ID: 1166349848

View in Genome Browser
Species Human (GRCh38)
Location 19:42191425-42191447
Sequence CACTCCTTCAGACCTAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166349842_1166349848 -1 Left 1166349842 19:42191403-42191425 CCAGTAATACCAATCCTTTCCTC 0: 1
1: 0
2: 2
3: 12
4: 176
Right 1166349848 19:42191425-42191447 CACTCCTTCAGACCTAAGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 128
1166349843_1166349848 -10 Left 1166349843 19:42191412-42191434 CCAATCCTTTCCTCACTCCTTCA 0: 1
1: 2
2: 4
3: 79
4: 915
Right 1166349848 19:42191425-42191447 CACTCCTTCAGACCTAAGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 128
1166349841_1166349848 18 Left 1166349841 19:42191384-42191406 CCATGACTCTCACAGCACTCCAG 0: 1
1: 0
2: 2
3: 59
4: 335
Right 1166349848 19:42191425-42191447 CACTCCTTCAGACCTAAGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166349848 Original CRISPR CACTCCTTCAGACCTAAGGG TGG Intronic
904418181 1:30375393-30375415 GACTCCTGCAGACCCGAGGGTGG + Intergenic
912412663 1:109489199-109489221 CACTCCCTCAGCCCTGAGTGTGG + Intronic
914428830 1:147601134-147601156 CCCTCCTTCAGACCTCTTGGAGG - Intronic
918271992 1:182910789-182910811 CACTCCTTCAGAGCTAAGCCAGG - Intronic
922456467 1:225777641-225777663 CACTCATTCAGCCCTACCGGGGG + Intergenic
1068492129 10:57737582-57737604 CACCTCTCCAGACCTGAGGGTGG - Intergenic
1069935833 10:71915401-71915423 CAGACCTTCAGACCTTAGGTTGG + Intergenic
1074873414 10:117595596-117595618 CGTCCCTTCAGCCCTAAGGGTGG - Intergenic
1078650443 11:13186023-13186045 TGTTCCTTCAGGCCTAAGGGTGG - Intergenic
1080154210 11:29089102-29089124 CTCACCTTCAGACTTTAGGGAGG + Intergenic
1081850909 11:46274660-46274682 AACTCCTTCAGATGTAAAGGAGG + Intergenic
1088678894 11:112222287-112222309 CCCTCCTTCCTATCTAAGGGAGG - Intronic
1088876648 11:113941845-113941867 GACTCCTTCAGGCCTAAGGGTGG + Intronic
1089603293 11:119627787-119627809 CACTCCTCCATACCTAAGCGGGG + Intronic
1091629475 12:2148816-2148838 AACTCCTCCAGACCGCAGGGAGG - Intronic
1093089343 12:14904235-14904257 CACTCCCACAGACCTAGGTGAGG + Intronic
1093426599 12:19035046-19035068 CCCACCTCCTGACCTAAGGGAGG - Intergenic
1093806072 12:23434619-23434641 TACTCTCTCAGACCTAAGGGTGG + Intergenic
1096189032 12:49602977-49602999 CTGTCCTTCAGCGCTAAGGGAGG - Intronic
1096494206 12:52029949-52029971 CCCTCCTACAGCCCTCAGGGCGG + Intronic
1099002963 12:77202479-77202501 TACTTCTTCAGAGCTAAGGTTGG - Intergenic
1099359931 12:81687480-81687502 GAGTCCCTCAGACCGAAGGGAGG + Intronic
1100898825 12:99215410-99215432 CCCTCCTCCAGACCTCAGAGAGG + Intronic
1102060413 12:109926831-109926853 CAGTCCTGCAGACCTGAGTGGGG + Intronic
1102617409 12:114166541-114166563 GACTCCTTCTGACCTAGAGGGGG + Intergenic
1104557444 12:129814012-129814034 CATTCCATCAGACCTCAGTGAGG - Intronic
1105424470 13:20282834-20282856 CAGTCCTGCAGACCTGAGTGGGG + Intergenic
