ID: 1166352996

View in Genome Browser
Species Human (GRCh38)
Location 19:42209437-42209459
Sequence CTGAATACACAAATGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 343}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166352991_1166352996 24 Left 1166352991 19:42209390-42209412 CCACTGCACAAGAAATGTCTGAA 0: 1
1: 0
2: 2
3: 12
4: 249
Right 1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG 0: 1
1: 0
2: 2
3: 29
4: 343
1166352995_1166352996 -9 Left 1166352995 19:42209423-42209445 CCGGCAGATGTTTGCTGAATACA 0: 1
1: 1
2: 2
3: 29
4: 259
Right 1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG 0: 1
1: 0
2: 2
3: 29
4: 343
1166352994_1166352996 -8 Left 1166352994 19:42209422-42209444 CCCGGCAGATGTTTGCTGAATAC 0: 1
1: 0
2: 0
3: 29
4: 358
Right 1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG 0: 1
1: 0
2: 2
3: 29
4: 343
1166352993_1166352996 -7 Left 1166352993 19:42209421-42209443 CCCCGGCAGATGTTTGCTGAATA 0: 1
1: 0
2: 3
3: 18
4: 190
Right 1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG 0: 1
1: 0
2: 2
3: 29
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166352996 Original CRISPR CTGAATACACAAATGAAACT AGG Intronic
900740230 1:4326696-4326718 CTGAACACACACCTGACACTGGG - Intergenic
901053081 1:6435420-6435442 CTGATTACACAAAAGAAACATGG - Intronic
901063063 1:6482338-6482360 CTTAATTCATAAATGAAACAAGG - Intronic
902211519 1:14908030-14908052 AAGAATACACAAAGGAAAGTAGG - Intronic
902481160 1:16712629-16712651 CTGATTACACAAAAGAAACATGG + Intergenic
902673239 1:17990381-17990403 CAGATTAGACAACTGAAACTCGG - Intergenic
902736214 1:18402965-18402987 CTGGCTTCACAAATGAAAATGGG + Intergenic
904966900 1:34381155-34381177 CTGAAGAGACAAAATAAACTGGG - Intergenic
905351340 1:37348634-37348656 CGGGATACACAGATGAACCTGGG - Intergenic
905438077 1:37973016-37973038 CTAAATACACAAAATTAACTGGG + Intronic
905907779 1:41631004-41631026 ATGAATACACAAATGAGTATTGG + Intronic
907568712 1:55462450-55462472 CTAAAAACACAAGTGATACTGGG - Intergenic
907688508 1:56638024-56638046 ATGAATACAGAGATGAAAGTGGG - Intronic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908993329 1:70121755-70121777 GTAAATACACAAATAAAACAGGG - Intronic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
910744561 1:90559239-90559261 GTGAATACATATAAGAAACTGGG - Intergenic
910781523 1:90940816-90940838 CTGATAACAAAAATAAAACTTGG + Exonic
911531693 1:99051307-99051329 ATGAATACCCAAAGGAAAATAGG - Intergenic
914427400 1:147590208-147590230 ATGAATTCAAAAATGACACTAGG - Intronic
915146532 1:153799002-153799024 TTGAATAAACTAATGAAACGGGG + Intergenic
916963756 1:169914313-169914335 CTGAATATACAATTGTAAGTTGG + Intergenic
918585346 1:186181053-186181075 CTGAATGCAGAAATCACACTTGG + Intronic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
919565831 1:199186055-199186077 ATGAATATACTAATAAAACTCGG - Intergenic
919682385 1:200448605-200448627 CTGGATACACAAGAGGAACTGGG - Intergenic
922771453 1:228186020-228186042 CAGAATGCACAAATGACAATGGG + Intergenic
923307952 1:232705540-232705562 CTGCATACACAAATATAAATTGG + Intergenic
1064634664 10:17351665-17351687 CTGAATGCATAAATGAAATGTGG + Intronic
1064691902 10:17927181-17927203 CTGAGTACAGAAAAGAAGCTAGG + Intergenic
