ID: 1166359265

View in Genome Browser
Species Human (GRCh38)
Location 19:42245887-42245909
Sequence AGGATCTCAGAGGATATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166359260_1166359265 16 Left 1166359260 19:42245848-42245870 CCTTGAGAGCATCTGTAAAGGGC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1166359265 19:42245887-42245909 AGGATCTCAGAGGATATGGATGG 0: 1
1: 0
2: 1
3: 18
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166359265 Original CRISPR AGGATCTCAGAGGATATGGA TGG Intronic
902116082 1:14122473-14122495 AGAATCTCAGAGGATTGTGATGG - Intergenic
902190512 1:14759815-14759837 GGGATCTAAGAGGATCTGGACGG - Intronic
902699302 1:18160868-18160890 AGGACCACAGAGGGTATGGAGGG + Intronic
902730660 1:18366635-18366657 AGGAACACATAGGACATGGAAGG + Intronic
902886696 1:19410251-19410273 AGGATGCCAGGGGAGATGGAGGG + Intronic
903804708 1:25997007-25997029 AGGAGCCCAGAGGGAATGGATGG + Intronic
904894478 1:33803906-33803928 AAGATCTCAGAGTAGATGAAAGG - Intronic
906026248 1:42676517-42676539 AGCACCTCAGAGGAACTGGAAGG - Intronic
907111200 1:51928066-51928088 AGGAACTTTGAGGATATGGAAGG + Intronic
907491810 1:54813426-54813448 AGGAGCACAGAGGATTTGGACGG - Intronic
908597310 1:65702226-65702248 ATGTTTACAGAGGATATGGAAGG + Intergenic
909664111 1:78114665-78114687 AGGAGCTCAGAGGATTTTTAGGG + Intronic
909870360 1:80731111-80731133 AGGATCTCAGTGGATAAGGTAGG + Intergenic
911516192 1:98871178-98871200 AGCAACTCAGTGGATAGGGAAGG - Intergenic
912273585 1:108233858-108233880 AGAATCTCACAGGACATGGTTGG + Intronic
912294635 1:108460464-108460486 AGAATCTCACAGGACATGGTTGG - Intronic
913554232 1:119948925-119948947 AGGTTATCAGATCATATGGAAGG - Intronic
915236122 1:154484065-154484087 AGCATCTCAGAGGACAAGGCTGG - Exonic
916285624 1:163101848-163101870 ATGATCTCAGAAGATGTGTATGG + Intergenic
916400743 1:164445958-164445980 AGATTCTCAGAGGATCTGGAGGG - Intergenic
917152850 1:171963393-171963415 TGGATCTCAGAGGATTTTTAGGG + Intronic
918958530 1:191240276-191240298 ATGATCTCAGGAGATATGTATGG + Intergenic
919114116 1:193259366-193259388 AGGAACACAGAAGAAATGGATGG + Intergenic
919398999 1:197085348-197085370 AGCAGCTCAGAGGGTATGGAGGG - Intronic
920312244 1:205055394-205055416 AGGGTGTCTGTGGATATGGATGG + Intronic
1065642555 10:27799374-27799396 AGGATGTCAGAGGAGAGAGAAGG + Intergenic
1068007363 10:51407255-51407277 ATGATCTCAGGGGATGTGCATGG - Intronic
1070295694 10:75159504-75159526 GGGATCTGAGGGGATATAGAAGG - Intronic
1070480510 10:76878133-76878155 CGGACCTCAGAGGCTAAGGAGGG + Intronic
1071387308 10:85134378-85134400 AGGCTCTCCTAGGATGTGGAAGG - Intergenic
1073791575 10:106945475-106945497 AGGAACTATGAGGATGTGGAAGG + Intronic
1074154274 10:110784599-110784621 AGTATCTCAGAGAATACTGATGG - Intronic
1074963646 10:118469993-118470015 TGGGTCTCAGAGGATGAGGAAGG - Intergenic
1075294571 10:121263002-121263024 ACGATCACAGAGCATGTGGAAGG + Intergenic
1075611721 10:123859985-123860007 AGGTGCACTGAGGATATGGACGG - Intronic
