ID: 1166358637

View in Genome Browser
Species Human (GRCh38)
Location 19:42242414-42242436
Sequence GCGCCCTGCCCGAGCCCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166358631_1166358637 8 Left 1166358631 19:42242383-42242405 CCGCCGCCGGGCTCCGCGAACGA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358630_1166358637 11 Left 1166358630 19:42242380-42242402 CCTCCGCCGCCGGGCTCCGCGAA 0: 1
1: 0
2: 2
3: 26
4: 179
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358632_1166358637 5 Left 1166358632 19:42242386-42242408 CCGCCGGGCTCCGCGAACGAGCT 0: 1
1: 1
2: 0
3: 1
4: 30
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358628_1166358637 17 Left 1166358628 19:42242374-42242396 CCTCCGCCTCCGCCGCCGGGCTC 0: 1
1: 4
2: 33
3: 271
4: 1349
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358633_1166358637 2 Left 1166358633 19:42242389-42242411 CCGGGCTCCGCGAACGAGCTAGT 0: 1
1: 0
2: 0
3: 4
4: 8
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358629_1166358637 14 Left 1166358629 19:42242377-42242399 CCGCCTCCGCCGCCGGGCTCCGC 0: 1
1: 0
2: 7
3: 110
4: 696
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358622_1166358637 29 Left 1166358622 19:42242362-42242384 CCGCCGCCGCCTCCTCCGCCTCC 0: 4
1: 53
2: 380
3: 4810
4: 12637
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358634_1166358637 -5 Left 1166358634 19:42242396-42242418 CCGCGAACGAGCTAGTCCGCGCC 0: 1
1: 0
2: 0
3: 2
4: 5
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358624_1166358637 23 Left 1166358624 19:42242368-42242390 CCGCCTCCTCCGCCTCCGCCGCC 0: 4
1: 33
2: 332
3: 4649
4: 12376
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358626_1166358637 20 Left 1166358626 19:42242371-42242393 CCTCCTCCGCCTCCGCCGCCGGG 0: 1
1: 1
2: 80
3: 570
4: 3129
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218
1166358623_1166358637 26 Left 1166358623 19:42242365-42242387 CCGCCGCCTCCTCCGCCTCCGCC 0: 4
1: 30
2: 266
3: 4744
4: 12532
Right 1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166358637 Original CRISPR GCGCCCTGCCCGAGCCCCCA GGG Exonic
900594497 1:3474576-3474598 GGGCCCTGCAGGAGCCCCCTGGG + Intronic
900622445 1:3593548-3593570 GCTGCCAGCCCGAGTCCCCAGGG - Intronic
901022248 1:6261269-6261291 GCGGCCGGCCCGAGCCTCCCTGG + Intergenic
901102067 1:6726556-6726578 GAGCCCTGCCCGGGCCACCCTGG + Intergenic
902078519 1:13805545-13805567 GGGCCCTCACCCAGCCCCCAGGG + Intronic
902261715 1:15230156-15230178 GCGCCCTGACCCAGGCCCCCAGG - Intergenic
902334889 1:15749181-15749203 GAGCCCAGCTCCAGCCCCCAGGG + Intergenic
902548842 1:17207501-17207523 GCGCACTGCCAGGGCACCCACGG - Intronic