1064717687 10:18193755-18193777 CTGAATAAATGAATGAATCTAGG - Intronic
1064722306 10:18241651-18241673 ATGAATACAAAAATGAGACAAGG + Intronic
1064923445 10:20543529-20543551 CTGAAGTCACAGCTGAAACTGGG + Intergenic
1065364857 10:24925508-24925530 ATAAATACATAACTGAAACTGGG - Intronic
1066643564 10:37581271-37581293 CTAAAGTCACAAATAAAACTAGG + Intergenic
1067422592 10:46168025-46168047 CTGAAATCAGAAATAAAACTGGG - Intergenic
1068063007 10:52093013-52093035 GTGACTAGATAAATGAAACTTGG + Intronic
1068470447 10:57455458-57455480 CTGAATAACCAAATAAATCTTGG + Intergenic
1069060751 10:63892087-63892109 GTGAATACAGAACTGAAACAAGG - Intergenic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1070662078 10:78314151-78314173 CTGGTTACAGAAATCAAACTGGG + Intergenic
1071144396 10:82550584-82550606 CTAAAAACACAAAGGAATCTTGG - Intronic
1071222011 10:83478394-83478416 CTAAATACACAAATTTAGCTGGG + Intergenic
1075267579 10:121016460-121016482 TTGAATCCACAGATAAAACTGGG - Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1077629735 11:3803152-3803174 CTAAATACACAAAATTAACTGGG - Intronic
1078024643 11:7683215-7683237 ATGAATAGGCAAATCAAACTTGG + Intergenic
1078132936 11:8628237-8628259 CTGAGTTCAGAAATGAGACTAGG - Intronic
1079167842 11:18063519-18063541 ATGAATACAAAAATGAAGCTGGG + Intergenic
1080277015 11:30514091-30514113 ATGAATACATGAATAAAACTGGG - Intronic
1082064455 11:47888125-47888147 ATCAATGCACAACTGAAACTTGG + Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082990095 11:59200020-59200042 ATAAAGACATAAATGAAACTGGG + Intronic
1086257507 11:84895306-84895328 TTGAATACAAATATGATACTAGG + Intronic
1087511169 11:99095715-99095737 GTGAATTAACAAATGAAATTGGG + Intronic
1088008617 11:104972363-104972385 CTCAATACAGAAATGAAAAGCGG + Intergenic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1089133358 11:116229695-116229717 CTGAATTAAAAAATGTAACTAGG - Intergenic
1089884602 11:121807596-121807618 CAGAATACATAAAAGAAACCAGG + Intergenic
1090254159 11:125271520-125271542 CTGAATGAACAAATGAAAACAGG - Intronic
1091607343 12:1965863-1965885 CTGACTACACAAATGAATCTAGG + Intronic
1093805209 12:23423825-23423847 CTTAATACTCAAATAAAATTAGG - Intergenic
1094033577 12:26042029-26042051 CTGAATTTAAAAATGAAACGAGG + Intronic
1094312848 12:29104437-29104459 CTGAAAACACAAAAGAACCTTGG - Intergenic
1094741525 12:33295016-33295038 CAGAATACCTGAATGAAACTGGG - Intergenic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1100354165 12:93813555-93813577 CAGAAGAAACAAATGAAACTGGG - Intronic
1100574881 12:95881722-95881744 ATGAATATACAAAAGAAAATTGG + Intronic
1101040399 12:100749579-100749601 CTGAAAACACCAATGAATCAGGG + Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102817358 12:115878015-115878037 CTGAATGAATAAATGTAACTTGG - Intergenic
1107662188 13:42650194-42650216 AGGAGCACACAAATGAAACTGGG + Intergenic
1107765821 13:43733417-43733439 CTCTATGCACAAATGAATCTTGG + Intronic
1107772278 13:43801362-43801384 CTGAATGCACTAATGAATCCAGG - Intergenic
1108338226 13:49468620-49468642 CTGAAAGAACAAATGAAATTAGG - Intronic
1109118219 13:58418088-58418110 CATAAAACACAAATGTAACTAGG + Intergenic
1110212630 13:72991402-72991424 CTGATTATACAACTGAAACTTGG - Intronic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1110873718 13:80483613-80483635 GTGAATCCACGAATCAAACTTGG - Intergenic
1111297112 13:86294207-86294229 CCTAATACACAATTGAAACATGG - Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1111884469 13:94002288-94002310 GTCAATACCCCAATGAAACTTGG + Intronic
1112085205 13:96024186-96024208 CTGGATACACTAATTATACTTGG - Intronic
1113335747 13:109374234-109374256 CTGCATACAGAAAGGACACTGGG + Intergenic
1113495073 13:110720743-110720765 GTGAAGAAATAAATGAAACTTGG + Exonic
1113817227 13:113181365-113181387 TTGATCACAGAAATGAAACTGGG - Intronic
1114564241 14:23617140-23617162 CTGAAAAAAAAAATGAAATTAGG - Intergenic
1117902796 14:60552413-60552435 CTAAATACACAAATTAAGATAGG - Intergenic
1117902996 14:60554677-60554699 ATGAATAGACAAATAAAACATGG + Intergenic
1117976949 14:61308455-61308477 CTGAGTACTAAGATGAAACTTGG - Intronic
1118754277 14:68827432-68827454 CTGAAATCAGAAATGAAAGTGGG + Intergenic
1119122784 14:72095335-72095357 CAGAAAGCACAAAAGAAACTGGG - Intronic
1119824062 14:77642328-77642350 ATGAATAAGCGAATGAAACTTGG + Intergenic
1120104511 14:80479333-80479355 ATGAAGACACACCTGAAACTGGG + Intronic
1120974720 14:90238414-90238436 ATGCATACGCAAATGAGACTTGG - Intergenic
1122334701 14:100963875-100963897 GTGAATAAATAAATGAAAGTTGG + Intergenic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1123693197 15:22856720-22856742 GTTAATAAACAAATGAAAATGGG + Intronic
1123712925 15:23003416-23003438 TTAAATTCACCAATGAAACTAGG + Intronic
1123922877 15:25082893-25082915 CTGCAGCAACAAATGAAACTTGG - Intergenic
1124782827 15:32652025-32652047 AAGAATCCACAAAGGAAACTGGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1129565221 15:76614900-76614922 CTAAATTCAGAAATGAAAGTGGG + Intronic
1131547543 15:93328560-93328582 CTGAATACACCATTTAGACTGGG - Intergenic
1131999868 15:98167660-98167682 CAGAAGTCACAAATGAAATTAGG + Intergenic
1135173842 16:20210548-20210570 CCGACAACACAAATGGAACTTGG - Intergenic
1135280312 16:21148667-21148689 CTGTAGAAACAAATTAAACTAGG + Intronic
1135582829 16:23642473-23642495 ATAAAAACACAAAGGAAACTAGG - Intronic
1135763950 16:25160798-25160820 CTGAATAGAGAAAAGAAAATGGG - Intronic
1135874783 16:26188282-26188304 TTGACTACACAAATGAGAATTGG + Intergenic
1138058447 16:53861604-53861626 CTAAATACAAAATTGAAAATTGG - Intronic
1139712005 16:68782995-68783017 CTGAAAACACAACTGAAATCTGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1142424910 16:89996962-89996984 CTGCATGCAGAATTGAAACTGGG - Intergenic
1142443252 16:90115811-90115833 CTAAAAACCCAAATAAAACTGGG - Intergenic
1142650683 17:1349399-1349421 CTGAATACACAAATAATTGTGGG - Intronic
1143031644 17:3971292-3971314 CTCAACACACAAATGAGTCTGGG + Intergenic
1143060995 17:4200958-4200980 CTGTATATTCAAATGAAAATGGG - Intronic
1146154983 17:30515775-30515797 CAGAATAAAGAAATGTAACTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147481377 17:40767177-40767199 TTGAAAACATAAATGAAACATGG + Intronic
1148825118 17:50387340-50387362 TTGCACACACAAGTGAAACTGGG - Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1149416511 17:56465459-56465481 ATGAATACAGAAATAGAACTGGG - Intronic
1149499689 17:57142831-57142853 TTGAATAAATAAATGAAGCTGGG - Intergenic
