ID: 1166360266

View in Genome Browser
Species Human (GRCh38)
Location 19:42250202-42250224
Sequence AATCCTAGCTGTGTGACCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4313
Summary {0: 1, 1: 18, 2: 168, 3: 927, 4: 3199}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166360266_1166360278 25 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360278 19:42250250-42250272 TGCTTGTTCCCACAGGCAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 255
1166360266_1166360271 -8 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360271 19:42250217-42250239 CTAGGATTTGGCAAAGCCAGGGG 0: 1
1: 0
2: 1
3: 9
4: 176
1166360266_1166360270 -9 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360270 19:42250216-42250238 GCTAGGATTTGGCAAAGCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 267
1166360266_1166360276 23 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360276 19:42250248-42250270 AATGCTTGTTCCCACAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 275
1166360266_1166360273 18 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 76
1166360266_1166360277 24 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360277 19:42250249-42250271 ATGCTTGTTCCCACAGGCAAGGG 0: 1
1: 1
2: 1
3: 9
4: 163
1166360266_1166360269 -10 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360269 19:42250215-42250237 AGCTAGGATTTGGCAAAGCCAGG 0: 1
1: 0
2: 5
3: 83
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166360266 Original CRISPR AATCCTAGCTGTGTGACCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr