ID: 1166353291

View in Genome Browser
Species Human (GRCh38)
Location 19:42211371-42211393
Sequence CTAGACCCTCAAAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166353287_1166353291 -9 Left 1166353287 19:42211357-42211379 CCTGGGAAACAGAGCTAGACCCT 0: 7
1: 219
2: 7103
3: 45081
4: 143498
Right 1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 642
1166353285_1166353291 5 Left 1166353285 19:42211343-42211365 CCACTGGACTCCAGCCTGGGAAA 0: 13
1: 2135
2: 90955
3: 296112
4: 249333
Right 1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 642
1166353286_1166353291 -5 Left 1166353286 19:42211353-42211375 CCAGCCTGGGAAACAGAGCTAGA 0: 21
1: 1435
2: 46609
3: 188123
4: 234769
Right 1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166353291 Original CRISPR CTAGACCCTCAAAGGGAGAA GGG Intronic
900722578 1:4186983-4187005 CTAGACCCTAAAAGGGCAATAGG - Intergenic
900840753 1:5046832-5046854 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
900847437 1:5115103-5115125 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
900964774 1:5950341-5950363 CTTGAAGCTCAAAGGGAGGAGGG + Intronic
904431238 1:30465845-30465867 CTCCACCCTCAAGGGGAGAATGG - Intergenic
904711601 1:32434305-32434327 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
904996514 1:34635683-34635705 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
905060555 1:35136056-35136078 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
905684541 1:39899399-39899421 CTACTCTCTGAAAGGGAGAATGG - Intronic
907503602 1:54901586-54901608 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
908591987 1:65645600-65645622 CTAGACCCTAAAAGGTCTAAAGG - Intergenic
908709657 1:67000997-67001019 CTGGACCCTGAGTGGGAGAAAGG - Exonic
908852370 1:68388250-68388272 CTAGACCCTAAAAGGTCTAAAGG + Intergenic
909222693 1:72983558-72983580 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
909551056 1:76898525-76898547 CTAGACCCTAAAAGGTCAAAAGG - Intronic
909776728 1:79492288-79492310 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
909793010 1:79700070-79700092 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
909978486 1:82071235-82071257 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
910520056 1:88110518-88110540 TAAGCCCCTGAAAGGGAGAAGGG - Intergenic
911759822 1:101601785-101601807 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
912296442 1:108474936-108474958 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
912813525 1:112811398-112811420 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
912882269 1:113427336-113427358 CTTGTCCCACAAAGGGAGACTGG - Intronic
913396573 1:118378153-118378175 TTAGAGGCTCAAAGGAAGAAGGG + Intergenic
913510471 1:119556951-119556973 CAAGACCTTCAAAGTGAGAAAGG - Intergenic
913514687 1:119594376-119594398 CAAGACCTTCAAAGTGAGAAAGG - Intergenic
918347081 1:183615632-183615654 CTAGACCCTAAAAGGTCTAAAGG + Intergenic
918714441 1:187769222-187769244 CTAGACCCTAAAAGGTCTAAAGG - Intergenic
919281827 1:195499879-195499901 TTTGAAGCTCAAAGGGAGAAAGG - Intergenic
919476363 1:198036778-198036800 CTAGACCCTAAAAGGTCTAAAGG + Intergenic
919758645 1:201082497-201082519 CTAGGCAGTCAAAGGGAGGAGGG - Intronic
920829368 1:209450921-209450943 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
921212385 1:212911490-212911512 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
921426562 1:215008673-215008695 CTAGGACCTCAAAGTTAGAAAGG - Intronic
921459815 1:215413669-215413691 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
921520094 1:216147532-216147554 CTAGACCCTAAAAGGTCAAAAGG + Intronic
922048378 1:221967940-221967962 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
922049568 1:221976832-221976854 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
922154104 1:223028132-223028154 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
923066078 1:230518536-230518558 CTAAACCATCAAAAGGAGGAAGG - Intergenic
923075172 1:230603214-230603236 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
923962751 1:239103334-239103356 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
924896215 1:248339955-248339977 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1062930718 10:1350705-1350727 CTAGACCCTGAAAGGTCAAAAGG + Intronic
1063509634 10:6633321-6633343 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1063527717 10:6800818-6800840 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1064490568 10:15851406-15851428 CCAGAATCTAAAAGGGAGAATGG - Intronic
1064663845 10:17630571-17630593 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1064887027 10:20122886-20122908 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1065259650 10:23911302-23911324 CTAGTATCTCAAAGGGATAAAGG - Intronic
1065438672 10:25727135-25727157 GTGGACCTTCAGAGGGAGAAGGG - Intergenic
1065877295 10:30008339-30008361 CCAGAACCTCAAAGGCAGCACGG - Intergenic
1068058383 10:52037489-52037511 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1068179689 10:53502760-53502782 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1068230940 10:54168740-54168762 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1068592378 10:58864744-58864766 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1068771080 10:60821390-60821412 ATATACACTCAATGGGAGAAAGG - Intergenic
1068829316 10:61474478-61474500 CTAGACTCTTAAAGGAAGGAGGG - Intergenic
1070154857 10:73827105-73827127 CAAGACCCTCACAGGGGGCAAGG + Intronic
1070474894 10:76820554-76820576 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1071821707 10:89286653-89286675 CTAGACCCTGAAAGGTCAAAAGG + Intronic
1071897765 10:90084767-90084789 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1071916169 10:90296990-90297012 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1072580226 10:96734197-96734219 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1073709520 10:106021346-106021368 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1073725844 10:106229567-106229589 CTATACACACAAAGAGAGAATGG - Intergenic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1074018993 10:109564318-109564340 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
1074549705 10:114431056-114431078 ATAGACCTTCAAAGGGAGCCAGG + Intergenic
1074740744 10:116482638-116482660 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1074824675 10:117206219-117206241 CTAGAGCCTTAGAGGGAGTATGG - Intronic
1074933807 10:118157810-118157832 CTAGAGCCTCAAAGGCAGCATGG + Intergenic
1075248664 10:120846834-120846856 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1076158630 10:128223487-128223509 CTAGATGTTCAAAGGGAAAAGGG + Intergenic
1077766418 11:5164038-5164060 CTAGACCCTAAAAGGACAAAAGG - Intronic