1149991162 17:61384336-61384358 CTGGACACACACGTGAAACTGGG - Intronic
1150054256 17:61997767-61997789 CTGTAGAGACAAATAAAACTCGG + Intronic
1150415134 17:64981441-64981463 CTAAATATACAAATGACCCTTGG + Intergenic
1151520293 17:74623718-74623740 GTGAGAACACAAAGGAAACTTGG - Exonic
1153468036 18:5411665-5411687 TTGAAAACAAAAATGAAAATGGG + Intronic
1155117196 18:22781057-22781079 CTTAATATACAAAATAAACTGGG + Intergenic
1155362053 18:25013092-25013114 CTTAATACATAAAGAAAACTAGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156707989 18:39907145-39907167 CAGATTACCCAAATGAATCTGGG - Intergenic
1156801680 18:41122389-41122411 ATAAATACACACCTGAAACTGGG - Intergenic
1157088976 18:44612876-44612898 TTTAAGACACAAATGAAAGTGGG + Intergenic
1157289853 18:46401593-46401615 AGGAACACACAAATGAAACTGGG + Intronic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158026937 18:52910399-52910421 ATTAATCAACAAATGAAACTAGG - Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158955050 18:62529657-62529679 CTGCATAGAAAAATGTAACTGGG - Intronic
1159118979 18:64147837-64147859 CTGAATTCACACAGGAGACTTGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159964916 18:74585831-74585853 CTGAATATACAAAATTAACTGGG + Intronic
1161889975 19:7028009-7028031 ATGAAAACACACTTGAAACTGGG - Intergenic
1161891477 19:7042737-7042759 ATGAAAACACACTTGAAACTGGG + Intergenic
1161893562 19:7061194-7061216 ATGAAAACACACTTGAAACTGGG + Intergenic
1164410789 19:28003172-28003194 CTGCCTACAGAAATGAAGCTTGG + Intergenic
1165086308 19:33350372-33350394 CTAAATACATAAATAAAAATAGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1166636657 19:44457145-44457167 GTGAAGACACAAAAGAGACTGGG + Intergenic
1167352289 19:48982859-48982881 CTGAATGAACAAATAAAACATGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1202715195 1_KI270714v1_random:38533-38555 CTGATTACACAAAAGAAACATGG + Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
928589050 2:32794730-32794752 CTGAAATCAGAAATGAAAATGGG + Intronic
928589167 2:32796439-32796461 CTGAAATCAGAAATGAAAATGGG + Intronic
928800849 2:35089594-35089616 CTGAATAGCCAAATCAATCTTGG + Intergenic
928835070 2:35533823-35533845 GTGAATACATAAATGAAATGTGG + Intergenic
929177498 2:38995838-38995860 ATACATACACAAATGAAAATTGG - Intronic
929874186 2:45782883-45782905 CTGAATCCAGAAAGCAAACTGGG + Intronic
930084474 2:47484809-47484831 ATGAATGCATAAATGAAACGTGG + Intronic
930156792 2:48114123-48114145 CTGAAAACAGAAATGAAACTAGG - Intergenic
930202699 2:48560314-48560336 CTGAATTCTCAAAGGAAGCTGGG - Intronic
930905460 2:56561263-56561285 ATGGATACACATAAGAAACTCGG - Intergenic
930952596 2:57161418-57161440 GTGAATACATAAATAAAAGTAGG - Intergenic
931005394 2:57845264-57845286 CCAAATACCCAAATGAAATTTGG + Intergenic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
933532669 2:83530386-83530408 CTGATTACACAATTAAAAGTTGG + Intergenic
933676702 2:85063606-85063628 CTGACTACCCAAATGAAAACAGG + Intergenic
935511947 2:103986734-103986756 ATGAATGAACAAATGAAACTAGG - Intergenic
935794054 2:106623619-106623641 CTGAAAGCACAAATGAAAACAGG - Intergenic
936980405 2:118259430-118259452 CTGTATATAGAAATGTAACTTGG + Intergenic
937200110 2:120196949-120196971 CTGAAATCAGAAATGAAAGTGGG + Intergenic