903140504 1:21336010-21336032 TAGCCCTGCCCCTGCCCCCAGGG - Intronic
904772101 1:32886346-32886368 GCGCCGCTCCCCAGCCCCCAGGG + Intronic
905202158 1:36322611-36322633 GCGCCCCGCCCGCGGCCCCGGGG - Exonic
905493216 1:38361709-38361731 GCCCCCGCCTCGAGCCCCCAGGG + Intergenic
908951404 1:69567470-69567492 CCGCGCTGCCCGAGCGCCCGGGG + Intergenic
910334480 1:86111596-86111618 GCAGGCTGCCCGAGCCCACAGGG + Intronic
912369358 1:109161758-109161780 GCTCCCTGCCCGGGGTCCCAGGG + Intronic
914260781 1:145997275-145997297 GCCCCCAGCCCTAGCCCCAAGGG - Intergenic
917433956 1:175000162-175000184 TCGGCCTGACCCAGCCCCCATGG + Exonic
917666228 1:177228460-177228482 GCCCCCTGCCAGAGTCCCCCAGG - Intronic
919925484 1:202189812-202189834 TCTACCTGCCAGAGCCCCCAGGG + Intergenic
922453536 1:225755926-225755948 GCCCCCTGCCCCAGCATCCAGGG + Intergenic
924561267 1:245157304-245157326 GTGACTGGCCCGAGCCCCCAGGG + Intronic
1062938679 10:1406273-1406295 GCTCCCTGCCTGAGCCCCTGGGG - Intronic
1064899209 10:20275481-20275503 GTGCGCTCCCCGAGCCCTCATGG - Intronic
1067477794 10:46578099-46578121 GCGCCCTGGTCGCGCCCCTATGG - Intergenic
1067616945 10:47763688-47763710 GCGCCCTGGTCGCGCCCCTATGG + Intergenic
1070439525 10:76429768-76429790 GGCCCCTGCCCAGGCCCCCATGG - Intronic
1070785577 10:79160383-79160405 GAGCCCAGCACCAGCCCCCACGG + Intronic
1070824447 10:79382608-79382630 GCCCGCTGCCACAGCCCCCAGGG + Exonic
1072027608 10:91476886-91476908 GCGCCCGGCCCGGACCCGCAGGG - Intronic
1072654453 10:97320230-97320252 GCGCCCTCCCGGAGGCGCCAGGG - Exonic
1073206842 10:101774202-101774224 GAGCCCTGCCCCAGCCGCCTGGG + Intronic
1073250373 10:102117532-102117554 GCCCCCTGCCCGGGCCCCTGGGG + Intronic
1074527972 10:114278081-114278103 GAGCCCTCCCCGACCCCACATGG - Intronic
1075777343 10:124997348-124997370 GGGACCTCCTCGAGCCCCCATGG + Intronic
1076587529 10:131559705-131559727 GCTCCATGCCTGGGCCCCCAGGG - Intergenic
1076612656 10:131736483-131736505 GCCCCCACCCCGAGCACCCAGGG + Intergenic
1076630590 10:131849745-131849767 GGGCCCGGCCCGACACCCCAGGG - Intergenic
1076719035 10:132384916-132384938 GCACCCTGCTAGAGACCCCAGGG - Intergenic
1077051723 11:569567-569589 GCCCCCTGCCCCAGCCCCGGCGG + Intergenic
1077064661 11:635754-635776 GCGCCCAGCCGGAGACCCCAGGG + Intergenic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1077417652 11:2432370-2432392 GGGCCCAGCCCCTGCCCCCACGG + Intergenic
1082076779 11:47981016-47981038 GCCCCCCGCCCGAGCCCACCCGG - Intronic
1082099803 11:48163054-48163076 GCCCCATCCCCGAGCCCCCCTGG - Intronic
1082986054 11:59172240-59172262 GCGCGCGGCCCGAGCCCCGGCGG - Intronic
1083990268 11:66242364-66242386 GCCCCATGCCTGACCCCCCAGGG - Intronic