1076516060 10:131045037-131045059 AAGAGCTCAGAGGATCGGGAGGG + Intergenic
1076827799 10:132978408-132978430 AGGACATCGGATGATATGGAGGG + Intergenic
1077648159 11:3944978-3945000 GGGAAGTCAGAGAATATGGAGGG - Intronic
1078906465 11:15692598-15692620 AATAACTCAGAGGATAAGGAAGG - Intergenic
1080783759 11:35455377-35455399 TGTTTATCAGAGGATATGGAGGG - Intronic
1081102958 11:39027890-39027912 AGGACATCAAAGGATATGGGTGG + Intergenic
1081232565 11:40603792-40603814 AGCATCTAAGAGGAAATGAAAGG + Intronic
1081977048 11:47242341-47242363 TGGCTCTCAGAGGTCATGGATGG + Intronic
1084497842 11:69515396-69515418 AGGATCCCAGAGGGCATGGGCGG - Intergenic
1084720442 11:70902334-70902356 TGGATCTCAAAGGAAAGGGAGGG + Intronic
1085253784 11:75160535-75160557 AGGCTCCCAGAGGAGGTGGAGGG - Intronic
1085276824 11:75305998-75306020 TGGATCACAGAGGATGAGGAGGG - Intronic
1088848444 11:113686829-113686851 AAGATCTCAGAGCACCTGGATGG + Intergenic
1089295591 11:117465356-117465378 AGGATCTGAGAGGTAATGGGAGG - Intronic
1089450329 11:118590432-118590454 AGGATCTCAGATGACAAGTATGG + Exonic
1091045027 11:132317787-132317809 AGTGTCTTAGAGGATGTGGAAGG + Intronic
1093031507 12:14293309-14293331 ATGATCTCAGGGGATGTGTATGG - Intergenic
1093121367 12:15275466-15275488 AGGATCTCAGTAGATGTGAAAGG - Intronic
1093787385 12:23208200-23208222 AAGTTCTCTGAGGATAGGGATGG - Intergenic
1094378654 12:29818649-29818671 AGGAGGTCATAGGACATGGAAGG + Intergenic
1094763721 12:33565832-33565854 TGAATCTGTGAGGATATGGAAGG + Intergenic
1095514024 12:42985831-42985853 AAGATTTAAGAGGAAATGGAGGG + Intergenic
1097271750 12:57779767-57779789 TGCATCTTAGAGGATGTGGAAGG - Intronic
1097626329 12:62005388-62005410 AAGATCTCATTGGAAATGGAAGG - Intronic
1099716852 12:86305875-86305897 GCGATATCAGTGGATATGGAGGG + Intronic
1100886950 12:99082038-99082060 AAAATCTCAGAGGAAAGGGAAGG + Intronic
1101752683 12:107595597-107595619 AGAATCTAAGAGAATGTGGAAGG + Intronic
1103140046 12:118540601-118540623 GGAATCCCAGAGGATCTGGATGG + Intergenic
1103726054 12:122997848-122997870 AGGGGCACAGAGGACATGGAGGG + Intronic
1103743163 12:123105009-123105031 AGGAGGTCAGAGAATATTGAGGG - Intronic
1104546960 12:129721607-129721629 AGGTTCTCAGAGGAGATCAACGG - Intronic
1105013124 12:132769133-132769155 AGGCTCTCACAGGATCCGGAGGG - Exonic
1106186282 13:27412633-27412655 AGGATCTGAGAGGGTTTGGGTGG + Intergenic
1106786920 13:33116450-33116472 AGCATGGCAGAGCATATGGATGG - Intronic
1107520091 13:41171660-41171682 AATATCTCAGAGGATTAGGAAGG - Intergenic
1107884272 13:44861403-44861425 AGAAATACAGAGGATATGGAAGG + Intergenic
1108355844 13:49628219-49628241 AGGAGCTCAGAGGATCCTGAGGG + Intergenic
1110098279 13:71560270-71560292 AAGATCTCAGAGAATAAAGAAGG + Intronic
1110246313 13:73328168-73328190 AGGATATCAGAGCCTTTGGAGGG + Intergenic
1110859751 13:80334860-80334882 AGGAAGTCAGAGGAAATTGAAGG + Intergenic
1113747544 13:112755463-112755485 AGGCTCTGAGAGGACCTGGAGGG - Intronic