937763074 2:125628600-125628622 ATGAAGACACAACTGAGACTGGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
940151467 2:150607197-150607219 CTGATAACATAAATAAAACTAGG - Intergenic
940648829 2:156419966-156419988 TAGAATACACAAATGTCACTTGG + Intergenic
940709980 2:157150536-157150558 CTGACTACAAAAATAAAAATGGG - Intergenic
941318852 2:164029905-164029927 CAGAATACTTAAATGGAACTGGG - Intergenic
942399223 2:175583620-175583642 CTGATTTCTCAAATGAAAATGGG - Intergenic
943228956 2:185220276-185220298 CTGAAAAAACAAATAAAATTAGG + Intergenic
943334789 2:186600323-186600345 CTCAATACACAAATGCTCCTAGG + Intronic
943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG + Intergenic
944608874 2:201379923-201379945 CTGAAAACAGAAAGGAAAATAGG + Exonic
944951369 2:204753572-204753594 CTGATTACACAGCTGGAACTAGG - Intronic
945574205 2:211509354-211509376 ATAAATAAACAAATAAAACTGGG + Intronic
948653131 2:239461609-239461631 CTGAAACCACAAATGTAACCAGG - Intergenic
1171135872 20:22694015-22694037 CTGAATAAAAATATGAAACCTGG - Intergenic
1173108346 20:40160076-40160098 CTGAATACAAAATTGAAGCTAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1177075316 21:16564223-16564245 CTGAAAACACAAAATTAACTGGG + Intergenic
1177931234 21:27286434-27286456 CTGAATAAATAAATGCATCTGGG + Intergenic
1178249197 21:30985832-30985854 CTGAAAAGAAAAATGAAATTCGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1182141477 22:27963222-27963244 CTGAATTTACAAATAAAAATAGG + Intergenic
1182500801 22:30745830-30745852 CTGAAATCAGAAATGAAAGTGGG + Intronic
1183942786 22:41305538-41305560 CTGAATTAGCAAATGAAACTGGG + Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
1185412488 22:50691932-50691954 CTAAAATCACAAATGAAATTTGG - Intergenic
950813231 3:15670834-15670856 CTGAATTCACAGAAAAAACTGGG + Intronic
951531161 3:23699314-23699336 GTGAAAACACAAATGTACCTGGG - Intergenic
951626438 3:24669361-24669383 CAGAATTCACAAGTGAACCTGGG + Intergenic
952621368 3:35347171-35347193 AGGAATACACAAAAGAAACAAGG - Intergenic
953268278 3:41414334-41414356 GTGAATACACACATACAACTTGG + Intronic
954457240 3:50606449-50606471 CTGTGTACACAACTGAAAATCGG + Intergenic
954889755 3:53914283-53914305 CTGAATACACAATTTAAATATGG - Intergenic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956090166 3:65657845-65657867 CTGAATAGCCAGATGATACTGGG + Intronic
956589875 3:70903424-70903446 CTGAATATCCAAATGAAAGTAGG - Intergenic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
957253575 3:77807736-77807758 ATGAATACACAATTGCTACTAGG - Intergenic
958984437 3:100763915-100763937 ATGAAAACACAAATGAAAAGTGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959832283 3:110878760-110878782 TTGAACACACAAATGGAACTTGG + Intergenic
960821717 3:121740219-121740241 ATGAATATACAAGTAAAACTGGG + Intronic
961234711 3:125356275-125356297 CAGAATAGACTAAGGAAACTGGG - Intronic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
962555488 3:136546673-136546695 CTGAATTTAGAAATGAAACCTGG - Intronic
963287819 3:143453170-143453192 TTGAATACACAAATTAACATAGG + Intronic
963453306 3:145513089-145513111 CTGAAGAGTCACATGAAACTAGG + Intergenic
964166637 3:153714911-153714933 ATGAATAGACAAATTAAACTAGG - Intergenic