1084363623 11:68684435-68684457 GCACCCTCGCCGAGCCCCGAGGG - Intronic
1084387928 11:68855604-68855626 GCGCGCTGCGCGAGCACCCCCGG + Intergenic
1088999774 11:115042174-115042196 GCCCCCTGCCAGAGGCCCCTGGG + Intergenic
1089466618 11:118690002-118690024 GAGCCCTCCCCGTACCCCCAGGG - Intergenic
1090832283 11:130428016-130428038 TCGCCCGGCCGGAGCCCCCGAGG + Exonic
1090835100 11:130448526-130448548 GCTCGCTGCCGGAGCCTCCAGGG - Intergenic
1096465726 12:51847120-51847142 CCGCTGTGCCTGAGCCCCCAAGG - Intergenic
1097107754 12:56635280-56635302 GAGCTCTGCCCGCGCTCCCAGGG + Intronic
1100461192 12:94800838-94800860 GCGACTTGCCCGAGATCCCATGG - Intergenic
1100611576 12:96195033-96195055 GGGCCCTGGGCGAGCTCCCAGGG - Intronic
1103610660 12:122122308-122122330 CCTCCCTGGCAGAGCCCCCAGGG - Intronic
1104065206 12:125300026-125300048 GCGCCCTGCGTGGGCCGCCACGG + Intronic
1104860601 12:131921468-131921490 GAGCCCTGCCCTGGGCCCCACGG + Exonic
1104981416 12:132574571-132574593 GCGCCCTGCCCCAGCCCAGGTGG - Intronic
1112461473 13:99606838-99606860 GCGGCCTCCCCAAGCCCTCACGG + Intronic
1112749868 13:102571246-102571268 GTGTCCTACCAGAGCCCCCAGGG - Intergenic
1118464934 14:66022493-66022515 GCCCCCTTCCTGGGCCCCCAAGG + Intergenic
1119535608 14:75400409-75400431 GCACCCTCCCCCTGCCCCCAGGG + Intergenic
1119894048 14:78205065-78205087 GCCCGCTGCCCCAGCCCACAGGG + Intergenic
1121423709 14:93833420-93833442 GGGCCCTGCACAGGCCCCCATGG - Intergenic
1121430168 14:93880851-93880873 GCATCCTGCCAGAGGCCCCAGGG - Intergenic
1122938556 14:104970993-104971015 GCCACCTGCCTGAGCCCCCAGGG + Intronic
1128984086 15:72206696-72206718 GGGGCCTGCCCCATCCCCCAGGG - Intronic
1129117734 15:73374692-73374714 GTGCCCTGGCAGAGTCCCCAGGG - Intergenic
1129523553 15:76200422-76200444 GGGACCTGCTTGAGCCCCCATGG + Intronic
1129694017 15:77730463-77730485 GTGCACTGCCCGAGCCCCTGAGG - Intronic
1129970620 15:79774913-79774935 GTGCCCTGCCCCTGCCTCCAAGG + Intergenic
1131056313 15:89377439-89377461 GCTCCCAGCCCCAGCCCCCTGGG - Intergenic
1132284737 15:100654654-100654676 TCTCCCTCCCTGAGCCCCCATGG + Intergenic
1132669247 16:1095966-1095988 GAGGCCTGCAGGAGCCCCCACGG + Intronic
1132999458 16:2841711-2841733 GGGGCCTGCCCGAAGCCCCATGG + Intergenic
1133304681 16:4801729-4801751 AGACCCTGCCCAAGCCCCCAGGG + Intronic
1135406128 16:22199274-22199296 TCCCCCTCCCCGAGCCCGCAAGG - Intergenic
1138584766 16:57962650-57962672 GAGACCTGCCCCAGCCCCCTGGG + Intronic
1141438892 16:84016652-84016674 GCGCCCTGGCCGACCCCTCAGGG - Exonic
1141640216 16:85336479-85336501 GTGTCCTACCCGAGCCACCAAGG - Intergenic
1141916540 16:87101056-87101078 GCTCCCTGCTTGAGCCCCAAGGG - Intronic
1142203225 16:88770875-88770897 GCTCCTCGCCCAAGCCCCCAGGG - Intronic
1143496366 17:7315060-7315082 GCCCACGGCCCGAGCGCCCACGG - Exonic
1143515259 17:7416366-7416388 CCCCCCTGCCCGACCCCCCTAGG + Intronic
1143906897 17:10216336-10216358 CCTCACTGCCCCAGCCCCCACGG + Intergenic
1144062816 17:11598812-11598834 GCACCGGGCCCGAGCCTCCAGGG + Exonic
1144833430 17:18144181-18144203 CAGCCCTGCCCGAGCCCCTGAGG - Intronic
1145925612 17:28644801-28644823 GCGCGTGGCCCGAGCTCCCAGGG - Intronic
1146281762 17:31549610-31549632 CAACCCCGCCCGAGCCCCCACGG + Intergenic
1146594558 17:34157362-34157384 CCGCCCTGCCCTTCCCCCCAAGG - Intronic
1148558836 17:48594471-48594493 GCGCCCAGGCCGAGCCGGCAGGG + Intronic
1148865929 17:50628588-50628610 GCCCCCTCCCCTCGCCCCCAGGG + Intergenic
1148870764 17:50657733-50657755 GCGACCCGCCCGAGCCCACATGG - Intronic
1149660665 17:58332602-58332624 GCGCCCCGCCCCCGCCCGCAGGG + Intergenic
1151370709 17:73644775-73644797 GCGCCCGGCCCCAGCGCCCCCGG - Intergenic
1152204739 17:78968477-78968499 GCGCCCTGCTCAGGGCCCCATGG - Intergenic
1152556439 17:81055411-81055433 GCACCCTGCAGGGGCCCCCATGG + Intronic
1152640425 17:81447147-81447169 GGGCCCAGCCTGAGCCCACAAGG + Exonic
1153703749 18:7723773-7723795 TCTCCCAGCCCGCGCCCCCAGGG - Intronic
1160425105 18:78773905-78773927 GTGCCCAGCCCCAGCCCCCACGG + Intergenic
1160745569 19:709451-709473 GCGCCCCGCCCGCGTCTCCAGGG + Intronic
1160747372 19:718521-718543 GGACCCTGCCCGGGCCCTCAGGG - Intronic
1160874158 19:1289605-1289627 GCGCCCACCCAGTGCCCCCAAGG - Intronic
1161136853 19:2625014-2625036 GCACAGGGCCCGAGCCCCCAGGG - Intronic
1161216769 19:3098618-3098640 CCGGCCTGCGCCAGCCCCCACGG + Intronic
1161513578 19:4684612-4684634 GCTCCCTTCCCGAGACCCAAAGG + Intronic
1161894476 19:7069841-7069863 GCGCACAGCCCGAGGCCTCAGGG - Intronic
1162494441 19:11015511-11015533 GCACCTTGCCCGAGACACCAAGG - Intronic
1163630035 19:18413609-18413631 GGGCCCTTCCCCAGCTCCCATGG - Intergenic
1164630389 19:29758069-29758091 AAGCCCTGCCCTAGGCCCCAGGG + Intergenic
1165829712 19:38724355-38724377 CCGTCCTGCCCCAGCCCCTACGG - Intronic
1166358637 19:42242414-42242436 GCGCCCTGCCCGAGCCCCCAGGG + Exonic
1167792299 19:51689866-51689888 GCGAGCTGCCCGAGCCCTCGGGG + Intergenic
925339375 2:3125735-3125757 GGGCCCTGCCTCAGCCCCCTGGG + Intergenic
926696417 2:15772410-15772432 CCCCCCTGCCCCAGCCCCTAAGG - Intergenic
927552143 2:24010105-24010127 GCCCCCTGCACCAGCCGCCAAGG + Exonic
931759833 2:65406871-65406893 GAGCCCTGCCTGAGCCTCCAAGG - Intronic
932562804 2:72887674-72887696 GCGCCCTGCGCGAGCTCCCCCGG + Exonic
934665093 2:96164216-96164238 GGGCCCTGCCTGAGGCCACATGG - Intergenic
934861277 2:97765285-97765307 ACGCCCTACCCGAGCCTCCAAGG + Intronic
937214550 2:120303338-120303360 GCGCTCTATCAGAGCCCCCAGGG + Intergenic
938397522 2:130962453-130962475 GCCCACTGCCCCAGCCCCCTGGG + Intronic
940852656 2:158703039-158703061 GAGCCCTGCCCTAGCCCTCCAGG - Intergenic
941979035 2:171434559-171434581 GGGCCCGGCCCGCGCCTCCATGG + Exonic
943111189 2:183608116-183608138 TCGGCCTGACCCAGCCCCCATGG - Intergenic
945080877 2:206085527-206085549 GCGCCCTGCCCCCGCACCCCGGG - Intronic
945314821 2:208360335-208360357 GCGGCCTCCCCGAGCCCCTCGGG + Intronic
945673761 2:212832133-212832155 GCGCCCTGCCTCCGCCGCCATGG + Intergenic
1169262707 20:4149513-4149535 TCACCCTGCCCGGGGCCCCAAGG - Intronic
1169471269 20:5887630-5887652 GTGCCCTGCCCATGCCCCCTCGG - Intergenic
1170032814 20:11959989-11960011 GCACCCTGCCCAGACCCCCAGGG - Intergenic
1171208809 20:23301492-23301514 GAGCCCTGGCTGAGCTCCCACGG - Intergenic
1172663901 20:36586063-36586085 GTGTCCTGGCCTAGCCCCCAGGG + Intronic
1173644685 20:44626046-44626068 GCCCCCTGCCTGGGCCCCCATGG - Intronic
1175562150 20:59939781-59939803 GCGCGCGGCCCGGGCTCCCAGGG + Exonic
1175972176 20:62692158-62692180 GCCCCATTCCCGAGGCCCCAGGG - Intergenic
1176380793 21:6111316-6111338 GCGCCCGCGCGGAGCCCCCACGG - Intronic
1177871032 21:26573083-26573105 GCGCCCGGCCCGGGCTCCCTTGG - Exonic
1179742679 21:43426924-43426946 GCGCCCGCGCGGAGCCCCCACGG + Intronic
1179965325 21:44801621-44801643 GCTCCCTGCCCCAGCCCCGCCGG + Intronic
1180049204 21:45323766-45323788 GGGCCCTCCCCAAGCCCCCGCGG + Intergenic
1180062236 21:45391387-45391409 GCACCCTGCCCGTGCCACCAGGG - Intergenic
1180958674 22:19752351-19752373 GCTCCCTGGCCAAGCCCCCAAGG - Intergenic
1180977425 22:19855872-19855894 GCTGCCTGCCCGTGGCCCCAAGG - Intergenic
1180994737 22:19959853-19959875 GAGCACTTCCCCAGCCCCCATGG + Intronic
1181277565 22:21696210-21696232 GTGCCCTGCCTGAGCTCTCAGGG + Intronic
1181851522 22:25753100-25753122 GCGCGCGGCCAGAGCCTCCACGG + Intronic
1182080064 22:27522533-27522555 CCTCCCTTCCCGAGTCCCCACGG - Intergenic
1182296901 22:29315330-29315352 GCGCCCTGCCCGGTGCGCCACGG + Exonic
1184127765 22:42500286-42500308 CCGCCCTGCCAGAGCCCCGGCGG - Intergenic
1184136639 22:42553822-42553844 CCGCCCTGCCCGAGCCCCGGCGG - Intronic
1184422944 22:44392325-44392347 ACACCCTGCCTGTGCCCCCATGG - Intergenic
1184472764 22:44704951-44704973 GCTCCCTGCCAGGGCCCCCTAGG + Intronic
1184651037 22:45919570-45919592 GTGCCCAGCCCGGGCACCCACGG - Intergenic
1184670042 22:46007597-46007619 GAGGCCTGCCCTTGCCCCCAGGG + Intergenic
949480898 3:4493207-4493229 GGGCCCAGCCCGGGCGCCCAGGG + Intergenic