1115245289 14:31288129-31288151 AGGATGTCAGTGCATATAGAAGG - Intergenic
1115517442 14:34200008-34200030 AGGATCTCAAAGCATAAGAAAGG + Intronic
1119059412 14:71459884-71459906 ATGATCTCAGGAGATATGTATGG - Intronic
1119107259 14:71936542-71936564 ATGATCTCAGGAGATATGTATGG - Intronic
1119266282 14:73264779-73264801 GGGGTCTCAGTGGATAAGGAGGG + Intronic
1119774936 14:77242486-77242508 AGGAGCTCAGAGGAGAGGGGAGG - Intronic
1121165483 14:91792257-91792279 AGAATATTAGAGGATCTGGAAGG - Intronic
1123648904 15:22463332-22463354 AAGAACTCAGTGGATGTGGAAGG - Intronic
1123729432 15:23132353-23132375 AAGAACTCAGTGGATGTGGAAGG + Intronic
1123747600 15:23329835-23329857 AAGAACTCAGTGGATGTGGAAGG + Intergenic
1124279962 15:28353686-28353708 AAGAACTCAGTGGATGTGGAAGG + Intergenic
1124302737 15:28557925-28557947 AAGAACTCAGTGGATGTGGAAGG - Intergenic
1125555926 15:40584762-40584784 AGGATGACAGAGGACTTGGAGGG - Intergenic
1126474067 15:49047409-49047431 AGTATATCGGAGGATATGCATGG + Intergenic
1126515190 15:49525811-49525833 AGGATATCATATGATATTGAAGG + Intronic
1127762776 15:62155358-62155380 GGGATCCCAGAGGATAAGGTTGG + Intergenic
1130111239 15:80967359-80967381 AGGACCTCAGAGAATTTGTAAGG + Intronic
1130574714 15:85081648-85081670 AGGATCCCACAGGGCATGGAGGG - Intronic
1131931588 15:97448785-97448807 GGGACCTCAGAGACTATGGATGG + Intergenic
1134341670 16:13352515-13352537 AGGATCCCAGTGGAAATGTAAGG + Intergenic
1135194963 16:20386700-20386722 GGGATATCAGGGGATATCGAAGG - Intronic
1135730480 16:24890974-24890996 CGGATCTCGGAAAATATGGAAGG - Exonic
1135864079 16:26084561-26084583 AGGATCTCAGGAGATAAAGATGG - Intronic
1136036625 16:27545419-27545441 ATGATCTTAGAGAATAAGGATGG - Exonic
1137664406 16:50241197-50241219 GGAATCTCTGAGGATATGAATGG + Intergenic
1138239097 16:55412033-55412055 AGGCACTCAGGGGATATGGTGGG + Intronic
1140032925 16:71352788-71352810 AGGCTGTCAGGGGAAATGGAAGG + Intergenic
1140339462 16:74142488-74142510 AGGAACTCTCAGTATATGGAAGG + Intergenic
1141851821 16:86651329-86651351 GGGTCCTCAGAGGATATGGGAGG + Intergenic
1142960085 17:3547200-3547222 TGGATCTCAGAGTCTAGGGACGG - Intronic
1144652901 17:17018397-17018419 AGGATCTGAGCGTATGTGGAGGG - Intergenic
1146238322 17:31188528-31188550 ATGATCTCAGGAGATATGTATGG + Intronic
1146647451 17:34584611-34584633 AGGTGCTCAGAAGAAATGGATGG + Intronic
1148670915 17:49409344-49409366 AGGATCTCAGTTGTGATGGACGG + Exonic
1148887894 17:50786784-50786806 CGGATCTCAGAGGATGGGGTGGG - Intergenic
1149146676 17:53502012-53502034 AGGATCACAGAGGATTTTTAGGG - Intergenic
1149317085 17:55448721-55448743 AGTATTCCAGAGGATATGGTCGG + Intergenic
1149778038 17:59373450-59373472 AGGAGTTCAGAGAAGATGGATGG - Intronic
1150200401 17:63350317-63350339 AGGATCTCACAGGCTCTGAAAGG - Intronic
1150362105 17:64544969-64544991 AGCTTCTCAGAGCATGTGGATGG - Intronic
1151054966 17:71020346-71020368 AGGAATTCAGAGTATATGCAAGG - Intergenic
1151068277 17:71177796-71177818 TGGATCTCTCAGGATATGTAGGG + Intergenic
