ID: 1166348431

View in Genome Browser
Species Human (GRCh38)
Location 19:42181447-42181469
Sequence ATGAACAGGCAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 435}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166348431 Original CRISPR ATGAACAGGCAGAATGAGGA GGG (reversed) Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
902705414 1:18200886-18200908 ATGAGGAGGGATAATGAGGAGGG + Intronic
902873741 1:19328883-19328905 GTGAGTAGGCAGAATGAGGTAGG - Exonic
904159503 1:28512324-28512346 ATGACCAGGAAGAATGATCAAGG - Intronic
904599383 1:31665289-31665311 ATGCACAGGAAGAATAAAGAAGG - Intronic
904794456 1:33048822-33048844 ATGAGCAGGTAGTATGAGCAAGG + Intronic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905311362 1:37051400-37051422 ATGAACACGCAGAATGCAGAAGG - Intergenic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905474954 1:38219504-38219526 ATGTGCAGGCAGGAAGAGGAAGG + Intergenic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908580671 1:65512637-65512659 AAAAACAGACAGGATGAGGAGGG + Intronic
908849536 1:68361333-68361355 ATGACAAGGCAGAATGAGGTAGG - Intergenic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909116297 1:71541422-71541444 ATGAAAAGGCAGCTTGAGGGTGG + Intronic
910367707 1:86484444-86484466 ATACACAGCCAGAATGAGAATGG + Intronic
911127471 1:94353833-94353855 AAGAACAGGCTGAGAGAGGATGG - Intergenic
911541862 1:99165992-99166014 GGGCACAGGCAGAATTAGGAGGG - Intergenic
912683513 1:111743868-111743890 ATGATCAGGCAGCATGTGGTGGG - Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914244925 1:145878390-145878412 ATCAACAGCAAGAATGAGGATGG - Exonic
915302690 1:154960505-154960527 AAAAACAGGCAGAACTAGGATGG + Intronic
915328901 1:155097066-155097088 GACAACAGGCAGAATGGGGAGGG - Intergenic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916348958 1:163827078-163827100 AGGAGCAGGCAGAATGAGCTAGG - Intergenic
916630984 1:166612141-166612163 ATGAGCAGGCAGCACAAGGAAGG - Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917669467 1:177259013-177259035 ATGATTAGGCATAGTGAGGAAGG + Intronic
917938911 1:179896678-179896700 AATAGCAGGCAGAATGAGGACGG + Intronic
918014698 1:180622054-180622076 CTCAACAGGCAGGATCAGGAAGG - Intergenic
918743289 1:188164612-188164634 AATAACAGGAAAAATGAGGAAGG + Intergenic
919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG + Intergenic
919553874 1:199027791-199027813 ATGATCAGGCAGAATAATCAGGG - Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
921278942 1:213546339-213546361 GTCAGCAGGCAGAGTGAGGATGG + Intergenic
921759713 1:218899048-218899070 AAGAGCAGGCAGAGAGAGGAAGG - Intergenic
922094615 1:222432359-222432381 AGGAACAGGCAGAATTATCAGGG - Intergenic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924256899 1:242191807-242191829 AGGTACAGAGAGAATGAGGAGGG + Intronic
924549551 1:245062835-245062857 ATGAGCAGACAGATTGAAGAGGG - Intronic
924652869 1:245946643-245946665 ACGTACAGGCAGAGTGGGGAGGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1063114429 10:3063966-3063988 ATGCACAGGCAGAAACAGCAGGG + Intergenic
1063670393 10:8095447-8095469 ATGAACAGGGAAGTTGAGGACGG + Intergenic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1066411002 10:35169205-35169227 ATGAACAGGAAGAATCAATATGG - Intronic
1066457354 10:35584072-35584094 ATGTACAGGCAGAATGTGATTGG - Intergenic
1066704278 10:38160734-38160756 ATGAGCATGCAGAAAGAGGTGGG - Intergenic