961340423 3:126213522-126213544 GCGCGCTGCCCGGGCCCCGCAGG + Intergenic
961372778 3:126441451-126441473 CCTCCCTGCCCGAGGCCCCCAGG - Intronic
965449164 3:168816197-168816219 GGGCACTGCCAGAGCCCCCCAGG + Intergenic
966378675 3:179322827-179322849 GAGCCCCTCCCGAGCCCCGAGGG - Intergenic
967989434 3:195120286-195120308 CCCCCCCGCCCCAGCCCCCATGG + Intronic
968462813 4:733794-733816 GTGCCCTGCCCGCGCCACCCAGG + Intronic
968513019 4:1003562-1003584 GCGCCCTGCCCCTGACCCAAGGG + Exonic
968640491 4:1712185-1712207 GCGCCCGGCCCGTGCTGCCATGG - Exonic
968967340 4:3775772-3775794 CCGTCCTCCCCGTGCCCCCAAGG - Intergenic
969267465 4:6073980-6074002 GCCCCCTACCCCAGTCCCCAGGG + Intronic
969425465 4:7121506-7121528 GCAGCCTTCCCGAGCCCCCGAGG + Intergenic
971264772 4:25087995-25088017 GCGACCTGCCCAGGCCCACAAGG - Intergenic
972290417 4:37686033-37686055 GCGCCCTGCCCGGACCGCCGCGG + Intronic
973246583 4:48016718-48016740 GCGCCCTGACCCCGCCCCCGGGG - Intronic
978206194 4:106083448-106083470 GCCACCTCCCCGATCCCCCAGGG - Intronic
978769618 4:112441229-112441251 CGGCCCTGCCCAAGCCCCAAAGG - Exonic
984102217 4:175499739-175499761 GGGACCTGCCCAGGCCCCCAAGG + Intergenic
985035726 4:185838340-185838362 GTGGCCTGCCCAAGCCCCCAGGG - Intronic
985589191 5:755935-755957 CCGCCCTCGCCGAGGCCCCAAGG - Intronic
985603870 5:848451-848473 CCGCCCTCGCCGAGGCCCCAAGG - Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990407966 5:55510995-55511017 GCTCTCTTTCCGAGCCCCCATGG + Intronic
999730469 5:154473486-154473508 GTACCCGGCCCGAGGCCCCAGGG - Intergenic
1001412413 5:171520540-171520562 AGGCCCTGCCCAAGGCCCCATGG - Intergenic
1002020482 5:176361318-176361340 CAGCCCAGCCCGAGCCCCCGCGG - Intronic
1002305722 5:178281510-178281532 GCGCCGTGCCCAAGCCCCTCTGG - Intronic
1002497172 5:179623359-179623381 GCTCTCGGCCCGGGCCCCCACGG - Exonic
1003074417 6:2971168-2971190 GCGCCCAGGCCCAGCGCCCACGG - Intronic
1003174768 6:3746413-3746435 GTGCCCTGCCAGGGCTCCCATGG - Intronic
1003862918 6:10338181-10338203 GCACGCTGCCCGAGCCAGCATGG + Intergenic
1003893521 6:10584978-10585000 GTGTCCTGCCTGTGCCCCCAAGG + Intronic
1005255715 6:24000980-24001002 GCCTCCTGCCCCAGCCCCCCAGG + Intergenic
1006093536 6:31642191-31642213 GCTGCCAGCCCGAGCCCCCAGGG + Exonic
1006377408 6:33679206-33679228 GGTCCCTGCCCGTGCCCCCCAGG - Intronic
1007518132 6:42429644-42429666 GGGGCCCTCCCGAGCCCCCAAGG + Intronic
1013272473 6:108557756-108557778 GCGCGCTGCCCGAGCCGCGGCGG - Intergenic
1018954874 6:168402698-168402720 GAACCCTGCCCCAGCCCACAGGG + Intergenic
1019512096 7:1422731-1422753 GCCCCCTGCCCCAGCCCTGATGG + Intergenic
1020059916 7:5144273-5144295 GTGCCCTGCGCGAGCTTCCAGGG + Intergenic
