ID: 1166346216

View in Genome Browser
Species Human (GRCh38)
Location 19:42167789-42167811
Sequence CCATAGGCAATATGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166346216 Original CRISPR CCATAGGCAATATGGGCAAT GGG (reversed) Intronic
900689722 1:3973381-3973403 CCATAGACACTGTGGGGAATAGG - Intergenic
900689745 1:3973471-3973493 CCATAGACACTGTGGGGAATAGG - Intergenic
909174577 1:72339980-72340002 AAAAAGGCAATATGGGGAATGGG - Intergenic
921745418 1:218735007-218735029 CATTAGGCAGGATGGGCAATAGG - Intergenic
921775400 1:219093653-219093675 CCATAGCAAAAATGGGCAAATGG + Intergenic
922194396 1:223347140-223347162 CAATAAGCAATATGGAAAATTGG + Intronic
923071046 1:230564733-230564755 CCATATGGCATATGGGAAATGGG + Intergenic
1069361578 10:67649027-67649049 CCAGAGCCAATCTGTGCAATAGG + Intronic
1070105170 10:73424861-73424883 CCTTAGGCAATTTGGGGGATGGG - Intronic
1074039616 10:109775338-109775360 CCACAGACAAGATGGGCAAATGG + Intergenic
1074202579 10:111251981-111252003 CCAAAGGCAAAATGGACAAAGGG + Intergenic
1074885913 10:117693536-117693558 CCATGGCCAATGTGGGCTATTGG - Intergenic
1080925024 11:36747309-36747331 CCCTAGGCATTATGGACACTTGG - Intergenic
1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG + Intergenic
1096580342 12:52580919-52580941 CCATAGGCAATGTGGAAATTGGG + Intergenic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1111985888 13:95066745-95066767 CCATCGGCAGAATGGGCAAGAGG - Intronic
1114959432 14:27866262-27866284 CCCTAGGCACTATGGCCACTGGG - Intergenic
1115805911 14:37051548-37051570 GCACAGGCAACTTGGGCAATTGG + Intronic
1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125137350 15:36358981-36359003 GCATATGCAACATGGGCATTTGG - Intergenic
1134473461 16:14549312-14549334 GAATAGGGAATATGGGGAATAGG - Intronic
1137811089 16:51353148-51353170 CCACAAGCAAGAAGGGCAATGGG - Intergenic
1138723205 16:59106460-59106482 CCATATGCAAAATGCTCAATGGG + Intergenic
1144304183 17:13952370-13952392 CCATTGTCAATATTGGCAAAGGG - Intergenic
1144516788 17:15923705-15923727 CACTAAGAAATATGGGCAATGGG - Intergenic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1153489568 18:5632944-5632966 GCATAGGCAAGAGGGGCATTTGG - Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
938371722 2:130772823-130772845 CCATAGGCACTGAGGTCAATAGG - Intergenic
939201380 2:139039689-139039711 CCATTGCCATTATGGGGAATTGG + Intergenic
941468032 2:165854011-165854033 CCCTAGGCAGTATGTGCAGTGGG + Intergenic
943057297 2:182998206-182998228 CCATAGCCAATATACGGAATGGG + Intronic
945639604 2:212407047-212407069 ACATAGGGAATATGGGCAGTGGG - Intronic
1170464746 20:16612305-16612327 CCACAGGCAATATGTGACATTGG - Intergenic
1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG + Intergenic
1174855652 20:54042832-54042854 CCCTAGGCAAATTGGGAAATAGG - Intronic
1176513304 21:7764662-7764684 CCATCTGCAATATCTGCAATCGG - Intronic
1178647417 21:34395186-34395208 CCATCTGCAATATCTGCAATCGG - Intronic
1181913124 22:26256386-26256408 CCATAGCCAAAATGGCCAAAAGG + Intronic
1183667839 22:39255454-39255476 CCAGAGGCAAAAAGGACAATCGG + Intergenic
1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG + Intergenic
1184540792 22:45122900-45122922 CAATAGGCTATATGGTTAATTGG - Intergenic
951130428 3:19036078-19036100 CCAAAGCAAAAATGGGCAATTGG + Intergenic