1066986344 10:42471124-42471146 ATGAGCATGCAGAAAGAGGTGGG + Intergenic
1068170985 10:53394386-53394408 ATAATCAGGCAGAATGAGGATGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069231695 10:66017656-66017678 ATCAACAGGCACATTTAGGATGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070453035 10:76581099-76581121 TGGAAGAGGCAGAAAGAGGAAGG + Intergenic
1070696983 10:78570823-78570845 AGGGCCAGGCAGAGTGAGGATGG - Intergenic
1071562490 10:86655085-86655107 ATAAACAGGCTGATAGAGGAGGG + Intronic
1071786908 10:88911330-88911352 ATGAACAGCCAGTAGGAGGTAGG + Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072923721 10:99597877-99597899 AGGAACAGGCAGAAAGAGAATGG + Intergenic
1074556924 10:114499976-114499998 ATGAACAGGCAGGATAATGAGGG + Intronic
1074671373 10:115796008-115796030 GTGCCCAGGCAGAGTGAGGAGGG - Intronic
1075154521 10:119963518-119963540 AGGAACAGCCTGAATGAGCAAGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075449727 10:122542061-122542083 ATTAACAGACATAAAGAGGATGG - Intergenic
1076028138 10:127134256-127134278 ATAAACAGTCACAAGGAGGATGG - Intronic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077035157 11:490946-490968 CTGACCAGGCAGAAAGGGGAGGG - Exonic
1077449861 11:2634025-2634047 CTGAGCAGGCAGAATGAAGCTGG - Intronic
1078282878 11:9920276-9920298 AAAAACAGGCAGAATTGGGAAGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079946013 11:26741536-26741558 ATAAATAGGAAGAATGGGGATGG - Intergenic
1080197957 11:29633608-29633630 ATGATCAGGCCAAGTGAGGAGGG + Intergenic
1080277357 11:30517616-30517638 AGAAACATGCAGGATGAGGAAGG - Intronic
1080569183 11:33540984-33541006 AAGAAAAGGAAGAATGAGAAAGG + Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080941598 11:36924439-36924461 ATTAACAAGAGGAATGAGGAAGG + Intergenic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1083829531 11:65222555-65222577 ATGAACGGGAGGAAGGAGGAAGG + Intergenic
1084577221 11:69997173-69997195 ATCCACAGGAAGAATAAGGATGG + Intergenic
1084943254 11:72625555-72625577 AGGAAAAGGCAGCCTGAGGAGGG + Intronic
1085653410 11:78289752-78289774 ATGAACACAAACAATGAGGAAGG + Intronic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1086592314 11:88530136-88530158 TTGGACAGGTAGAATGAGCATGG - Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1087998223 11:104838949-104838971 AAGCCCAGGCAAAATGAGGAAGG - Intergenic
1089322675 11:117637094-117637116 ATGAGCAGGCAAAGTGGGGAGGG - Intronic
1089556068 11:119316577-119316599 ATGCCCAGGCAGAAGGGGGAAGG + Intronic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1092282225 12:7106906-7106928 GTAAACTGGCAGAATGAGGAGGG + Intronic
1094151557 12:27290017-27290039 ATGAGCAGGAAGATTGAGCAGGG + Intronic
1094160603 12:27385959-27385981 ATGCACAGGAATGATGAGGACGG - Intronic
1095169400 12:39016261-39016283 ATGAACAGAAAGACTGTGGATGG + Intergenic
1095550362 12:43430931-43430953 ATGATCAGGCTGGATGAGGATGG - Intronic
1095990031 12:48028191-48028213 ATAAAAAGGCTGAATGAGGCCGG + Intergenic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096191217 12:49621470-49621492 ATGAACAGTCAGATTGGAGAAGG + Intronic
1097116218 12:56699308-56699330 ATGAACAGTGAGGATGACGAGGG + Intergenic
1097129895 12:56804283-56804305 GTGACCAGGAAGAATGAGGTAGG + Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1098239045 12:68447445-68447467 AAGAACAGGAATAATGAGGCTGG + Intergenic
1098437390 12:70482263-70482285 ATGAAGAGCAAGAATAAGGATGG - Intergenic
1098729443 12:74014690-74014712 ATGTACAGGCAGCATGGTGATGG + Intergenic
1099295456 12:80823145-80823167 ATGTCCAGGAAGAATGAGGTAGG - Intronic
1099664740 12:85613581-85613603 AGGAAATGGCAGAATCAGGAGGG - Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1101560234 12:105850443-105850465 AACAGCAGGCAGCATGAGGAGGG - Intergenic
1102020748 12:109680556-109680578 AAGAACTGGTAGAATGTGGATGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103277842 12:119728127-119728149 ATGAACAGGCAGAGTACAGAGGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1104429775 12:128706546-128706568 CTGCACAGGCAAAATTAGGAAGG + Exonic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106384200 13:29268204-29268226 ATGAGTAGCAAGAATGAGGAAGG + Intronic
1107121502 13:36801361-36801383 CTGAGCTGGCAGAATGAGGCTGG + Intergenic
1107556349 13:41519543-41519565 ATGCAAAGGCAGAACGCGGAAGG - Intergenic
1107597979 13:41983525-41983547 AAGATAAGGAAGAATGAGGAAGG - Intergenic
1108071592 13:46634501-46634523 AGGCACAGCCTGAATGAGGAAGG - Intronic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1111686435 13:91507239-91507261 ATCACATGGCAGAATGAGGAAGG + Intronic
1111983324 13:95039924-95039946 AGCAACAGGCAGAGTGAGGGTGG + Intronic
1112105050 13:96231185-96231207 ATCAACAGGCACAGTAAGGATGG - Intronic
1112156887 13:96827268-96827290 ATGAACAGACAGATTGAAGGTGG + Intronic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113682666 13:112255239-112255261 GTGAACAGTTAGAATGACGATGG + Intergenic
1114209025 14:20600242-20600264 TTCACCAGGCAGAATGGGGAAGG + Intronic
1114507476 14:23228535-23228557 ATGAGCAGGGAGGATGAGCAGGG + Intronic
1115452950 14:33569663-33569685 AGGAACATGCAGATAGAGGATGG + Intronic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1117728440 14:58696790-58696812 ATGAACAGGCATATTGGGAATGG + Intergenic
1119661670 14:76456640-76456662 AGGAACAGGCTGGATGAGGATGG + Intronic
1120811962 14:88812857-88812879 ATGAACTGGCAGAGTGAGGCAGG + Intergenic
1120917537 14:89722989-89723011 AGGAACAGGCTGGATGGGGAAGG - Intergenic
1120996070 14:90419613-90419635 AGGAAGAGGTAGAATGAGGCTGG + Intergenic
1121092377 14:91191564-91191586 GGGAACAGGGAGAATGAGGCTGG - Intronic
1123165533 14:106322253-106322275 ATTAACAGACAGAATTATGAAGG - Intergenic
1125298883 15:38233223-38233245 ATGAAGGGGCAGAATGAAGGGGG + Intergenic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1126464243 15:48946442-48946464 AGGAAGAGGAAGGATGAGGAAGG - Intronic
1128310564 15:66629565-66629587 ATACACAGCTAGAATGAGGAGGG + Intronic
1128407866 15:67362061-67362083 GGGAACAGGAAGAAAGAGGAAGG + Intronic
1128672883 15:69587464-69587486 ATGAACATGCAGAATGTGCTTGG + Intergenic
1128922948 15:71628864-71628886 GGAAACAGGCAGAATGAGGCTGG + Intronic
1129801438 15:78418059-78418081 AAGAGCAGGCAGAATGTGTAGGG + Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130081565 15:80738373-80738395 ATGTACAGGCAGCAAGAGTAAGG + Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130540717 15:84819067-84819089 AAAACCAGGCAGAATGGGGAGGG + Intronic
1131539314 15:93262825-93262847 ATGAATGGGCAGAATAAGAATGG - Intergenic
1132318148 15:100905412-100905434 AAGAACATGCAGAGGGAGGATGG + Intronic
1132337196 15:101055594-101055616 AGGAGCAGACAGAATAAGGACGG + Intronic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1132853996 16:2036728-2036750 GTGAACGGGCAGAATGTGGAGGG + Exonic
1133434908 16:5770763-5770785 ATGAACTGGCAGGATGTGGGTGG + Intergenic