964719966 3:159761608-159761630 CTGGAAACAGAAAGGAAACTGGG + Intronic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
967694949 3:192519755-192519777 CTGAATACATAAATAAATGTAGG - Intronic
968363569 3:198167199-198167221 CTAAAAACCCAAATAAAACTGGG - Intergenic
968397001 4:248437-248459 CATAATAAAAAAATGAAACTAGG - Intergenic
968539378 4:1155932-1155954 CAGAATCCACACATGACACTTGG + Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
971718596 4:30214904-30214926 CTGAAAACAGAAATGAATCATGG + Intergenic
973066513 4:45800859-45800881 ATGAAAATACAAATGAAAGTTGG - Intergenic
974139049 4:57860390-57860412 CTAGATACACAAATAAGACTAGG - Intergenic
974207341 4:58723096-58723118 CTCAATACACAAAAGAAACAAGG + Intergenic
975932813 4:79546168-79546190 CTGAATACAGCTATGAAACTTGG - Intergenic
976503322 4:85816438-85816460 GTGAAAACATGAATGAAACTTGG - Intronic
977733695 4:100384643-100384665 CAGAATACATAAATGAAATGGGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978021495 4:103818908-103818930 CTTAATACATAAAAGACACTTGG + Intergenic
979355073 4:119693785-119693807 CTGAATAAAAAACTAAAACTTGG - Intergenic
979410643 4:120374463-120374485 TCCAATACACAACTGAAACTAGG + Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
980544433 4:134239769-134239791 ATTAAGACACAAGTGAAACTTGG + Intergenic
980640320 4:135568945-135568967 CTAATTGCATAAATGAAACTGGG + Intergenic
980814859 4:137931808-137931830 CTGCAGACACATAAGAAACTGGG - Intergenic
982220947 4:153124804-153124826 CTCTCTACACTAATGAAACTGGG + Intergenic
982360322 4:154512371-154512393 TTGAATACTCAAAACAAACTTGG - Intergenic
983159880 4:164399348-164399370 ATAAATAAATAAATGAAACTGGG - Intergenic
984669460 4:182465942-182465964 CTTAATAGAGAAATGAGACTTGG - Intronic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
989684742 5:44072286-44072308 CTGAATACAAAAAGGAAATTTGG - Intergenic
990107568 5:52283457-52283479 TTGGCTACATAAATGAAACTAGG + Intergenic
991318156 5:65335864-65335886 GTGAATACACATAGAAAACTAGG + Intronic
991683787 5:69163656-69163678 CTCAAAACAAAAATAAAACTGGG + Intergenic
992362366 5:76053217-76053239 CTGAAAAGACAAATGACACTTGG - Intergenic
992937482 5:81724212-81724234 CTGAATACACAAATTAATTTGGG + Intronic
993229566 5:85215488-85215510 CTAAATACAGAAGTGATACTTGG + Intergenic
994706850 5:103217580-103217602 CTGAAAACAGAAACAAAACTAGG - Intergenic
994868545 5:105313424-105313446 CTGAATACATAAATAAATTTTGG + Intergenic
995809596 5:116089923-116089945 CGGGATACATAAATGAAAGTAGG - Intronic
995852065 5:116556690-116556712 CTGAACACCAAAATGACACTTGG - Intronic
996577899 5:124996783-124996805 CTGATTACACAATTGTGACTTGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996702377 5:126463458-126463480 TTGAGTCCACAAATTAAACTTGG + Intronic
997163346 5:131632725-131632747 CTGAAAACAGAAATGAACTTGGG + Intronic
998838745 5:146230813-146230835 CTGAAAACACAACTGAGAGTTGG + Exonic
1000210393 5:159102241-159102263 TTAAATGCACAATTGAAACTTGG + Intergenic
1000498729 5:162021015-162021037 CTGATCACACAAGTGATACTGGG - Intergenic
1001250217 5:170141357-170141379 CTGATGACACAAATGTCACTCGG - Intergenic
1001545519 5:172568433-172568455 CTCAAGACACAAAGGCAACTCGG - Intergenic
1002340678 5:178514929-178514951 CAGAAAACACAAACGAGACTTGG - Intronic