1151219915 17:72604744-72604766 ATGACCTCAGAGGACATGGCAGG + Intergenic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1153534502 18:6086562-6086584 AGGATCTGGGATGAGATGGAAGG - Intronic
1153660147 18:7318671-7318693 AGGATGTCAGATGACATGGATGG + Intergenic
1155242909 18:23880320-23880342 AGTATTTCAGAGCATGTGGAGGG - Intronic
1155466070 18:26136744-26136766 AAGATCTCTGAGGATCTAGATGG + Intronic
1156173751 18:34517616-34517638 AGGTTGTCAGAGGTTAGGGATGG - Intronic
1156376840 18:36522160-36522182 AGGATCTCACAGAACAAGGATGG - Intronic
1156998869 18:43500036-43500058 ATGATCTCAGGGGATGTGTATGG + Intergenic
1157183797 18:45520979-45521001 AGTATCTCAGAGGACCTGGTGGG - Intronic
1157805798 18:50656647-50656669 AGGCTCTTGGAGGATGTGGAAGG - Intronic
1158098270 18:53800110-53800132 AGGATATAGAAGGATATGGAAGG - Intergenic
1159349243 18:67250345-67250367 AGGCTCTCAGTGTTTATGGATGG + Intergenic
1161017612 19:1991044-1991066 AGGACCTCAGAGGCCAAGGAAGG + Intronic
1161089037 19:2351190-2351212 AGGGTCACCGAGGACATGGAAGG - Intronic
1162030020 19:7913303-7913325 AAGACCTCAGGGGATGTGGAGGG + Exonic
1162730227 19:12714249-12714271 AGGAGCTCAAAGGATGTGAAAGG - Intronic
1163323963 19:16591300-16591322 AGGATCTCAGAGGGACTGTAAGG + Intronic
1163466503 19:17470986-17471008 ATGATCTCAGGGGATTTGGGGGG + Intronic
1164683883 19:30153984-30154006 AGGAACTGAGAGGAGAAGGAAGG - Intergenic
1166359265 19:42245887-42245909 AGGATCTCAGAGGATATGGATGG + Intronic
1167451905 19:49575591-49575613 AGGAAGTCAGAGGATATAGCAGG + Intronic
924989552 2:300747-300769 AGCATCTAAGAGGATATGGGTGG - Intergenic
925118803 2:1401926-1401948 AGGATCTCTGAGTAAATGGCTGG - Intronic
925930968 2:8707647-8707669 AGGAACTCAGATAAGATGGATGG - Intergenic
926423965 2:12724672-12724694 AAGATCACAGAGGGTATCGAAGG - Intronic
926920496 2:17935346-17935368 AGGCCCCCAGAGGATAAGGATGG - Intronic
927311628 2:21638300-21638322 AGAATCTTAGTGGACATGGACGG - Intergenic
929532202 2:42760365-42760387 TGGATCTCAGAGGATGAGGAAGG - Intergenic
930006503 2:46901448-46901470 AGGGTCTCAGAGGGTACGGAGGG + Intergenic
930237734 2:48903894-48903916 AGTATATCAAAGGAAATGGAAGG - Intergenic
932186267 2:69698937-69698959 AGGATATAAGAGGATAAGGCAGG + Intronic
932706589 2:74030899-74030921 AGGACATCAGAGGGGATGGAAGG + Intronic
935043318 2:99455632-99455654 AGAGTCTCACAGGAAATGGAAGG + Intronic
936459062 2:112698084-112698106 AGGATTTCAGAGGACAGAGAAGG - Intergenic
936937700 2:117853990-117854012 AGGCTCCCCGAGGATATGGCTGG - Intergenic
936937712 2:117854042-117854064 AGGTTCCCCGAGGATATGGCTGG - Intergenic
936937724 2:117854094-117854116 AGGCTCCCCGAGGATATGGCTGG - Intergenic
937024080 2:118682934-118682956 AGGCTCGCAGAGAAGATGGATGG - Intergenic
937528039 2:122795275-122795297 AAGCTCCCAGAAGATATGGAAGG - Intergenic
939171671 2:138703283-138703305 AGACTCTCAGAGGGTATGTATGG - Intronic
939198076 2:138998253-138998275 AGGAGCTCAGAGTACAGGGAAGG + Intergenic