1134197544 16:12170524-12170546 AAGCTCAGGCAGAAGGAGGAGGG + Intronic
1135340799 16:21646321-21646343 ATGTCCAGGCAGAATGGGAAGGG + Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136097008 16:27963847-27963869 ATGCAAAGGCAGACTCAGGATGG - Intronic
1136319042 16:29470684-29470706 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1136367417 16:29815142-29815164 ATGAGGAGGCAGGAAGAGGAAGG - Intronic
1136433613 16:30210028-30210050 ATGATTCCGCAGAATGAGGAGGG - Intergenic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1138751765 16:59430905-59430927 ATGAACAGGCAGCAAGAGGATGG - Intergenic
1139271496 16:65687689-65687711 GTGATCAGGCAGACTGTGGATGG - Intergenic
1140734035 16:77881992-77882014 ATGCACAGCCAGGATGGGGATGG + Intronic
1141320638 16:83005334-83005356 ATGAACAGGGAGAAAGAGTGAGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143883453 17:10048346-10048368 ATAAACAGGCAAAAAGAGAAAGG + Intronic
1145240856 17:21240505-21240527 ATGAGCTTGGAGAATGAGGAAGG + Exonic
1146561107 17:33871425-33871447 ATGAGCAGGGAGAAGGAGGTGGG - Intronic
1147549450 17:41429189-41429211 AGGAACAGGCAGTAGGTGGAAGG + Intergenic
1148153422 17:45409794-45409816 ATGAACAGGAGCAAGGAGGAGGG - Intronic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1149119839 17:53149417-53149439 AGGAGCAGGCAGAATGTAGATGG - Intergenic
1149863456 17:60137370-60137392 ATAAACAGACAAAATCAGGAGGG + Intergenic
1150178127 17:63083652-63083674 ATTATCAGGCAGACTGGGGAAGG - Intronic
1151203880 17:72490625-72490647 ATGAAGAGGTAGAATGTGAATGG - Intergenic
1151265901 17:72954711-72954733 ATCAACAGTCAGAATATGGATGG + Intronic
1152009385 17:77701838-77701860 ATGAAAGGGAGGAATGAGGATGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155344407 18:24844153-24844175 AAGCACTGGCAGAATGAGGCAGG - Intergenic
1157425914 18:47584127-47584149 ATGTACAGGTAGAGTCAGGAAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159522313 18:69542029-69542051 CTGAAAAGGCAGAATGGAGATGG + Intronic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159754323 18:72345177-72345199 AATAAATGGCAGAATGAGGAAGG + Intergenic
1162303379 19:9856923-9856945 AGGAACAGGGGGAATGAGGATGG + Intronic
1164533465 19:29065571-29065593 GTGCACAGGCAGGCTGAGGAGGG + Intergenic
1165451185 19:35884335-35884357 ATGAAGATGCAGTAAGAGGATGG - Intergenic
1165827506 19:38713710-38713732 AGGAACAGAAAGAGTGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166896491 19:46025615-46025637 ATGAACAGACAGTTTGAAGATGG - Intergenic
1166901534 19:46067672-46067694 ATGAACAAGCAGAATGGAGGAGG + Intronic
1167110561 19:47458200-47458222 ATGAACAGTCAGAAAGAGGTGGG - Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
925184483 2:1837633-1837655 AGGAACAGGCTCAATGGGGAGGG + Intronic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926241059 2:11085772-11085794 ATGAAGAGGCAAAATGAATATGG - Intergenic
926498204 2:13617821-13617843 ATGAACAGGCAATAAGAGCAAGG + Intergenic
926937726 2:18103261-18103283 ATGCACAGGCAGGAAGATGATGG + Intronic
927207804 2:20621083-20621105 ATGAACAGGAAGAACCAGGCAGG + Intronic
927658113 2:24969049-24969071 ATGAACAGAAAGGATAAGGATGG - Intronic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
929389079 2:41447608-41447630 ATGATCATGCAGAATGAGTGAGG + Intergenic
930541103 2:52707826-52707848 GTGAACCGCCAGAATGGGGAAGG - Intergenic