951770145 3:26246151-26246173 CAATAGACGATATGGGCATTTGG + Intergenic
953560137 3:43982653-43982675 CTATAGTCAATATGGTCAATTGG - Intergenic
957693410 3:83600721-83600743 CCATAGTCAATAGGCACAATAGG - Intergenic
957864378 3:86003269-86003291 CCATGGGGAAAATGGGGAATGGG - Intronic
957968915 3:87358366-87358388 CCATAGACAATAATGCCAATTGG + Intergenic
959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG + Intergenic
962250179 3:133831384-133831406 CCATTAGCAACATGGGCAACTGG + Intronic
962470072 3:135699003-135699025 CCATATGTGAGATGGGCAATGGG - Intergenic
965612206 3:170556334-170556356 CCAGAGGCAATATGGCAAAGTGG + Intronic
965854453 3:173071436-173071458 CCAAAGGAAAAATGGGCAAATGG + Intronic
967953574 3:194859724-194859746 CTATAGGAAATATGAGAAATGGG - Intergenic
972115468 4:35627787-35627809 GGATATGCAATATGGACAATAGG + Intergenic
975512241 4:75206849-75206871 CCAAAGGCAATAGGGGCAGAGGG - Intergenic
980212780 4:129811356-129811378 CCATAGGGGATATGGCCATTGGG + Intergenic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
980689143 4:136270189-136270211 GCATAGGCAATACGGACGATTGG + Intergenic
982802995 4:159727187-159727209 CCATACTCAAGATGGGCATTTGG - Intergenic
983276952 4:165629342-165629364 CCATAGGAAATAAATGCAATGGG - Intergenic
983617878 4:169727920-169727942 CCAAAGGCAACATGAGCCATTGG + Intergenic
987460885 5:18208340-18208362 CCATAAGTAAAATGGGTAATGGG + Intergenic
989146479 5:38256031-38256053 CCATAGGCGATTTGGGAAATAGG - Intergenic
994744627 5:103663547-103663569 CGATAGGCAATATAGGTATTTGG - Intergenic
995433872 5:112113565-112113587 CCAAAAGCATTATGGGTAATTGG - Intergenic
995945517 5:117640377-117640399 CCATGGGCAATCTGAGCAAGAGG + Intergenic
997181047 5:131829553-131829575 AGAGAGGCAATATAGGCAATCGG + Intronic
1005696368 6:28356116-28356138 CCAAAGGCAATATGTGGACTCGG - Exonic
1010775972 6:79886216-79886238 CCAAAGCAAATATGGGCAAATGG + Intergenic
1013137260 6:107294566-107294588 CCATAGACAATAGGTGCCATTGG + Intronic
1013530080 6:111011116-111011138 CCACAGGCAAGATGGACAGTAGG - Intronic
1017780844 6:157714092-157714114 CCATAAGCAATAGGGGTAAATGG - Intronic
1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG + Intergenic
1027830168 7:83166824-83166846 CCATTGGCAATATGGCCTACGGG + Intergenic
1035857426 8:2990992-2991014 CCATAGGGTATATTAGCAATAGG + Intronic
1040535701 8:48307719-48307741 CCAAAGGCAAAATGAGCAAGAGG - Intergenic
1041019991 8:53629076-53629098 CCAAAGGAAAGATGGGCAAAAGG - Intergenic
1041879001 8:62725384-62725406 CCAAAGCAAAAATGGGCAATTGG - Intronic
1043611973 8:82076150-82076172 CCATATACAAAATGGCCAATAGG - Intergenic
1051169341 9:14303418-14303440 ACAAAGGCAATATGGGGAATAGG + Intronic
1052787219 9:32840088-32840110 AAATAGGCAATTTGGGCTATAGG - Intergenic
1053103407 9:35390407-35390429 CCATAGGCAAGATGGGCCTGGGG - Intronic
1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG + Intronic
1058814120 9:108668126-108668148 GCACAGGTAACATGGGCAATGGG + Intergenic
1062311252 9:135938689-135938711 CCACAGGCAAGCTGGGCACTTGG - Intronic
1189123201 X:38417247-38417269 CTAAAGGCAATATAGGGAATTGG + Intronic
1189471142 X:41315217-41315239 CCAGAGGCAATAATGGCAACAGG + Intergenic
1194869376 X:99109265-99109287 CCATAGGGAAAGTGGGCAAAAGG + Intergenic
1199585796 X:149414606-149414628 CCATAGGCAAGAAGAGAAATGGG - Intergenic