1106201540 13:27541723-27541745 CACTAAGTCAGACCTCAGGGTGG + Intergenic
1107599294 13:41996268-41996290 CAGTCTTTCTGACTTAAGGGTGG + Intergenic
1111846870 13:93521571-93521593 CCCTCCTTCAGAAATAAGGCAGG - Intronic
1111915153 13:94352613-94352635 CAGTCCTTCAGGCCTTAGGGTGG + Intronic
1113519979 13:110933689-110933711 CACCCCTTCAAACCTAAAGAAGG - Intergenic
1117756577 14:58980488-58980510 CACACCTTCAGCCACAAGGGAGG + Intergenic
1118447809 14:65867651-65867673 TGCTCCTTCAGACCCAGGGGTGG + Intergenic
1119141865 14:72274484-72274506 CCCTCCTTCAGGCCCAAGGCTGG + Intronic
1126240813 15:46441123-46441145 TTCTCCTTCACATCTAAGGGTGG + Intergenic
1128344989 15:66847958-66847980 CACTTCTTCAGAGCTGAGAGAGG - Intergenic
1129334194 15:74842828-74842850 CGCTCTTTAAGACCTAAGCGTGG + Intronic
1129494556 15:75965758-75965780 GACTCCTTCAAAAGTAAGGGTGG + Intronic
1135978859 16:27130840-27130862 GACTCCTTCAGTGCTAAGTGTGG - Intergenic
1139375690 16:66495098-66495120 CAGTCCTTAAGACCAAGGGGGGG + Intronic
1141916277 16:87099372-87099394 CCCTCCCTCAGACCCAAAGGAGG + Intronic
1142054330 16:87983249-87983271 CACTCCTTCAGGTCTAGGGAGGG - Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1147862678 17:43532886-43532908 CACTCCTTCACATCTCAGGGAGG - Exonic
1149488335 17:57063143-57063165 CACTGCTTTAGATCTCAGGGAGG - Intergenic
1150831361 17:68522794-68522816 CACTCGTACAGACTCAAGGGAGG + Exonic
1152184029 17:78843001-78843023 CACCCCCGCAGACCTGAGGGTGG - Intergenic
1152945110 17:83193849-83193871 CACCCCATCAGCCCTCAGGGTGG + Intergenic
1153262517 18:3238357-3238379 CACTCCCTCCGACCTGGGGGAGG + Intergenic
1157211801 18:45749200-45749222 CACTCCATCACACCCCAGGGAGG + Intronic
1160210099 18:76870747-76870769 CACTCCTTCAGCCTGAAAGGTGG - Intronic
1165984701 19:39757863-39757885 CAGTCCTTCATCCCTGAGGGCGG + Intergenic
1166349848 19:42191425-42191447 CACTCCTTCAGACCTAAGGGTGG + Intronic
925183642 2:1832594-1832616 CGTTCCTGCAGACCTAAGCGAGG - Intronic
927093330 2:19728859-19728881 CACTCCATCAAACCTAAGGCAGG + Intergenic
927311681 2:21638713-21638735 CAATCCTTCAAGTCTAAGGGTGG + Intergenic
927396236 2:22654723-22654745 CACTCCTTCAGACCCCAGAATGG + Intergenic
934674709 2:96241350-96241372 CACTCCTGCAGGACTAAAGGAGG + Intergenic
938911853 2:135892885-135892907 TGCTCCTTCAGACCTAAAGGTGG - Intergenic
938969875 2:136422295-136422317 CACTCCTTCACAACTCAGGTGGG - Intergenic
940071203 2:149690069-149690091 CACTACTTCAGTACTAAGTGGGG - Intergenic
940136721 2:150445423-150445445 CACTTCTTCTGACCTGAGAGTGG + Intergenic
945176294 2:207046997-207047019 CGATTCTTCAGTCCTAAGGGTGG + Intergenic
945655000 2:212612315-212612337 CACCCCTTCAGCCCTAGTGGTGG + Intergenic
947843690 2:233226727-233226749 CCCCCCTTCAGATCTAAGGAAGG - Intronic
948231099 2:236350244-236350266 AGCTCCTTCAGAACTAATGGGGG + Intronic
1173437113 20:43043236-43043258 CCCTCCCTCAGCCCTCAGGGAGG + Intronic
1176213094 20:63934943-63934965 CACTGAGTCAGAGCTAAGGGAGG - Exonic
1176964261 21:15194116-15194138 CACTTCTTCAGTTCTAAGGTTGG + Intergenic
1178789982 21:35690899-35690921 CACCCCTTCAGAACTAAGGGAGG + Intronic
1179290771 21:40016012-40016034 GAGTCCTTCAGACCTCAAGGTGG - Intronic
1183452435 22:37904491-37904513 CTCTCATTAAAACCTAAGGGGGG - Intergenic
953030340 3:39175820-39175842 CACTCCTTCAGAACTATGGATGG + Intergenic
956034855 3:65079716-65079738 TCCTCCTTCAGACCTAAGAGTGG + Intergenic
962383461 3:134914786-134914808 ATGTCCTTCAAACCTAAGGGTGG - Intronic
962824679 3:139089211-139089233 CACTCCTTCAGAGTTAAGGCAGG - Intronic
966491482 3:180532091-180532113 CAGACCTGCAGACCTAAGTGGGG + Intergenic
966723310 3:183086002-183086024 CTCTCCTTCAGCCCAAAGGGTGG + Intronic
970899983 4:21147284-21147306 CACTCCTTCAGTTCTCGGGGAGG + Intronic
971787941 4:31129445-31129467 CACTTCCACAGACCTAAGGTAGG - Intronic
975027673 4:69572368-69572390 CACTCTTTGAGATCTAAGGCTGG - Intergenic
976674556 4:87690201-87690223 GGCACCTTCAGACCTAAGAGTGG - Intergenic
978138261 4:105289509-105289531 CACTCCTACAGGCCTGAGGTTGG - Intergenic
982947726 4:161647771-161647793 CACTCCTACAGACCTAGGTGAGG + Intronic
983665520 4:170177267-170177289 CCCTCCTTCAGACCTCAGACTGG + Intergenic
983781070 4:171670506-171670528 TACCAATTCAGACCTAAGGGTGG + Intergenic
986093888 5:4537223-4537245 CACACTTCCAGACTTAAGGGTGG - Intergenic
986245594 5:6003904-6003926 CTGTCCTTCAGACCTAGGGATGG + Intergenic
987460065 5:18198347-18198369 CCCTCCTCCAGACCTAAGAATGG + Intergenic
989474438 5:41857674-41857696 CACTCCTTCAGACCTGGGGCTGG + Intronic
990358565 5:54995537-54995559 CACTCCTTGAGACCTTGGGCAGG - Intronic
992403545 5:76433519-76433541 CACCCCTTCAGACGTAGGGGAGG + Intronic
992433862 5:76736362-76736384 CACTCCCTCAGGCAGAAGGGAGG + Intergenic
994196933 5:96932200-96932222 GACTCCTTCGGTCCTTAGGGTGG + Intronic
995959087 5:117817511-117817533 CACACATTAAGGCCTAAGGGTGG - Intergenic
998396478 5:141821836-141821858 CAGTGGTTCAGGCCTAAGGGTGG - Intergenic
1000475564 5:161702628-161702650 CACTTCTTCACACCTAAAGAAGG - Intergenic
1000523831 5:162330812-162330834 CATTCCTTCAGAAATAAGAGAGG + Intergenic
1002850816 6:995184-995206 CAGTCCTTCAGATCTCAGGGAGG + Intergenic
1006365131 6:33610827-33610849 CACTCCTGCAGACCTCAGTCAGG + Intergenic
1006441164 6:34054533-34054555 CTCTCCAGCAGTCCTAAGGGAGG - Intronic
1008491414 6:52090601-52090623 TATTTCTTCAGGCCTAAGGGTGG + Intergenic
1008914084 6:56767891-56767913 CACTGCTACAGACCTAAGACAGG + Intronic
1011791914 6:90907703-90907725 CACTCCTTCAGCCCTCAAGCTGG + Intergenic
1012604778 6:101144615-101144637 CACCACTTCAGACATAGGGGTGG - Intergenic
1013132177 6:107243751-107243773 CACTCCTACAGACCTAGGTGAGG + Intronic
1014925796 6:127267830-127267852 CACTCCTTCAGACGGGATGGAGG - Intronic
1014943190 6:127467278-127467300 CACTCCTGAATACCTCAGGGTGG + Intronic
1015757732 6:136625068-136625090 AACTCCTGCAGCCCAAAGGGTGG + Intronic
1017597556 6:156045401-156045423 CACTCCTTAAGAACTCAGGAAGG - Intergenic
1018908125 6:168086918-168086940 CACTCCATCAGGCCTCAAGGAGG - Intergenic
1022877575 7:34551316-34551338 TACTCCTTCAGGCTTAAGGGTGG - Intergenic
1022965128 7:35465441-35465463 TGCCCCTTCAGACCTAGGGGTGG - Intergenic
1023796658 7:43799116-43799138 CACTCCTTCAGACGTGAATGTGG - Intronic
1024865787 7:53904117-53904139 CTGTCCTTCAGACCCCAGGGTGG - Intergenic
1024981274 7:55159380-55159402 AAGTCATTCAGACCGAAGGGGGG - Intronic
1026225031 7:68432686-68432708 CACTCCATCAGAGCAAAGGCTGG - Intergenic
1026588355 7:71676108-71676130 CACTCATTGAGACCCTAGGGTGG + Intronic
1028732567 7:94168746-94168768 CATTCCTTCAGGCCTAGGGATGG + Intergenic
1030909827 7:115233420-115233442 CAATGCTTCAGTCCTCAGGGAGG - Intergenic
1034216909 7:149414871-149414893 CATTTCTTCTGACCTAAGTGTGG - Intergenic
1035457311 7:159016956-159016978 CACTGCTGCAGACCTCAGAGTGG + Intergenic
1035457322 7:159017022-159017044 CACTGCTGCAGACCTCAGAGTGG + Intergenic
1038093574 8:24282460-24282482 CACTCCTTCAACCCAAAGGCAGG - Intergenic
1039249799 8:35650340-35650362 AACTGCTTCAGGGCTAAGGGAGG - Intronic
1039269790 8:35868303-35868325 CATTCATTCAGGCCTAAAGGTGG + Intergenic
1046739230 8:117811015-117811037 AACTCCTTCAGGCCAAAGGGAGG + Intronic
1047202147 8:122776203-122776225 CACCCCTACAGACCTAGGTGAGG - Intergenic
1047428450 8:124767876-124767898 GATGTCTTCAGACCTAAGGGTGG - Intergenic
1048198923 8:132355347-132355369 GACTCCTTCAGTCATCAGGGTGG - Intronic
1055162325 9:73145455-73145477 CACTCGTGTAGACTTAAGGGAGG - Intergenic
1057584736 9:96319166-96319188 CACACATTCAGACGTAAGGAAGG + Intergenic
1057692236 9:97295472-97295494 GACTCCTGCAGACATGAGGGAGG - Intergenic
1060080004 9:120635052-120635074 CTATCCTTCAGAAATAAGGGAGG - Intronic
1185759138 X:2675959-2675981 CACTCCTTCAGCCCTCAAGTTGG + Intergenic
1187526367 X:20058656-20058678 CATTCCTTCAGACCTTGAGGAGG + Intronic
1187571836 X:20511834-20511856 GACTCCTTCACATCTAGGGGTGG + Intergenic
1189563572 X:42215985-42216007 AAATCCTCCAGTCCTAAGGGTGG - Intergenic
1190559411 X:51672174-51672196 CACTCCTTCAAACCTCAGCCAGG - Intergenic
1190564880 X:51721147-51721169 CACTCCTTCAAACCTCAGCCAGG + Intergenic
1192201370 X:69068675-69068697 CACCCCCTCAGCCCTCAGGGAGG - Intergenic
1193898182 X:87140782-87140804 CACCCCTTCAGACCTAGGTGAGG + Intergenic
1193920933 X:87425307-87425329 CATTCCTTCAGCCCTAAACGGGG - Intergenic
1194320638 X:92441806-92441828 CAGTCCTTCAGACCTTAGAATGG + Intronic
1196055405 X:111349951-111349973 CTCTCCTTGAGGCCTAAGAGTGG - Intronic
1196687046 X:118519951-118519973 AACTCCTTCAGACCTGAAGAAGG + Intronic
1200232205 X:154449671-154449693 CACCCCTGCGGACCTGAGGGAGG - Exonic
1200628752 Y:5554942-5554964 CAGTCCTTCAGACCTTAGAATGG + Intronic