1021717776 7:23474628-23474650 GCCCCCAGCCCCAACCCCCAAGG + Intergenic
1022606863 7:31823976-31823998 GCCCCCTGCCAGAGTCCCCATGG - Intronic
1023243774 7:38178549-38178571 GAGTCCTGCGCGAGCCTCCAGGG + Intronic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1027232636 7:76281661-76281683 GCCCCCGGCCCGCGCCCCCCCGG + Exonic
1029539307 7:101173429-101173451 ACGCCCTTCCCGCGCTCCCAGGG + Exonic
1035282218 7:157785421-157785443 GAGCCCTGCCCCAGGCTCCAAGG - Intronic
1035675005 8:1450162-1450184 GAGCTCTGCCCGAGGCACCAGGG - Intergenic
1036651815 8:10649036-10649058 GCGCCATGCCTGAGCCCAGATGG + Intronic
1037826114 8:22161633-22161655 GCCCCCTGTGAGAGCCCCCAAGG - Exonic
1037969784 8:23163882-23163904 GCGCCCTGCTCGAGCGCTCGAGG + Exonic
1037991507 8:23324439-23324461 CCACCCTGCCCAACCCCCCACGG - Intronic
1038645395 8:29357269-29357291 CCCACCTGCCCGAGCACCCACGG + Intergenic
1047615296 8:126558051-126558073 GAGCCCTTCCCCAGGCCCCACGG - Exonic
1048428257 8:134342653-134342675 GTGCCCTGCCCGAGTTCCCTGGG + Intergenic
1049586461 8:143434739-143434761 GGGCCCTACACCAGCCCCCATGG - Intergenic
1049673036 8:143878138-143878160 GCGCCGGCCCCGAGCCCTCACGG - Intronic
1049774137 8:144396948-144396970 TGGCCCTGCCCGTTCCCCCATGG - Intronic
1049785766 8:144450001-144450023 GCGCCCCGCCGGAACCCGCAGGG + Exonic
1056557660 9:87703224-87703246 GCCCCCTGCCTGGGCTCCCAGGG - Intronic
1057076108 9:92138992-92139014 TCTACCTGCCAGAGCCCCCAGGG + Intergenic
1057152591 9:92808496-92808518 GCGCCCAGCCTGAGGCCCCCAGG - Intergenic
1057432064 9:95004424-95004446 GCGCCCTGGCCTCGCCCCCCGGG + Intronic
1058618743 9:106862318-106862340 GCGCCGAGCCCGAGCCCCAGAGG - Intergenic
1059176630 9:112174864-112174886 GCGGCCTGGCCGGGCCCCCAGGG - Intronic
1060090330 9:120737139-120737161 GCCCCCTTCCCCTGCCCCCAAGG + Intergenic
1060986107 9:127819823-127819845 GTGCCCTCCCTGATCCCCCAGGG - Intronic
1061183104 9:129036690-129036712 CGGCCCCGGCCGAGCCCCCAAGG + Intronic
1062291676 9:135798092-135798114 GCGCTGTGGCCAAGCCCCCAAGG - Intergenic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1062549050 9:137077695-137077717 GAGGCCTGCGCGCGCCCCCACGG + Exonic
1185643489 X:1600976-1600998 GCCCCCGGCCGGTGCCCCCAAGG + Exonic
1187268090 X:17755595-17755617 GGGCCCTGACCGAGGCTCCAGGG + Intergenic
1188003589 X:25002869-25002891 GGGCCCTGCCCGCGCCCCTCCGG - Intergenic
1190872442 X:54435580-54435602 GAGGCCTGCCACAGCCCCCAGGG + Intergenic
1199772584 X:150983999-150984021 GCGGCCGGCCCGCGCCCCCCCGG - Intronic
1200251385 X:154556094-154556116 GGGCCCTGCCTGGGCCCACATGG - Intronic
1200266382 X:154648322-154648344 GGGCCCTGCCTGGGCCCACATGG + Intergenic