ID: 1166360267

View in Genome Browser
Species Human (GRCh38)
Location 19:42250203-42250225
Sequence AAATCCTAGCTGTGTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3784
Summary {0: 1, 1: 13, 2: 108, 3: 805, 4: 2857}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166360267_1166360278 24 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360278 19:42250250-42250272 TGCTTGTTCCCACAGGCAAGGGG 0: 1
1: 0
2: 0
3: 18
4: 255
1166360267_1166360273 17 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 76
1166360267_1166360277 23 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360277 19:42250249-42250271 ATGCTTGTTCCCACAGGCAAGGG 0: 1
1: 1
2: 1
3: 9
4: 163
1166360267_1166360271 -9 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360271 19:42250217-42250239 CTAGGATTTGGCAAAGCCAGGGG 0: 1
1: 0
2: 1
3: 9
4: 176
1166360267_1166360270 -10 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360270 19:42250216-42250238 GCTAGGATTTGGCAAAGCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 267
1166360267_1166360276 22 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360276 19:42250248-42250270 AATGCTTGTTCCCACAGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166360267 Original CRISPR AAATCCTAGCTGTGTGACCT TGG (reversed) Intronic
Too many off-targets to display for this crispr