + Intronic
1060140522 9:121205572-121205594 GACTAGAAAGTCAAGGTGGGAGG - Intronic
1061436769 9:130568210-130568232 GAGTAGTAATTTAAGATAGTGGG + Intergenic
1061829665 9:133283310-133283332 GACTAGTGAGTGATGGTGGCGGG + Intergenic
1061829845 9:133284722-133284744 GACTGGTGAGTGATGGTGGTGGG + Intergenic
1061947392 9:133916386-133916408 TTGTAGAAAGGGAAGGTGGTGGG + Intronic
1062008732 9:134255822-134255844 GATTAATAAGTGAAGGTGGCAGG + Intergenic
1192498481 X:71632677-71632699 CAGTAGTTAGTGACTGTGGTTGG - Intergenic
1195317229 X:103691078-103691100 CACTAGTAAGTGGAGGTGGCAGG - Intergenic
1195465216 X:105172231-105172253 GAGGAGAAAGGGAAGGAGGTTGG + Intronic
1198809542 X:140521592-140521614 GGGTAGGAAGTGAAAGTGGGAGG - Intergenic
1199989708 X:152979511-152979533 GAGTAAGAAGGAAAGGTGGTGGG - Intergenic
1200375636 X:155776867-155776889 GAGGTGTAAGTGAAGGTGTGGGG - Exonic
1201613515 Y:15869523-15869545 GAAGAGCAAGGGAAGGTGGTTGG - Intergenic
1201989822 Y:20010959-20010981 GAATAGCAAGTGAAAGGGGTAGG + Intergenic