1077850829 11:6073564-6073586 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1077883318 11:6367766-6367788 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
1078046159 11:7915888-7915910 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1078202968 11:9200804-9200826 GTATATCCCCAAAGGGAGAATGG - Intronic
1079447428 11:20569774-20569796 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1079672604 11:23187666-23187688 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1079727105 11:23890907-23890929 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1080227323 11:29975367-29975389 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1080826450 11:35852975-35852997 CAGGCCCCTCCAAGGGAGAAGGG + Intergenic
1083170834 11:60923232-60923254 CTAGAGCCTCAAAGGAAAAGTGG - Exonic
1084047131 11:66575581-66575603 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1084245632 11:67855162-67855184 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1084355518 11:68635696-68635718 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1085181252 11:74538639-74538661 CAAGCCCCACAGAGGGAGAAGGG - Intronic
1085834816 11:79941760-79941782 ATAGAGCCTCACATGGAGAAAGG - Intergenic
1085934234 11:81123809-81123831 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1085987981 11:81808173-81808195 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1086004983 11:82027178-82027200 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1086125341 11:83343843-83343865 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1087099064 11:94347679-94347701 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1087314645 11:96589909-96589931 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1089349062 11:117811267-117811289 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1089917349 11:122170987-122171009 CTGGACCTTCCATGGGAGAAGGG + Intergenic
1089940534 11:122411775-122411797 CTGAACCTTCAAAGGGTGAAGGG + Intergenic
1089987653 11:122829107-122829129 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1090107636 11:123869352-123869374 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1090526844 11:127546486-127546508 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
1090546523 11:127772830-127772852 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1090926972 11:131258213-131258235 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1091183639 11:133628770-133628792 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1091699552 12:2650873-2650895 CAAGACCCTGGAAGGGAGAGGGG - Intronic
1091851060 12:3697224-3697246 CAAGCCCATCAAAGGGAGGAGGG + Intronic
1091886479 12:4020515-4020537 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1092474455 12:8806922-8806944 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1092626777 12:10336656-10336678 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1092723752 12:11465897-11465919 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1092739358 12:11613422-11613444 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1092789675 12:12060377-12060399 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1093044054 12:14421421-14421443 CAGCACCCTCAGAGGGAGAATGG - Intronic
1093071196 12:14708597-14708619 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1093268045 12:17025431-17025453 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1093322024 12:17724027-17724049 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1093448455 12:19287535-19287557 CCAGAGCCTCCAAGGGAAAACGG + Exonic
1093575871 12:20729438-20729460 CCAAACCCTCAAAGGAAGAATGG - Intronic
1093578784 12:20765361-20765383 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1093584551 12:20820729-20820751 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1093812874 12:23509765-23509787 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1093951037 12:25165107-25165129 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1094316090 12:29138752-29138774 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1094400635 12:30057934-30057956 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1095637621 12:44451754-44451776 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1095898566 12:47305173-47305195 CTCAAACCTCTAAGGGAGAATGG + Intergenic
1097136588 12:56862100-56862122 CCAGGCCCTCTCAGGGAGAAAGG + Intergenic
1097451891 12:59746781-59746803 CTACCCCCTCAAAGTCAGAAAGG + Intronic
1097542233 12:60955738-60955760 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1098402212 12:70087384-70087406 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1098630063 12:72712621-72712643 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1101278432 12:103226407-103226429 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1101396659 12:104354701-104354723 CTTGGCCCTCAAAGTGAGCATGG + Intergenic
1106073292 13:26435004-26435026 CTGGACTGTCAAAGGGAGAGTGG + Intergenic
1106283899 13:28302537-28302559 CTGGGCCCTCAAATGTAGAAGGG + Exonic
1106943410 13:34800628-34800650 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1107075543 13:36318427-36318449 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1107220330 13:37972928-37972950 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1107683176 13:42871141-42871163 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1108202665 13:48058340-48058362 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1108281968 13:48870093-48870115 CTAGACCTTATAAGGGAGATAGG + Intergenic
1108493385 13:51002476-51002498 GGAGACCTTCAGAGGGAGAACGG - Intergenic
1108512960 13:51171852-51171874 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1108803910 13:54131444-54131466 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1108814093 13:54268842-54268864 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1108919579 13:55658701-55658723 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1108947403 13:56042296-56042318 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1108952980 13:56116145-56116167 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1109343546 13:61090314-61090336 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1109344754 13:61100709-61100731 CTACAGGCTCAAAGGTAGAAGGG + Intergenic
1109352879 13:61206745-61206767 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1109709700 13:66145064-66145086 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1110098377 13:71561552-71561574 CTAGTATCTCAAAGGGAGCATGG + Intronic
1110765443 13:79276119-79276141 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1111302014 13:86360391-86360413 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1111362146 13:87190180-87190202 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1111458875 13:88516551-88516573 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1111631738 13:90852314-90852336 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1112236794 13:97644302-97644324 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1112889354 13:104211805-104211827 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
1113324302 13:109267328-109267350 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1115240634 14:31249065-31249087 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1115525341 14:34274586-34274608 TTAGACCCTCTGAGGGAGCACGG - Intronic
1115904774 14:38192776-38192798 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1116179643 14:41517927-41517949 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1116218217 14:42047977-42047999 ATACACCCTCAGAGGGAGAGTGG - Intergenic
1116525701 14:45902177-45902199 CTAAATCATCAAAGGGAAAAGGG + Intergenic
1116573421 14:46545912-46545934 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1116613478 14:47106166-47106188 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1116702441 14:48259134-48259156 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1116703325 14:48266098-48266120 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1116952879 14:50895156-50895178 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1117957950 14:61137176-61137198 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1118152589 14:63205423-63205445 CTAGACACACAAATGGTGAAAGG + Intronic
1119022395 14:71126287-71126309 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1119317165 14:73705476-73705498 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1120251431 14:82064835-82064857 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1120438084 14:84503932-84503954 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1120539600 14:85736727-85736749 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1120618225 14:86733302-86733324 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1120659992 14:87238764-87238786 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1120710720 14:87790248-87790270 CTAGACTCTCCCAGGGAGGATGG + Intergenic
1121703613 14:95974906-95974928 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1121980617 14:98450877-98450899 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1122040964 14:98987184-98987206 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1123803012 15:23841166-23841188 ACAGACACTCAAAGGAAGAAGGG - Intergenic
1124079885 15:26482787-26482809 CAAGACCATCCAAGGGAGATAGG + Intergenic
1124146429 15:27130308-27130330 CAAGACCATTAAATGGAGAATGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124882327 15:33654068-33654090 CTCGACTCTCCAAGGTAGAATGG + Intronic
1124940803 15:34215978-34216000 CTAGACCTTCAGAGGGCGCATGG - Intergenic
1125045741 15:35240755-35240777 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1125131549 15:36289368-36289390 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1125213257 15:37239955-37239977 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1126530190 15:49702863-49702885 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1126912438 15:53430560-53430582 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1127270979 15:57401856-57401878 CTAGCCCATCAACAGGAGAAGGG - Intronic
1127828825 15:62731521-62731543 CTACACCCTCAAAGGTAAAATGG - Intronic
1129941977 15:79506048-79506070 CTAGAACCTGGAAGAGAGAAGGG - Intergenic
1130304521 15:82704210-82704232 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1130395860 15:83500682-83500704 GTAGTCCCTGGAAGGGAGAAAGG - Intronic
1130637638 15:85640187-85640209 CTACACCCTCAAAATGAGACAGG - Intronic
1130855081 15:87833253-87833275 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1130893851 15:88155381-88155403 CTGGAGGCTCTAAGGGAGAATGG - Intronic
1130945979 15:88551228-88551250 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1131882550 15:96875559-96875581 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1132262978 15:100442244-100442266 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1133035512 16:3031712-3031734 CTAGGCCCTCAAAGCGGGATGGG + Intronic
1133651364 16:7816689-7816711 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1133765772 16:8836740-8836762 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1133766796 16:8843807-8843829 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1134321531 16:13168568-13168590 CTACACCATGAAAGGGAGAAGGG + Intronic
1137645802 16:50072913-50072935 TTTGACTCTGAAAGGGAGAAAGG + Intronic
1138804914 16:60080818-60080840 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1139039267 16:62982897-62982919 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1139943085 16:70620191-70620213 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1139943755 16:70624509-70624531 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1143945984 17:10592436-10592458 CTAGATCCTCAAAGGAGCAAAGG + Intergenic
1144171593 17:12664517-12664539 CTAGATCCCCAAAGGGAACATGG + Intergenic
1146597862 17:34185259-34185281 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1150016623 17:61563852-61563874 CAAGACTTTCAAAGGGTGAATGG - Intergenic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1150861020 17:68800795-68800817 CTTGACTCTTAAAGGAAGAAGGG - Intergenic
1151341429 17:73473407-73473429 CAGGACCCTCAGAGGAAGAAGGG + Intronic
1151839790 17:76609678-76609700 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1152118273 17:78402108-78402130 CAACACCCTCCAGGGGAGAAAGG - Intronic
1155173786 18:23286005-23286027 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1155697052 18:28696825-28696847 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1156125875 18:33904473-33904495 CTAAACCATAAAAGGGAGGAGGG - Intronic
1156251966 18:35360063-35360085 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
1156302209 18:35845858-35845880 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1156840383 18:41604002-41604024 CTAGGCCCTGAAAGAGAGTAAGG + Intergenic
1158336343 18:56417577-56417599 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1158394675 18:57070350-57070372 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1158465308 18:57684989-57685011 CTAGACCTTCAAAGGAAGCATGG + Intronic
1158690657 18:59657352-59657374 TTACACACTTAAAGGGAGAAGGG + Intronic
1158941945 18:62412640-62412662 AGAGACCCTCACAGGGAGGAGGG - Intergenic
1159164432 18:64683627-64683649 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1159434174 18:68394666-68394688 CTAGATCCTCGGAGGGAGCATGG - Intergenic
1159835017 18:73326623-73326645 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1163635440 19:18435145-18435167 CCAGACACCCACAGGGAGAAAGG + Intronic
1164152940 19:22570227-22570249 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1164459265 19:28433613-28433635 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1165497038 19:36159129-36159151 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1166353291 19:42211371-42211393 CTAGACCCTCAAAGGGAGAAGGG + Intronic
1166498976 19:43327226-43327248 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1167046636 19:47053472-47053494 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1167902113 19:52629758-52629780 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1168051606 19:53833595-53833617 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1168270564 19:55247504-55247526 CCAGACCCTCATGGGGAGACAGG - Intronic
1168724543 19:58573496-58573518 CTAGACCGCAAAATGGAGAAAGG + Exonic
925544519 2:5002966-5002988 CTAGACCCTAAAAGGTGAAAAGG + Intergenic
925770826 2:7281678-7281700 CTAGACCCTTGAGGGGAGCATGG + Intergenic
925828854 2:7876385-7876407 CTAGACCCTAAAAGGTGAAAAGG - Intergenic
926413555 2:12628488-12628510 CTAGACCCTAAAAGGTGAAAAGG + Intergenic
926464127 2:13167714-13167736 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
926815583 2:16795664-16795686 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
927865394 2:26584538-26584560 CTATGCCCTCAAAGGGTTAAGGG + Intronic
928770141 2:34695804-34695826 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
928778272 2:34791694-34791716 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
928827692 2:35440843-35440865 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
928857132 2:35815043-35815065 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
928928527 2:36601022-36601044 CTAGACCCTAAAAGGTCAAAAGG + Intronic
929004867 2:37384724-37384746 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
929076707 2:38084489-38084511 CTAGACCCTAAAAGGTCAAAAGG - Intronic
930955063 2:57194953-57194975 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
931026427 2:58117136-58117158 CTAGACCCTAAAAGGTCAAAAGG - Intronic
931336867 2:61354516-61354538 CTAGCCACTAAATGGGAGAAGGG + Intronic
931608964 2:64078918-64078940 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
931674308 2:64678413-64678435 CTAGACCCATAAAGGAAGGAAGG + Intronic
931850392 2:66245915-66245937 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
932295820 2:70622614-70622636 CTAGACCCTAAAAGGTCAAAAGG + Intronic
932358850 2:71088767-71088789 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
932367682 2:71163406-71163428 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
933013056 2:77090363-77090385 CTAGACCCTAAAAGGTCAAAAGG + Intronic
933179803 2:79215569-79215591 CTAGACCCTAAAAGGTCAAAAGG - Intronic
933552428 2:83792633-83792655 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
935155606 2:100481151-100481173 CTATACCCTGAAAAGGAAAAAGG - Exonic
935298744 2:101674171-101674193 CCAGACCTTCAAAGGGACATTGG - Intergenic
936125665 2:109787495-109787517 CTAGAACCTCAAGGGGTGGACGG + Intergenic
936219028 2:110583973-110583995 CTAGAACCTCAAGGGGTGGACGG - Intergenic
936794329 2:116187988-116188010 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
936883299 2:117280728-117280750 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
937328485 2:121006711-121006733 CTAGACCTACCCAGGGAGAAAGG - Intergenic
937427408 2:121811864-121811886 CCAGACCCACAAAGGGTGTAAGG - Intergenic
938985697 2:136573225-136573247 CTATACCTTCAGAGGGAGCATGG + Intergenic
939600831 2:144188060-144188082 CTAGAGCCTCAGAGGGAGTGTGG + Intronic
940508830 2:154586986-154587008 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
941307248 2:163885521-163885543 CCAGAGTCTCAAAGGGAGCATGG - Intergenic
941340366 2:164297840-164297862 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
941353350 2:164461101-164461123 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
941456219 2:165714219-165714241 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
942079917 2:172390252-172390274 TTAGATCCTCCAAAGGAGAAGGG - Intergenic
942097050 2:172543699-172543721 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
942730329 2:179055499-179055521 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
942961022 2:181829831-181829853 CCAGACCCCCTCAGGGAGAAGGG - Intergenic
943412965 2:187564202-187564224 CTAGACCCTAAAAGGTCAAAAGG - Intronic
943450097 2:188035203-188035225 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
943461229 2:188172954-188172976 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
943806616 2:192132407-192132429 CTAGACCCTAAAAGGTCAAAAGG + Intronic
943835367 2:192509446-192509468 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
943951328 2:194134638-194134660 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
944105680 2:196076867-196076889 ATACACTCTCAAAGGGAGAGTGG + Intergenic
944387416 2:199181359-199181381 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
944394103 2:199248912-199248934 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
944876160 2:203965640-203965662 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
945153136 2:206810580-206810602 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
945173417 2:207019202-207019224 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
945394268 2:209301211-209301233 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
945938281 2:215924358-215924380 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
946129425 2:217594315-217594337 CTAGCCCACCAAAGGAAGAAGGG + Intronic
946781079 2:223193591-223193613 CTAGACCCTAAAAGGTCAAAAGG - Intronic
946871795 2:224091600-224091622 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
946886464 2:224227277-224227299 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
946893238 2:224298662-224298684 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
948390649 2:237608942-237608964 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
948592088 2:239057017-239057039 CGGGACCCTAAAATGGAGAAAGG + Intronic
1168739308 20:174480-174502 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1169061254 20:2662071-2662093 CTAAACCTTCAGAGGGAGCAGGG + Intronic
1170106200 20:12755859-12755881 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1170325524 20:15151584-15151606 CTAGACCCTAAAAGGTGAAAAGG - Intronic
1170820736 20:19754869-19754891 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1172191874 20:33066801-33066823 CTGGACCCCCAATGGGAGAGAGG - Intronic
1172233629 20:33354215-33354237 CTCAGCCCCCAAAGGGAGAATGG + Intergenic
1172909283 20:38394576-38394598 CCAGAGTCTCAAAGGGAGCATGG + Intergenic
1173101876 20:40095328-40095350 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1173118838 20:40271044-40271066 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1173763814 20:45587947-45587969 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1173853438 20:46233564-46233586 CTAGACCCTCGAGGGCAGGATGG + Intronic
1175209907 20:57347422-57347444 CTAGAAACAAAAAGGGAGAACGG - Intergenic
1175285380 20:57833864-57833886 ATGGACCCTCACTGGGAGAAGGG + Intergenic
1175285415 20:57833978-57834000 ATGGACCCTCACTGGGAGAAGGG + Intergenic
1177031211 21:15983540-15983562 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1177840782 21:26231790-26231812 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
1179015321 21:37590761-37590783 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
1179387520 21:40956937-40956959 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1179650403 21:42804773-42804795 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1182732241 22:32504776-32504798 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1182985776 22:34714770-34714792 CTGGAGCCTCGAAGGGAGCATGG + Intergenic
949162132 3:894392-894414 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
949190430 3:1243535-1243557 CTAGACCCTAAAAGGTCAAAAGG - Intronic
949671116 3:6399640-6399662 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
949827406 3:8179003-8179025 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
950926461 3:16746304-16746326 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
951298847 3:20971235-20971257 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
952101435 3:30017644-30017666 CTAGAACCTCAGAGGGAGCATGG + Intergenic
952663491 3:35878069-35878091 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
952896090 3:38080003-38080025 CTAGACCCTAAAAGGTCAAAGGG - Intronic
953077168 3:39581523-39581545 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
953177161 3:40562978-40563000 CTAGACCCTAAAAGGTCAAAAGG + Intronic
953320142 3:41964048-41964070 CTAACCCCTCTAAGGGAGAGCGG + Intergenic
953814277 3:46141681-46141703 CTGGGCCCTCAAATGTAGAAGGG + Intergenic
953825739 3:46250017-46250039 CTAGACCCTAAAAGGTCAAAAGG - Intronic
953888062 3:46729389-46729411 CTATCCCCTTAAAGGGAGAAAGG + Intronic
954858488 3:53666953-53666975 CTAGATCCTAAAGGGAAGAAAGG + Intronic
955253331 3:57305665-57305687 CTAGACCCTAAAAGGTCAAAAGG + Intronic
956549026 3:70438613-70438635 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
956709182 3:72024948-72024970 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
958648095 3:96899125-96899147 CTAAACCTTCAAAGGGAGCTTGG - Intronic
959491765 3:106998590-106998612 CTAGACCCTGAAAAGGAATATGG - Intergenic
959669690 3:108962221-108962243 CTAGACCATCAAAGGGGAGAGGG + Intronic
959749356 3:109814778-109814800 CTGGCACCACAAAGGGAGAAAGG - Intergenic
960310152 3:116109042-116109064 CTAGACCCTAAAAGGTCAAAAGG - Intronic
960532383 3:118779735-118779757 CAAGACCCACCAAGGCAGAATGG + Intergenic
961164799 3:124756276-124756298 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
961293473 3:125865663-125865685 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
961711660 3:128832911-128832933 CTAGACCCTAAAAGGTCAAAGGG - Intergenic
961730550 3:128961692-128961714 CTAGACCCTAAAAGGTCAAAAGG + Intronic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
962205530 3:133431115-133431137 CTAGACCCTAAAAGGTCAAAAGG + Intronic
962593730 3:136917653-136917675 CTTGACCCTCAAAAGTAAAATGG - Intronic
962660592 3:137597433-137597455 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
963058583 3:141206925-141206947 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
963425181 3:145114940-145114962 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
963468577 3:145712358-145712380 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
963520410 3:146355512-146355534 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
963521588 3:146364014-146364036 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
964125492 3:153230440-153230462 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
964906546 3:161725585-161725607 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
964984906 3:162726269-162726291 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
965070293 3:163909529-163909551 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
965262691 3:166504536-166504558 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
965286768 3:166827827-166827849 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
965336290 3:167433174-167433196 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
965447476 3:168793445-168793467 CTATCCCCTTAAAGGGAGGAAGG + Intergenic
965640077 3:170821704-170821726 CTAGACCCTGAAAGGTCAAAAGG - Intronic
965713370 3:171578400-171578422 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
966066809 3:175829705-175829727 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
966085394 3:176063294-176063316 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
966105120 3:176325348-176325370 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
966232885 3:177669563-177669585 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
966279263 3:178209491-178209513 CTAGACCCTAAAAGGTCTAAAGG + Intergenic
967098601 3:186197365-186197387 ATAGACCCTAAAAGGCAGAGGGG + Intronic
967496187 3:190146491-190146513 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
967624683 3:191670211-191670233 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
967643870 3:191899120-191899142 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
967658143 3:192074808-192074830 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
968124856 3:196151521-196151543 CTAGAGCCTCAGAAGGAGCATGG - Intergenic
969228724 4:5815443-5815465 CCACACCCTCATAGGGAGACGGG + Intronic
969493264 4:7511925-7511947 CAGGACCTGCAAAGGGAGAAAGG - Intronic
969946637 4:10790191-10790213 CTAGACACTAACTGGGAGAAGGG + Intergenic
970029275 4:11657482-11657504 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
970042053 4:11808232-11808254 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
970087508 4:12365726-12365748 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
971180524 4:24325196-24325218 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
971200104 4:24502994-24503016 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
971451691 4:26806916-26806938 CTAGAGCCTCAGAGGGAGGCTGG + Intergenic
975826695 4:78327292-78327314 CTAGACTCACAACGGGAGTACGG - Intronic
976696499 4:87923851-87923873 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
976854852 4:89591355-89591377 CAATACCCTGAAAGGGAAAAAGG + Intergenic
976884607 4:89968520-89968542 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
977062544 4:92275219-92275241 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
977075244 4:92442689-92442711 CTAGACCCTAAAAGGTCAAAAGG - Intronic
977198466 4:94088352-94088374 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
977217190 4:94296943-94296965 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
978001156 4:103557491-103557513 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
978031442 4:103943097-103943119 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
979054657 4:115979381-115979403 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
979146583 4:117254083-117254105 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
979379905 4:119995903-119995925 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
979850343 4:125565363-125565385 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
980388889 4:132120183-132120205 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
980527831 4:134014127-134014149 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
980903902 4:138929854-138929876 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
981040208 4:140215477-140215499 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
981525171 4:145701090-145701112 CTAGACCCTAAAAGGTCAAAAGG + Intronic
981539687 4:145834728-145834750 CTAGACCCTAAAAGGTCAAAAGG + Intronic
982084003 4:151816329-151816351 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
982180512 4:152745079-152745101 CTAGACCCTAAAAGGTCAAAAGG - Intronic
982497143 4:156107194-156107216 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
982535409 4:156602265-156602287 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
982899450 4:160980417-160980439 CTAGACCCTCCCAGGGAGTGAGG - Intergenic
983023835 4:162711085-162711107 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
983055449 4:163095071-163095093 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
983345519 4:166522478-166522500 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
983369422 4:166839933-166839955 ATACACCCTCAGAGGGAGAGTGG - Intronic
984165396 4:176298602-176298624 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
984322150 4:178209105-178209127 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
984700632 4:182816503-182816525 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
985112866 4:186564004-186564026 CTTGTCCCTCAAAGGAAGCAAGG - Intergenic
985389906 4:189483191-189483213 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
985582322 5:704773-704795 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
985734035 5:1566878-1566900 CTAGACCCCCACTGGAAGAAAGG - Intergenic
986193501 5:5517536-5517558 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
986555081 5:9002300-9002322 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
986563432 5:9086117-9086139 TTACACCCTCATAGGCAGAAGGG + Intronic
986919623 5:12666267-12666289 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
987282005 5:16421997-16422019 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
987487467 5:18540291-18540313 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
987498161 5:18672586-18672608 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
988904523 5:35772531-35772553 CTACGCCCTCAGATGGAGAAGGG - Intronic
990966374 5:61452794-61452816 CTAAATCCTCAAAGAGAAAAAGG - Intronic
991503716 5:67303109-67303131 CAAGACACTCAAGGAGAGAAGGG + Intergenic
992394625 5:76359335-76359357 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
992960794 5:81955241-81955263 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
993192678 5:84700462-84700484 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
993836669 5:92825963-92825985 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
994295108 5:98081021-98081043 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
994532579 5:100987981-100988003 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
994556894 5:101316896-101316918 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
994804541 5:104427774-104427796 CCAGACCCTCAAAGGCATCATGG - Intergenic
994989510 5:106980363-106980385 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
995899403 5:117050093-117050115 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
996203295 5:120701318-120701340 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
996344860 5:122477332-122477354 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
996509870 5:124305753-124305775 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
996745483 5:126843286-126843308 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
997624176 5:135320391-135320413 CTAACCCCTGCAAGGGAGAAGGG + Intronic
997746363 5:136303269-136303291 CTAGACCCTAAAAGGTCAAAAGG + Intronic
998209473 5:140183408-140183430 GTCAACCCTCAAAGTGAGAATGG - Intronic
998402234 5:141853871-141853893 CTGGACCCTGCATGGGAGAAGGG + Exonic
998996434 5:147872700-147872722 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1000438549 5:161241925-161241947 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1000439684 5:161250449-161250471 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1000519446 5:162279104-162279126 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1000885362 5:166742839-166742861 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1000935681 5:167301642-167301664 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1001331489 5:170765761-170765783 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1001437796 5:171714160-171714182 CTACACCCAAGAAGGGAGAATGG + Intergenic
1002611001 5:180418453-180418475 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1003092388 6:3114989-3115011 CTACAGCCCAAAAGGGAGAATGG + Exonic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004106228 6:12669360-12669382 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
1004283560 6:14300678-14300700 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1004836961 6:19540860-19540882 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1005014695 6:21365235-21365257 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1008476486 6:51940140-51940162 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1008595202 6:53035228-53035250 GTAGAAACTCAAGGGGAGAAGGG + Intronic
1009269781 6:61602058-61602080 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1009343570 6:62587934-62587956 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1009849932 6:69182738-69182760 ATAGACTCTCAAAAGGAAAAAGG + Intronic
1010043776 6:71418021-71418043 ATAGACCCTCAGAGGAATAAGGG + Intergenic
1010071759 6:71752302-71752324 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1010826949 6:80486165-80486187 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1010829730 6:80514060-80514082 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1011770981 6:90673940-90673962 CTAGACCCTAAAAGGTCTAAAGG - Intergenic
1012014427 6:93833805-93833827 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1012315786 6:97781579-97781601 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1013843717 6:114426052-114426074 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1013891667 6:115033867-115033889 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1014360198 6:120465994-120466016 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1014555812 6:122841815-122841837 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1014614711 6:123586016-123586038 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1014718858 6:124894019-124894041 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1014794027 6:125705589-125705611 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1014891507 6:126850735-126850757 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1015165188 6:130194326-130194348 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1015266697 6:131297438-131297460 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1015269622 6:131325385-131325407 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1015271337 6:131340857-131340879 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1015288073 6:131508009-131508031 CTAGACCCTAAAAGGGCAAAAGG - Intergenic
1015323794 6:131903668-131903690 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1015729691 6:136335143-136335165 CCAGAGCCTCAGAGGGAGCAGGG - Intergenic
1016114179 6:140261138-140261160 CTAGACCCTAAAAGGCCAAAAGG - Intergenic
1016248826 6:142017790-142017812 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1016535794 6:145106877-145106899 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1016650330 6:146454143-146454165 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1016853231 6:148641782-148641804 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1017389461 6:153923467-153923489 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1017779371 6:157704401-157704423 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1018084535 6:160290299-160290321 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1018495439 6:164342458-164342480 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1018521509 6:164655879-164655901 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1019900877 7:4019907-4019929 TGAGTCCCTCAAAGGGAGGACGG - Intronic
1020210141 7:6152865-6152887 TTGGACCCTCAAAGGTAGAGGGG - Intronic
1020323982 7:6960422-6960444 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1020532751 7:9357147-9357169 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1021429809 7:20547431-20547453 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1021637278 7:22705226-22705248 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1021810626 7:24398259-24398281 CTAGACCCTGAAAGGTCAAAAGG + Intergenic
1021977932 7:26027914-26027936 CTAGACCCTGAAAGGTCAAAAGG - Intergenic
1022372836 7:29786829-29786851 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1022572829 7:31470781-31470803 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1022709032 7:32834349-32834371 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1022854746 7:34303620-34303642 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1023250438 7:38254528-38254550 CTTGACCCTTCAAGGGAGAATGG + Intergenic
1023327605 7:39076727-39076749 CCAGGACCTCAAAGGGAGATAGG - Intronic
1023698924 7:42874335-42874357 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1024697585 7:51872000-51872022 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1027642578 7:80755570-80755592 CTATACCTTCCAAGGAAGAAAGG - Intronic
1027851907 7:83461650-83461672 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1028604792 7:92644021-92644043 GTGGACCCTTACAGGGAGAATGG + Intronic
1028670475 7:93395914-93395936 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1029365099 7:100111691-100111713 CTAGTCCCTGGAAGGGAGGATGG + Intronic
1029500176 7:100924126-100924148 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1030441725 7:109595782-109595804 CTAGACCCTAAAAGGTCAAACGG - Intergenic
1030751537 7:113237306-113237328 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1031004633 7:116457466-116457488 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1031094276 7:117400781-117400803 CATGATCCTCAAAGGGAGAGTGG + Intronic
1031355231 7:120780871-120780893 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1031364784 7:120889366-120889388 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1031399947 7:121317554-121317576 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1031422493 7:121567734-121567756 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1031525556 7:122818903-122818925 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1031685808 7:124731022-124731044 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1031777307 7:125919570-125919592 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1032194493 7:129781235-129781257 CTAGAAGCTAAAAAGGAGAAGGG - Intergenic
1033675988 7:143540950-143540972 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1033695847 7:143788489-143788511 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1033909502 7:146247107-146247129 CTAGACCCTGAAAGGTCAAAAGG - Intronic
1034084871 7:148313803-148313825 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1035029582 7:155848535-155848557 CAAGACTCTCAAAAAGAGAAGGG - Intergenic
1035305636 7:157929584-157929606 CTGGACCCTGAAAGGAAGATGGG - Intronic
1035545152 8:475203-475225 CAAGACCATTCAAGGGAGAAAGG - Intergenic
1035880703 8:3241971-3241993 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1036070963 8:5440391-5440413 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1036281445 8:7404420-7404442 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1036340024 8:7907152-7907174 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1036472371 8:9063193-9063215 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1040029698 8:42813467-42813489 CTGGAAACTCACAGGGAGAAAGG + Intergenic
1041257353 8:55990724-55990746 CTACACTCCAAAAGGGAGAAGGG + Intronic
1041742862 8:61175745-61175767 CTAGACCCTAAGAGGGAACATGG + Intronic
1042453519 8:68975153-68975175 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1042707332 8:71676894-71676916 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1043353709 8:79389834-79389856 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1043717932 8:83508869-83508891 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1044148550 8:88745943-88745965 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1044258652 8:90093934-90093956 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1044417045 8:91949951-91949973 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1044921951 8:97177062-97177084 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1045197484 8:99945852-99945874 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1045644744 8:104287916-104287938 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1046294083 8:112197804-112197826 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1046439975 8:114243319-114243341 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1046443210 8:114283974-114283996 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1046559245 8:115816590-115816612 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1047175659 8:122538092-122538114 CTTGAACCTCAGAGGGAGAAGGG + Intergenic
1047350588 8:124069663-124069685 CTATACCCTCATATTGAGAAGGG + Intronic
1047663163 8:127060743-127060765 CTACAACTTCAAAGGGAAAAGGG - Intergenic
1047699309 8:127433710-127433732 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1048168473 8:132083965-132083987 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1048728462 8:137412030-137412052 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1049713436 8:144078094-144078116 CTGCATCCTCAAAGGGAAAAGGG + Intergenic
1050117566 9:2277549-2277571 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1051052588 9:12950303-12950325 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1051685083 9:19650053-19650075 CTTGATCCTCATAGGGAAAAAGG + Intronic
1051849323 9:21489429-21489451 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1052942423 9:34140317-34140339 TTGGATCCTCAAAGGGATAAAGG + Intergenic
1055233023 9:74087646-74087668 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1055626685 9:78182765-78182787 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1056044775 9:82704439-82704461 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1056061123 9:82885740-82885762 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1056323847 9:85460629-85460651 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1056437276 9:86587038-86587060 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1056522409 9:87412909-87412931 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1057377955 9:94541810-94541832 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1057683962 9:97216826-97216848 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1057812619 9:98269565-98269587 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1057982046 9:99672147-99672169 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1058026242 9:100144421-100144443 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1058612361 9:106790153-106790175 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1059546199 9:115178374-115178396 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1059574585 9:115475342-115475364 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1060737923 9:126078382-126078404 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1061583022 9:131549044-131549066 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1185858468 X:3556855-3556877 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1185960723 X:4544215-4544237 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1185991022 X:4893573-4893595 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1186075424 X:5873578-5873600 GTAGAACATCAAAGGAAGAAAGG + Intronic
1186784030 X:12941784-12941806 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1187086561 X:16048414-16048436 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1187099997 X:16182905-16182927 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1188419446 X:29977242-29977264 CTAGACCCTAAAAGGTCCAAAGG + Intergenic
1188552613 X:31379470-31379492 CTAGACCCTAAAAGGTCAAAAGG + Intronic
1193042227 X:77016105-77016127 CCAAATCCTCAAAGGGAGGAAGG + Intergenic
1193651205 X:84135640-84135662 CTAGACAGTAAAAGAGAGAATGG - Intronic
1193941460 X:87683873-87683895 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1194186285 X:90777046-90777068 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1194308575 X:92276789-92276811 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1194351254 X:92826483-92826505 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1194367070 X:93024917-93024939 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1194503017 X:94702545-94702567 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1194660648 X:96625988-96626010 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1195291197 X:103433282-103433304 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1195908715 X:109868941-109868963 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1196073047 X:111545901-111545923 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1196165509 X:112532600-112532622 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1196299975 X:114041967-114041989 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1196341753 X:114605028-114605050 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1196533575 X:116816190-116816212 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1196572465 X:117281143-117281165 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1196773889 X:119321492-119321514 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1196992723 X:121346737-121346759 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1197064878 X:122224019-122224041 CTAGACCCTAAAAGGTCGAAAGG + Intergenic
1197352097 X:125392571-125392593 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1197933040 X:131714030-131714052 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1200251572 X:154556934-154556956 CTTGCCCCTCAAAGGGAGCACGG - Intronic
1200266195 X:154647482-154647504 CTTGCCCCTCAAAGGGAGCACGG + Intergenic
1200532875 Y:4359123-4359145 CTAGACCCTAAAAGGTCAAAAGG - Intergenic
1200611179 Y:5328508-5328530 CTAGACCCTAAAAGGTCAAAAGG - Intronic
1200659579 Y:5943165-5943187 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1200675288 Y:6141173-6141195 CTAGACCCTAAAAGGTCAAAAGG + Intergenic
1201581355 Y:15514359-15514381 CTAGACCCTAAAAGGTCAAAAGG + Intergenic