942081516 2:172403562-172403584 TGTGTGTCAGAGGATATGGATGG + Intergenic
942088921 2:172469221-172469243 AGGATTGAAGACGATATGGATGG + Exonic
944328537 2:198437599-198437621 AGGAACTCTGAGGATGGGGATGG + Intronic
945717542 2:213378359-213378381 ATGATCTCAGCAGATATGTATGG - Intronic
946510914 2:220355322-220355344 ATGTTCTCAGAAGTTATGGATGG - Intergenic
947181254 2:227413392-227413414 AGGAGCTCAGAGGAGAGGTACGG + Intergenic
947811519 2:233007313-233007335 ACGATCACAGAGTATTTGGAGGG + Intronic
1169194960 20:3678003-3678025 AGGGTCTCAGAGTCTTTGGAGGG + Intronic
1169687249 20:8289083-8289105 AGGATCTGAGGTGATCTGGATGG - Intronic
1171030539 20:21672530-21672552 AGGATCCCAGAGTATAAAGAGGG - Intergenic
1171150275 20:22821595-22821617 AGGCTCTCAGAGGATGAGCAAGG + Intergenic
1171485099 20:25480569-25480591 AGGGTCACGGAGGAAATGGAAGG + Intronic
1173049459 20:39545398-39545420 AGGATCTTAGAAGACATGCATGG + Intergenic
1175234819 20:57502602-57502624 AGGTTCTCAGAGGAAAGGAATGG + Intronic
1177237409 21:18410392-18410414 AGGATCCCAGTGGAGATGGGAGG - Intronic
1179109459 21:38433906-38433928 AGGAATTCAGAGGATTAGGAAGG - Intronic
1180052403 21:45337264-45337286 AGGAACTGTGAGGATAAGGAAGG + Intergenic
1180290170 22:10842436-10842458 AGGATGTCAGAGCATAAGAAGGG - Intergenic
1180492968 22:15871858-15871880 AGGATGTCAGAGCATAAGAAGGG - Intergenic
1181373431 22:22436864-22436886 ATGATCTCAGAAGATATATATGG - Intergenic
1182681684 22:32084559-32084581 GGGATCTCGGAAGATGTGGAAGG - Exonic
1182700663 22:32234951-32234973 AGCATCTCGGAAGATGTGGAAGG + Exonic
1183081524 22:35459584-35459606 AGGCTCTGAGAGGTTAAGGAAGG + Intergenic
1183316339 22:37139045-37139067 AAGATCCCAGAGGAGGTGGAAGG + Intronic
1183429027 22:37754728-37754750 AGGCTCAGAGAGGAAATGGAGGG + Intronic
1184802702 22:46771517-46771539 AGGGACTCAGAGGAAAAGGATGG - Intronic
949246220 3:1927693-1927715 ATGATCTCAGGGGATGTGTATGG - Intergenic
949548613 3:5093842-5093864 ATGATCTCAAGGGATATAGATGG + Intergenic
950915804 3:16644240-16644262 AGGTACTCACAGGATATGCATGG - Intronic
951291635 3:20877800-20877822 ATGATCTCAGGAGATATGTATGG + Intergenic
951381970 3:21995426-21995448 AGGATCTCAGATGACATGCTTGG + Intronic
952822394 3:37496479-37496501 AGGGTGGCAGAGGATGTGGAGGG - Intronic
953221777 3:40978218-40978240 AGGCTGTCAAAGGAGATGGAAGG - Intergenic
953251589 3:41249349-41249371 AGGATCTCAGTGGACAGTGATGG + Intronic
954093462 3:48303054-48303076 AAGCTCTCAGAGGACATGGGTGG + Intergenic
954335768 3:49916523-49916545 AGGACCGCAGAGCACATGGAGGG + Exonic
954920834 3:54189490-54189512 TAGATCTCAAAGGACATGGAAGG - Intronic
955046281 3:55363415-55363437 AGCATTTCAGAGGAAATAGAAGG - Intergenic
955755082 3:62218084-62218106 AGGATCTCTGGGGATCTGGGTGG + Intronic
955771803 3:62392096-62392118 ATGATCTCTGAGAATAAGGAGGG - Intergenic
956027210 3:64995976-64995998 TGAATCTCTGAGGATGTGGACGG + Intergenic
956514696 3:70033883-70033905 AGGATGTCAGAGGATGGGGAAGG + Intergenic
956551016 3:70460131-70460153 AGGCTGTCAGAAGATATGCATGG - Intergenic