931493237 2:62772716-62772738 ATGAACAGTCATGATGATGATGG - Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932356457 2:71071982-71072004 AGGACCAGGCAGCAGGAGGAAGG + Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932569135 2:72928754-72928776 ATGCACAGGAAGAATGACTAGGG + Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
942619722 2:177834146-177834168 ATGACCAGGAAGAATTAGGCAGG - Intronic
942720246 2:178943479-178943501 AGGAGTAGGCAGGATGAGGATGG - Intronic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943338397 2:186646608-186646630 AAGAAAGGGAAGAATGAGGAAGG - Intronic
944461086 2:199951536-199951558 ATGAAATGGAAGAATGTGGATGG - Intronic
944574361 2:201077126-201077148 ATGAACAGGCCCAATAAGGTAGG - Intronic
945114482 2:206397859-206397881 AGAAATAGGCAGAGTGAGGAGGG + Intergenic
947384222 2:229575191-229575213 AAAATGAGGCAGAATGAGGAAGG + Intronic
947461997 2:230311503-230311525 AAGAAAAGGCTGAATGAGCACGG + Exonic
947471081 2:230401715-230401737 AAGAAAAGGCTGAATGAGCACGG + Exonic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948085497 2:235243388-235243410 TTGAACAGGCAGAAGGACTAAGG + Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1170360841 20:15544399-15544421 TTGAACAGCTAGGATGAGGAGGG + Intronic
1172965780 20:38833774-38833796 GTAAGCAGGCAGAATGGGGAAGG - Intronic
1173189531 20:40865415-40865437 TAGAACAGGCAGGATGGGGATGG - Intergenic
1173879790 20:46403593-46403615 ATGAAGAGCCAGAATCAGTATGG - Intronic
1175528699 20:59658637-59658659 ATTAACAGGGAGATTAAGGAAGG - Intronic
1175626853 20:60495761-60495783 AGGAACAGGCAGACAGTGGATGG - Intergenic
1175728845 20:61338551-61338573 AGGACCAGGCAGATTGGGGAGGG - Intronic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1178779251 21:35585286-35585308 ATTAACAGTCAGAATGAAAAGGG + Intronic
1178845330 21:36169756-36169778 AAGAAATGGCAGGATGAGGATGG - Intronic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179276292 21:39894960-39894982 ATGAACAGACAGACGGAGGTAGG - Intronic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183612534 22:38919871-38919893 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183655550 22:39182613-39182635 AGGAACAGGCAGATAGAGAAGGG - Intergenic
1183679107 22:39316782-39316804 AAGAAATGGCAGGATGAGGATGG - Exonic
1183681468 22:39332737-39332759 ATGATTAGGCTTAATGAGGAAGG - Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
953391192 3:42534851-42534873 ATGACCAGGAAGTATGAGGATGG - Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
955898055 3:63721868-63721890 ATGGACAGGAAGAATCAGTATGG + Intergenic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957802794 3:85106752-85106774 ATGACAAGGCAGAATAGGGAGGG + Intronic
958584542 3:96069392-96069414 TGGAACAGGCACAATGAGCAAGG + Intergenic
958661631 3:97076137-97076159 ATGATTAGGCTTAATGAGGAAGG + Intronic
958824813 3:99017527-99017549 ATCATCAAGCAGGATGAGGAGGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959685763 3:109144235-109144257 TTGATCAGGCAGAATGAAAAAGG + Intergenic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
962772586 3:138626973-138626995 ATGAACAGGCATCATGAGAAAGG - Intronic
963018040 3:140844513-140844535 ATTAACAGGCATAATCAGGAAGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964302194 3:155300970-155300992 ATAAACAGGGATAAAGAGGAAGG + Intergenic
965007415 3:163043640-163043662 ATGAACAGCCAGAATAGCGAGGG + Intergenic
965755002 3:172016770-172016792 GTGAACAGAGAGGATGAGGAGGG - Intergenic
965903879 3:173678503-173678525 ATTAACAGGTGGAAAGAGGATGG + Intronic
