ID: 1166356214

View in Genome Browser
Species Human (GRCh38)
Location 19:42229089-42229111
Sequence ATGGGGTGGTAGAAGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166356209_1166356214 -9 Left 1166356209 19:42229075-42229097 CCTGGGAAGGGGTCATGGGGTGG No data
Right 1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG No data
1166356200_1166356214 12 Left 1166356200 19:42229054-42229076 CCAGCAGAAGACAGGGCTGGACC No data
Right 1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166356214 Original CRISPR ATGGGGTGGTAGAAGGGTGA GGG Intergenic
No off target data available for this crispr