956723288 3:72136864-72136886 AGGTTCTCTAAGGCTATGGATGG + Intergenic
957244782 3:77702938-77702960 AGGAACTCAGAGTCTATTGATGG - Intergenic
959437290 3:106331923-106331945 AGCATCTCAGTAGATATGTAAGG - Intergenic
959615397 3:108341832-108341854 AGGATGACAGAGCAGATGGATGG - Intronic
960636750 3:119792177-119792199 AGGATCTCAGTAGTGATGGATGG - Intronic
961542426 3:127609056-127609078 ATGCTGTGAGAGGATATGGAGGG + Intronic
963331520 3:143921088-143921110 ATGATCTCAGAAGATGTGTATGG - Intergenic
963509289 3:146226925-146226947 AGCAGCTCAAAGGAGATGGAAGG - Intronic
964661977 3:159130089-159130111 AGGTTCCCAGAGGTTAGGGATGG - Intronic
965577739 3:170235255-170235277 AGGCCCTCAAAGGAGATGGAAGG - Exonic
966510285 3:180754718-180754740 AGGCACTAAGAGGAAATGGAGGG + Intronic
967268272 3:187711158-187711180 AGGATCTAAGGGAATATGGGTGG + Intronic
968554096 4:1238637-1238659 AGGGTCTCAGAGGGTCTGGGAGG - Intronic
970014201 4:11494680-11494702 AGGATCTGAAAGAATCTGGAAGG - Intergenic
971031013 4:22636796-22636818 AGAATGTCAGAGGATGTGCAAGG - Intergenic
971363698 4:25959284-25959306 AGGACATCAGAGGATTTGGGGGG - Intergenic
971752770 4:30672393-30672415 AGGAGCACAGAGGATATTTAGGG + Intergenic
975423072 4:74191876-74191898 AGGATGTTAGAGGATATGGAAGG + Intronic
978431578 4:108638759-108638781 AGGATGTCAGAGGGAAGGGAAGG - Intergenic
980628885 4:135408785-135408807 AGGATCGCTGAGTATATTGATGG - Intergenic
980719243 4:136672124-136672146 AGGAGCTGAGATGATATGCATGG + Intergenic
980863665 4:138529387-138529409 TGGGTCTCAGAGGATGTGGGTGG - Intergenic
983027691 4:162757592-162757614 ATGATCTCAGGAGATATGTATGG + Intergenic
986010771 5:3713044-3713066 AATATCCCAGGGGATATGGAAGG - Intergenic
987999006 5:25326071-25326093 AAGAACTCTGAGGATATGCAAGG + Intergenic
989089466 5:37714910-37714932 AAGTTCTCAGAGAAAATGGAAGG - Intronic
993306986 5:86286230-86286252 AGAATCTCATAGGACATGGTTGG - Intergenic
996168552 5:120259417-120259439 AGGATCTTAGAGTTTGTGGAAGG + Intergenic
1000576438 5:162980983-162981005 AAGCTCTTAGAGGATATAGATGG + Intergenic
1001289203 5:170444488-170444510 AGGGTCACAGAGGTTGTGGATGG - Intronic
1001907230 5:175482983-175483005 AGGCCTTCAGTGGATATGGAAGG + Intronic
1003940550 6:11021138-11021160 AGGACATCTGAGGATTTGGAAGG - Intronic
1004774412 6:18826796-18826818 AGGATTTGAGAGGAAATGCAGGG - Intergenic
1005185457 6:23159368-23159390 ATGATCTCAGGAGATATGTATGG + Intergenic
1006937128 6:37726272-37726294 AGGATCAGAGAGTAAATGGATGG - Intergenic
1007745533 6:44040910-44040932 AGGGTCTGAGGGGATTTGGAGGG - Intergenic
1007826989 6:44607951-44607973 AGATTCTCAGAGGAATTGGAAGG - Intergenic
1008284623 6:49632969-49632991 AGTATCTCAGGGGATATTCATGG + Intronic
1008628153 6:53337792-53337814 AGGATCTGACATGCTATGGAAGG + Intronic
1009515318 6:64608920-64608942 AGGATCACAGAGGATTTTTAGGG + Intronic
1011055449 6:83199123-83199145 AGGTTCTGAGAGGGGATGGATGG - Intergenic
1011167386 6:84464275-84464297 AGGATGTAAGAGGTTATGCATGG + Intergenic