966052912 3:175643168-175643190 ATCAACATGGAGAATGAGTAGGG - Intronic
967296373 3:187969092-187969114 ATCACCAGGCAGTATGAGGCTGG + Intergenic
968664324 4:1812667-1812689 ATGACGAGGGAGAATGACGAGGG + Exonic
968914402 4:3490996-3491018 ATGAGCAGGAAGAAGAAGGAAGG - Intronic
970340388 4:15100241-15100263 AAGACCTGGCAGAAAGAGGAAGG - Intergenic
970979863 4:22083568-22083590 ATAAACAGACAGAAAGGGGATGG + Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971609719 4:28707632-28707654 ATGATTAGGCTTAATGAGGAAGG + Intergenic
972471256 4:39406851-39406873 TTGAACTGGGAGACTGAGGATGG - Exonic
973940391 4:55903413-55903435 TTGAACAGGCAAAGTGGGGATGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974278434 4:59758823-59758845 ATGTTCAGGAAGAATGAGGTAGG + Intergenic
975482106 4:74891957-74891979 ATCAATGGGAAGAATGAGGAAGG + Intergenic
976103629 4:81593047-81593069 AAGAACAAGCAGAAGGAGCAGGG + Intronic
976455078 4:85237057-85237079 AACTACTGGCAGAATGAGGATGG - Intergenic
976480098 4:85532714-85532736 ATGAAATGGCAGAATGTGCATGG - Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977532551 4:98217348-98217370 AGAAACAGGCAGAGTGAGGAAGG + Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978417252 4:108489525-108489547 AGAAACAGGGAGAGTGAGGAAGG - Intergenic
978755547 4:112298181-112298203 ACAAACAGGCAGGATCAGGAAGG + Intronic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
979031212 4:115650270-115650292 GTGAACAGGCAGAAAGTAGAGGG - Intergenic
979593980 4:122512466-122512488 ATCAATAGGCAAGATGAGGATGG + Intergenic
979715267 4:123830068-123830090 ATTCACAGGCAGATTCAGGAAGG - Intergenic
980243244 4:130203399-130203421 ATAACCAGGAAGAATGAGGTAGG - Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983257249 4:165413709-165413731 ATGAACAGGAACACAGAGGAGGG + Intronic
984459284 4:180012525-180012547 ATGAGCAGGAAGAAGGAGAAAGG - Intergenic
984899122 4:184569044-184569066 ATGATTAGGCTTAATGAGGAAGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
986307793 5:6528626-6528648 ATGAACAGCCAGAATCAGAGGGG + Intergenic
986507397 5:8466592-8466614 ATAAACAGACAAAATGGGGAAGG + Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
989092478 5:37748022-37748044 ATGAATAGGAAGAATCAGTATGG + Intronic
989497263 5:42124009-42124031 ATGTACAGGAAGCATGAGGCTGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990000101 5:50882769-50882791 AAAAACAGGCAGAATGAAAATGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992860459 5:80904109-80904131 AATAACAGGCAGACTGGGGAGGG + Intergenic
993551375 5:89277945-89277967 CTGAACAGTCAGAATGGGCATGG + Intergenic
994284992 5:97954449-97954471 ATACACAGGCATAATGAGCAGGG - Intergenic
994694934 5:103062377-103062399 AGAAACAGGCAGAAGGAGTAAGG + Intergenic
995466434 5:112453784-112453806 AAGAGCAGGTAGAATGAAGAAGG + Intergenic
998170323 5:139868812-139868834 ATGAGCAGGCAGATGGAGGTGGG + Intronic
998506944 5:142679684-142679706 ATGAACAGAAAGAGTGAAGAGGG - Intronic
998754854 5:145366052-145366074 CTGCACAGGCAGATTGAGGTAGG - Intergenic
998797055 5:145831795-145831817 ATGAAAAGGCAGAACTGGGAAGG - Intronic
999408496 5:151328299-151328321 AGTAGCAGGCAGAATGGGGAAGG + Intronic
1000062524 5:157669842-157669864 AGGAACAGGCTGAGTGGGGATGG + Intronic
1000169022 5:158683469-158683491 ATGAAAAGGCAGACTCAGGGAGG - Intergenic
1000993207 5:167932448-167932470 ATAAACAGGCATAATTAGTAGGG + Intronic
1001008048 5:168072392-168072414 ATCAAAAGGCAGCATGATGAGGG + Intronic
1001690433 5:173628802-173628824 AGGGACAGGCGGAATGAGGTTGG + Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1003124022 6:3340916-3340938 AGGATCAGGTTGAATGAGGAGGG + Intronic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004283954 6:14302987-14303009 ATGAACAGGCAGAGTACAGAGGG - Intergenic
1004750265 6:18555239-18555261 ATGGAAAGGCAGAATGACAAAGG + Intergenic
1004857189 6:19763256-19763278 ATGATTAGGCATAGTGAGGAAGG + Intergenic
1004989325 6:21119143-21119165 CTCAACAGGAAGAAAGAGGAAGG - Intronic
1006044216 6:31280710-31280732 AAGAAATGGCAGGATGAGGATGG + Intronic
1006456476 6:34134863-34134885 ATTAGCAGTGAGAATGAGGAAGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007238856 6:40410877-40410899 ATTCACAGGCAAAATCAGGATGG - Intronic
1008118580 6:47583402-47583424 ATGAATAGGTAGAATAAAGAAGG - Intronic
1008786987 6:55180349-55180371 ATGCATAGGCAAAAAGAGGAAGG + Intronic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010504495 6:76640638-76640660 AATAACAGGCATATTGAGGAGGG - Intergenic
1010509774 6:76704103-76704125 ATGATCAGGTAAAGTGAGGATGG + Intergenic
1010534637 6:77011931-77011953 ATGTTCAGGAAGAATGAGGTAGG - Intergenic
1011128240 6:84029570-84029592 ATGAAGAGGCAGCATGGGGGTGG - Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1011195747 6:84777523-84777545 AGGAAGTGGCAGGATGAGGAAGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012252778 6:96997288-96997310 AGCAACAGGGAGAATGAAGATGG - Intronic
1012777051 6:103510162-103510184 AGGAAAAGGCAAAATGAGCATGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013057951 6:106603462-106603484 AAGAACATGCAGTATGAGGATGG - Intronic
1013764508 6:113558974-113558996 ATGAGCAGACAGAATAAAGATGG - Intergenic
1014262722 6:119238003-119238025 AAGAAAAGGCAGAAAGAGCAGGG - Intronic
1014857389 6:126418674-126418696 ATAAACAGCAAGAATGATGATGG - Intergenic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1015725840 6:136298493-136298515 ATAAACAAGAAGAATAAGGATGG + Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1017207031 6:151814059-151814081 AGGAACAGGCAGAATGAGCCCGG - Intronic
1021105805 7:16638435-16638457 ATGAACAGCCAGATGGAAGAGGG + Intronic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022840620 7:34160788-34160810 ATGAGCAGGCAGAGTGAGGCCGG - Intergenic
1022966840 7:35482097-35482119 CTGAACAGAAAGAATGAGGGAGG - Intergenic
1023332612 7:39134498-39134520 ATGTAAAGACAGAATGAAGAAGG - Intronic
1024053134 7:45642157-45642179 ATCAGCAGGCAGAAGGAGGAAGG + Intronic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026133958 7:67643130-67643152 TAAAACAGGCAGAATCAGGAAGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026603970 7:71800224-71800246 ATGAAAAGGCTGGATGATGATGG - Intronic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1028195016 7:87895994-87896016 ATAAGCAGGCAGATTGTGGAAGG - Intronic
1029158388 7:98533519-98533541 ATGAGCGGGCAGACGGAGGAAGG - Intergenic
1030473567 7:109999206-109999228 AAGAAATGGCAGAATGAGGATGG - Intergenic
1032419142 7:131764126-131764148 GGGAACAGGCAGAAGTAGGAGGG - Intergenic
1033017314 7:137684964-137684986 ATGAAAAGCCAGAAGGAGGCAGG - Intronic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036943058 8:13069709-13069731 AGGAACAGAGAGAATGAGGAGGG - Intergenic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1038419427 8:27422881-27422903 AATACGAGGCAGAATGAGGATGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1039364100 8:36912467-36912489 ATGAACAGCCAGACTTAGGAGGG + Intronic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039701081 8:39962566-39962588 ATGACCAGGAAGAATTAGGCAGG + Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042709984 8:71706760-71706782 AAGAAAAGGCAGAAAGAGGCTGG + Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043333574 8:79146644-79146666 TTGAAAGCGCAGAATGAGGATGG - Intergenic
1043459663 8:80446626-80446648 ATGAGTGGGCAGAATGAGCAGGG + Intergenic
1043914169 8:85901220-85901242 ATCATCAGGAAGAATGGGGAAGG - Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1047921508 8:129639408-129639430 ATGAAGAGGGAGAATCAGGGAGG + Intergenic
1049106961 8:140620076-140620098 AGGAACAGTCAGAATGTGAAGGG + Intronic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051147337 9:14041441-14041463 AAGAAATGGCAGGATGAGGATGG - Intergenic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055247381 9:74263571-74263593 ATTAACAGGAAGAAAAAGGATGG - Intergenic
1055692548 9:78848125-78848147 TTGAAAAGGCACAATGGGGATGG + Intergenic
1056647736 9:88429551-88429573 ATGAACAGCCAGATGGAAGAAGG + Intronic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056967622 9:91178327-91178349 ATGAACAGGAAAACAGAGGAGGG + Intergenic
1057419107 9:94895075-94895097 ATCAAAAGGCAGCATGAGGCTGG + Intronic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057727720 9:97580010-97580032 ATAAACAGGCCGAGTAAGGAAGG + Intronic
1057840470 9:98481994-98482016 AAGAACAGGCTGAAAGAGAACGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058404705 9:104659584-104659606 AAGAACAGGTTGAATGAGGTTGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058898500 9:109420832-109420854 ATAAACAGGCAGAATTAGATGGG + Intronic
1059345310 9:113624270-113624292 GTGACCAGGCAGAAAGAGCATGG + Intergenic
1060176916 9:121503892-121503914 ATGAACAGACAGCATTTGGAAGG + Intergenic
1060495748 9:124117643-124117665 GTGAACAGGGAGGCTGAGGATGG + Intergenic
1186806342 X:13143772-13143794 CTGTACAGGGAGAATGATGAGGG + Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1189653177 X:43211633-43211655 ATGCACTGGCAGGATGTGGAAGG - Intergenic
1189686640 X:43571116-43571138 AGAAACAGGCAGAAAGAAGATGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190502654 X:51095198-51095220 AGGAACAGGCAGAGAGAGAATGG - Intergenic
1190821824 X:53980411-53980433 ATGAAGAGGCAGCAAGACGAAGG + Intronic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1192087244 X:68112798-68112820 TTGAACAGGCAAAATGCTGAAGG + Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1193211400 X:78810861-78810883 ATGTCCAGGAAGAATGAGGTAGG + Intergenic
1193217085 X:78876015-78876037 ATGAATTGACAGAATGAGGTAGG + Intergenic
1193678613 X:84488053-84488075 AAAAGCAGGCAGATTGAGGATGG - Intronic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1197091094 X:122538657-122538679 AAGAAACGGCAGAAAGAGGATGG + Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198279752 X:135130071-135130093 TTGAACAGGCCGCATGAGGATGG - Intergenic
1198291205 X:135242443-135242465 TTGAACAGGCCGCATGAGGATGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199557234 X:149122681-149122703 AGGAAATGGCAGAATGATGATGG - Intergenic
1199854739 X:151751209-151751231 ATGAACAAGAAGATTGTGGAGGG - Intergenic
1200211871 X:154350293-154350315 ATGGACCGGCAAAATGGGGAGGG - Intronic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic