ID: 1166360273

View in Genome Browser
Species Human (GRCh38)
Location 19:42250243-42250265
Sequence GACCCAATGCTTGTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166360267_1166360273 17 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 76
1166360266_1166360273 18 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166360273 Original CRISPR GACCCAATGCTTGTTCCCAC AGG Intronic