1012848871 6:104423901-104423923 AGAATGTAAGAGGATATGCAGGG - Intergenic
1013323516 6:109020645-109020667 AGGTTTTCAGAGGATTTAGAAGG + Intronic
1014488469 6:122031544-122031566 AGGTTGCCAGAGGTTATGGATGG - Intergenic
1015208885 6:130672817-130672839 AAGATCTCAGAGGCTGAGGAGGG - Intergenic
1017119874 6:151014236-151014258 AGAATCCGAGAGGAAATGGATGG + Intronic
1017464164 6:154679077-154679099 AGGATCTGAGAAGATCTAGAAGG + Intergenic
1019135936 6:169907742-169907764 AGGCTCTCAGAGGGTATTGGCGG + Intergenic
1019849438 7:3539545-3539567 TGGAGCTCAGTGGAGATGGATGG + Intronic
1019870051 7:3751805-3751827 CGGTCCTCAGAGGAAATGGAAGG - Intronic
1020263596 7:6545723-6545745 AGGCACTCAGAGAATGTGGATGG + Intronic
1021638408 7:22714004-22714026 AGAATCTCAGAGGATTTAAACGG + Intergenic
1022489157 7:30803506-30803528 AGGAGCTTAGAGGAGAGGGAGGG + Intronic
1023283829 7:38597929-38597951 ATGTTCTCAGAGGATAAGGGTGG - Intronic
1023636994 7:42222058-42222080 AGGCTCTCAGCAGACATGGAGGG + Intronic
1023750816 7:43370855-43370877 AGGATCACAGAGGATTTTTAGGG + Intronic
1024510664 7:50202137-50202159 AGGATGTCAGAGAAAAAGGATGG - Intergenic
1024525925 7:50349459-50349481 AGGATTTTAGAAGAGATGGATGG + Intronic
1028572327 7:92304467-92304489 AGAATGTCAGCTGATATGGAAGG - Intronic
1028572734 7:92309423-92309445 AGAATCTCCTAGGATTTGGAGGG + Intronic
1030457179 7:109790688-109790710 ACGATCTCAGAAGATGTGTACGG - Intergenic
1030825661 7:114154833-114154855 AGAATCTCAGAGGGTATAAATGG - Intronic
1032338665 7:131050170-131050192 AGGAGATGAGAGGATATGGATGG - Intergenic
1032860204 7:135870617-135870639 AGAATCTCAGGGGATGGGGAAGG - Intergenic
1035950348 8:4013192-4013214 AGGATCCCAGAGGATAGGAGTGG - Intronic
1036091085 8:5666076-5666098 TGGATGTGAGAGGAAATGGAGGG + Intergenic
1036462764 8:8968299-8968321 TGGATCTCAGAGGATTTTTAGGG - Intergenic
1037408857 8:18572652-18572674 AGGAGCCCAGAGGAAATGCAAGG - Exonic
1038688185 8:29737738-29737760 AGGATTTCTGAGGGTATGAAAGG - Intergenic
1039330637 8:36533220-36533242 ATGATCTCAGAAGATGTGTATGG + Intergenic
1040594808 8:48826971-48826993 AGGATGTCAGAGGATACAGTGGG + Intergenic
1040912226 8:52530724-52530746 ATGATCTCAGGAGATATGTATGG + Intergenic
1041423237 8:57692812-57692834 AGGGTCCCAGAGGTCATGGAGGG + Intergenic
1041763160 8:61388932-61388954 AGGATATTAGAGGCTAGGGAGGG - Intronic
1042323673 8:67505144-67505166 ATCATCTCATAGGATATGAATGG - Intronic
1045976216 8:108132854-108132876 AGGATCTCAAAGGATTTGGCAGG + Intergenic
1047832153 8:128646081-128646103 AAGATCTCAAAGAAAATGGAAGG - Intergenic
1048302655 8:133262813-133262835 AGGATCTTAGAGAATCTGGGTGG - Intronic
1048691925 8:136975489-136975511 AGGAGCTCACAGGTTATGAAGGG + Intergenic
1049350399 8:142161265-142161287 AGGCTCCCAGAGGTCATGGACGG - Intergenic
1050494945 9:6230731-6230753 AGGATCTATGAGGATATAGTGGG - Intronic
1050628905 9:7538097-7538119 AGGGCCTCAGAGGTTCTGGAAGG + Intergenic
1050669095 9:7976264-7976286 AGTGCCTTAGAGGATATGGAGGG - Intergenic
1051275106 9:15391207-15391229 AGAAACTCAGAGCAAATGGAGGG - Intergenic
1051406182 9:16740039-16740061 AGTATCTCAGGGGATATCCATGG + Intronic
1051789231 9:20781431-20781453 AGCATCTCAGAGGATATTAAGGG + Intronic
1052422828 9:28265959-28265981 AGAATCTGAGATGATAAGGATGG + Intronic
1052826458 9:33179369-33179391 AGCATCAGAGAGAATATGGAAGG + Intergenic
1053314564 9:37040808-37040830 AAGACCTCAGAGGAAATGGAGGG - Intergenic
1053413408 9:37930220-37930242 ATGATCTCAGAGTATCTGGTTGG - Intronic
1053468532 9:38328114-38328136 TGGATCCCAGACAATATGGAGGG - Intergenic
1053520118 9:38769028-38769050 AGGAACTCAGAGGAGAGGTAAGG - Intergenic
1055668583 9:78576924-78576946 AGGACATAAGAGGACATGGAGGG - Intergenic
1055776637 9:79773264-79773286 AGAAGCACAGAGGAAATGGAAGG - Intergenic
1056334213 9:85550219-85550241 AAGATATCAGGGGATCTGGAAGG + Intronic
1056826478 9:89879557-89879579 AGGATCCCAGGGGATGTTGATGG + Intergenic
1058377076 9:104334927-104334949 AGGATCACAAAGGGTTTGGAAGG + Intergenic
1058439582 9:104994400-104994422 AGAATATCAAAGTATATGGAAGG + Intergenic
1059009437 9:110440782-110440804 GGGACCTCAGGGGATGTGGATGG - Intronic
1059735239 9:117093893-117093915 GGGAACTGAGAGAATATGGAAGG - Intronic
1059765492 9:117380057-117380079 AGGATGTGAGAGGATATAGCAGG + Intronic
1060057340 9:120426120-120426142 AGGCTTTCAGAGAAAATGGAGGG - Intronic
1061858758 9:133457187-133457209 GGGCTATCAGAGGATATCGAGGG - Intronic
1062629407 9:137457100-137457122 AGGATCTTAAGGGATATGTAGGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187716459 X:22107194-22107216 ATGATCTCAGGGGAGCTGGAAGG + Intronic
1191769220 X:64737781-64737803 ATGATCTCAGGAGATATGTATGG - Intergenic
1192347938 X:70327386-70327408 AGGGTCCCAGAGGAAATGGAAGG + Intronic
1192573630 X:72225776-72225798 AGGATCTCAGGGGGTTTGGAAGG - Intronic
1193447443 X:81621073-81621095 ATGATTTCAGAAGATATGTATGG + Intergenic
1194291670 X:92080481-92080503 ATGATCTCAAATGATATTGAAGG - Intronic
1194443811 X:93963410-93963432 ATGATCTCAGGAGATATGTATGG + Intergenic
1195167911 X:102238685-102238707 AGGATCTCACAGGGCATGAAGGG + Intergenic
1195190946 X:102448402-102448424 AGGATCTCACAGGGCATGAAGGG - Intronic
1196222576 X:113128824-113128846 TGGGTGCCAGAGGATATGGATGG - Intergenic
1196372384 X:114994274-114994296 ATGATCTCAGGGGATGTGTATGG - Intergenic
1198033343 X:132777014-132777036 TGCATCACAGAGGAAATGGAAGG + Intronic
1198638832 X:138732962-138732984 AGTTTCACAGAGGATATTGATGG + Intronic
1198701595 X:139402598-139402620 ATGATCTCAGGGGATGTGTATGG + Intergenic
1198968997 X:142258994-142259016 TGGATTTCAGAGGGTTTGGAAGG + Intergenic
1199145453 X:144360786-144360808 AGCATCTCTGTGGATTTGGAGGG - Intergenic
1199703099 X:150399886-150399908 AGGCTTTCAGAGGCTATTGAGGG + Intronic
1199917157 X:152355642-152355664 AGGATCCCAGAGAATACAGATGG - Intronic
1200609187 Y:5305060-5305082 ATGATCTCAAATGATATTGAAGG - Intronic
1200932037 Y:8705893-8705915 AGGATCTGAGAAGATCTGCAGGG - Intergenic