1003834322 6:10052481-10052503 CTAAAATCAAAAATGAAACTGGG + Intronic
1004452748 6:15762180-15762202 CTGAAAATTCAAATGTAACTGGG - Intergenic
1004813007 6:19280293-19280315 ATGAATACAAGAATGATACTGGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005330299 6:24743387-24743409 CTGAAGAAAGAAATGAAAGTTGG + Intergenic
1008032445 6:46712389-46712411 CTGAGTCCACTAATAAAACTGGG + Intronic
1008794150 6:55279900-55279922 ATCAATACATAAATGAAAGTAGG + Intronic
1009463579 6:63943821-63943843 CTGCACAAACAAAGGAAACTAGG - Intronic
1009715794 6:67393832-67393854 CTGAAAAGACAACTGAAAATGGG + Intergenic
1011114034 6:83870474-83870496 CTGAAAACAGAAATGAACCAAGG - Intronic
1011581941 6:88878063-88878085 ATAAATAAACAAATGAAATTAGG - Intronic
1013616096 6:111844931-111844953 CTGATAAGAAAAATGAAACTTGG + Intronic
1013730951 6:113166234-113166256 TTGAATACACAAATAAATATAGG - Intergenic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1014471376 6:121819136-121819158 CTGAAGACACACCTGAGACTGGG - Intergenic
1014505956 6:122256488-122256510 CTGAATACAGAGAAGCAACTAGG + Intergenic
1014537232 6:122628887-122628909 CTGTATACACAAACAACACTAGG - Intronic
1015468974 6:133580927-133580949 CTAAAATCACAAATGAAAATAGG + Intergenic
1016774411 6:147889386-147889408 CTGAACACACAAAAGACAGTTGG + Intergenic
1016955713 6:149624916-149624938 ATGAAGACAGAAAAGAAACTGGG + Intronic
1017829317 6:158111330-158111352 CTGAATTCACATATGAAAACTGG + Exonic
1019252131 7:21484-21506 CTAAAAACCCAAATAAAACTGGG + Intergenic
1019873663 7:3790272-3790294 CTGAAAACAGAAATTATACTAGG + Intronic
1020349641 7:7204415-7204437 CTGAAATCAGAAATGAAAGTAGG - Intronic
1020369770 7:7419158-7419180 CTGAATGAACAATTAAAACTAGG + Intronic
1021311059 7:19097001-19097023 CATAATACACAAATGATACTTGG - Intronic
1021783691 7:24132326-24132348 CTGAATTCTGACATGAAACTTGG - Intergenic
1023697337 7:42861293-42861315 CTAAAAACACACAAGAAACTAGG - Intergenic
1024683862 7:51723432-51723454 CTGAAATCAGAAATGAAAGTGGG - Intergenic
1027421867 7:78024678-78024700 CTGAAGACACAATTGAAAGAGGG + Intronic
1027534996 7:79388095-79388117 CTGAATTTGAAAATGAAACTAGG - Intronic
1027824643 7:83094970-83094992 CTAACTTCACAAATGAAATTGGG + Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028979017 7:96946123-96946145 ATGAAAAAAAAAATGAAACTTGG + Intergenic
1030281708 7:107782709-107782731 CTGAAAGCACAAACTAAACTAGG - Intronic
1030322623 7:108185389-108185411 CTGACTAAACAAATTACACTAGG + Intronic
1031204665 7:118741572-118741594 ATGAACACAAAAATGATACTAGG - Intergenic
1034057520 7:148051234-148051256 CTTAATACAAAAATGATATTTGG - Intronic
1034380318 7:150686616-150686638 ATGAGTAGACAAATGAAACATGG + Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036688650 8:10927699-10927721 CAGAATACACCAATTCAACTGGG + Intronic
1037099854 8:15031969-15031991 GTGTATGCAAAAATGAAACTGGG - Intronic
1037167096 8:15844099-15844121 CAGAAAACAAAAATGAAACAAGG - Intergenic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1040045167 8:42955529-42955551 TTGATTAAACAAATGAACCTAGG + Intronic
1041349209 8:56931681-56931703 CTGAAAACAGAAAGCAAACTGGG + Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1042626766 8:70766778-70766800 CTAAAAACACTCATGAAACTAGG - Intronic
1042700557 8:71608043-71608065 TTTAATACACTAATTAAACTTGG + Intergenic
1043040258 8:75253771-75253793 ATAAAGACACACATGAAACTGGG + Intergenic
1043326289 8:79055907-79055929 GTGAATGCAGACATGAAACTTGG - Intergenic
1043374020 8:79627181-79627203 CTGAATAAACAAGAGAAAATAGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044229937 8:89762217-89762239 ATGAATAAACAAATGAACCTGGG + Intronic
1044387418 8:91605898-91605920 AGGAATAAACAAATGAAAGTGGG - Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1046200213 8:110916683-110916705 CTGAATAAACAATAAAAACTTGG - Intergenic
1046891806 8:119430328-119430350 CTGAATACACTATTGAACATAGG - Intergenic
1050035369 9:1430013-1430035 CTGGGTACACAAATGTAACCTGG - Intergenic
1050741606 9:8826661-8826683 ATGAATACACAATTGCAAATTGG - Intronic
1051436150 9:17034626-17034648 CTGAGAAAACAAATGATACTAGG + Intergenic
1055235539 9:74118248-74118270 CTGAAAAGACAAATGGCACTAGG - Intergenic
1055684579 9:78757409-78757431 CTGAATACAGAAACTAAAATCGG - Intergenic
1056594891 9:87999334-87999356 CTGAATACACAGAATAACCTGGG - Intergenic
1057714108 9:97475670-97475692 AGAAAAACACAAATGAAACTGGG - Intronic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1058366024 9:104209395-104209417 CTGAATACACAAAGAGAAGTAGG - Intergenic
1060125732 9:121043112-121043134 CCAAATACACATAAGAAACTGGG + Exonic
1062149105 9:135008285-135008307 CTGAATAGACAAATCAAACCCGG + Intergenic
1062748210 9:138230431-138230453 CTAAAAACCCAAATAAAACTGGG - Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1185995867 X:4948611-4948633 TTGAATGCACAAATTAAAATTGG - Intergenic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1188307579 X:28577084-28577106 ATAAATACATAAATAAAACTAGG + Intergenic
1188649085 X:32608745-32608767 CTGAAAACACAAAAGAAATCTGG + Intronic
1188672780 X:32900248-32900270 ATAAATACAAAAATGAAAATTGG + Intronic
1191672856 X:63765119-63765141 CTTAATACACAAATGACTCATGG - Intronic
1191708992 X:64128076-64128098 CTGAAATCAGAAATGAAAGTTGG - Intergenic
1191961176 X:66703732-66703754 CTGAATACACAAAGCAATCTTGG + Intergenic
1193748727 X:85316698-85316720 ATGAATAGACAAATCAATCTTGG - Intronic
1194019340 X:88667750-88667772 CTGAATACACAATTGTCATTTGG - Intergenic
1194371006 X:93071370-93071392 CTTAATATTCAAAAGAAACTGGG - Intergenic
1194480688 X:94419299-94419321 CTGAAATCATAAATGAAAATGGG - Intergenic
1194799734 X:98257669-98257691 CAAAATACACAAATAAAGCTGGG + Intergenic
1194815318 X:98433660-98433682 GTGAATAAACAAATGATAGTTGG - Intergenic
1194891078 X:99380051-99380073 CTGAATACATAAATGAAGTTGGG - Intergenic
1194910359 X:99634471-99634493 CTAAAATCAGAAATGAAACTTGG + Intergenic
1195649427 X:107269292-107269314 ATGAATGGATAAATGAAACTTGG + Intergenic
1196697484 X:118628897-118628919 CTCAATTTACAAATGAAAATTGG + Intronic
1197003329 X:121466114-121466136 CTGAGGACAAAAATGAAACAGGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1199114636 X:143976862-143976884 CTTAATACATAACTGACACTTGG + Intergenic
1199417298 X:147599896-147599918 CGGAATACACAACTGAATCCTGG + Intergenic
1199747878 X:150785895-150785917 CAGAAAACACAAACAAAACTTGG - Intronic
1200678801 Y:6183259-6183281 CTTAATATTCAAAAGAAACTGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic