ID: 1166360273

View in Genome Browser
Species Human (GRCh38)
Location 19:42250243-42250265
Sequence GACCCAATGCTTGTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166360267_1166360273 17 Left 1166360267 19:42250203-42250225 CCAAGGTCACACAGCTAGGATTT 0: 1
1: 13
2: 108
3: 805
4: 2857
Right 1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 76
1166360266_1166360273 18 Left 1166360266 19:42250202-42250224 CCCAAGGTCACACAGCTAGGATT 0: 1
1: 18
2: 168
3: 927
4: 3199
Right 1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166360273 Original CRISPR GACCCAATGCTTGTTCCCAC AGG Intronic
900980496 1:6043507-6043529 GCCCCAATTCTGGTGCCCACAGG + Intronic
903369895 1:22828459-22828481 GACCCAATCCTTGTTCTGGCAGG + Intronic
906719712 1:47996615-47996637 GACCCAAACCATGGTCCCACGGG + Intronic
918016717 1:180641366-180641388 GACTCAAAGCTTGTTCCTCCAGG + Intronic
920760346 1:208777852-208777874 GAACCAAGGCTAGTTTCCACAGG + Intergenic
922016034 1:221648193-221648215 CACCAAATGGTTGTTCCCACTGG - Intergenic
1070338545 10:75476136-75476158 GATCCAAGTCTTGTTCTCACTGG + Intronic
1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG + Intronic
1071186529 10:83052641-83052663 GTCCCAATGCTTGTTCATCCAGG + Intergenic
1072205217 10:93197887-93197909 CTCCCAATTCTTGTTCCCAGAGG - Intergenic
1073624410 10:105082094-105082116 GACACAATGCTTGACCTCACAGG - Intronic
1080907346 11:36560262-36560284 CACCCAATGCTTGCCACCACTGG - Intronic
1084489466 11:69470721-69470743 GACCCAAATCTCTTTCCCACGGG - Intergenic
1085196127 11:74672891-74672913 TTCCCAAGGCCTGTTCCCACTGG - Intergenic
1088328708 11:108628470-108628492 GACCCAATGCTTGCTAGCCCTGG - Intergenic
1088993422 11:114974308-114974330 GACACAATCCTTGTTCTCAAGGG + Intergenic
1090650445 11:128801515-128801537 GGCTAAAAGCTTGTTCCCACAGG - Intronic
1092128018 12:6088861-6088883 AACCCAATGCCTGTCTCCACTGG - Intronic
1092476978 12:8828014-8828036 GTCCCAATGCTGGTGGCCACAGG - Intronic
1096542350 12:52314818-52314840 GACCCTGCCCTTGTTCCCACAGG - Exonic
1104419678 12:128625008-128625030 GACCCTATGCTTGTGCCAATAGG + Intronic
1113242644 13:108355479-108355501 GCCCCTCTGCCTGTTCCCACGGG - Intergenic
1117935190 14:60896237-60896259 TTCCCACTGCTTGCTCCCACTGG - Intronic
1120068800 14:80078978-80079000 GACCCAATCCTTGCTCTCAATGG + Intergenic
1121921598 14:97887240-97887262 CACCCAGTGCTTTTCCCCACTGG - Intergenic
1122552625 14:102558025-102558047 GGCCCAAGACTTGTTCACACAGG + Intergenic
1128405861 15:67337862-67337884 GACCCAAAGCTGGTTCCCAAAGG + Intronic
1128887444 15:71302023-71302045 AACCCTAAGCTTGCTCCCACAGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1145936955 17:28719970-28719992 TCTCCAATGCTCGTTCCCACGGG - Exonic
1146512337 17:33460912-33460934 GAGCCAATGACTCTTCCCACTGG + Intronic
1156868300 18:41913835-41913857 GACACAGCGTTTGTTCCCACTGG - Intergenic
1157887168 18:51379909-51379931 GACCCAGTCAATGTTCCCACGGG - Intergenic
1161751608 19:6101684-6101706 GACCCAATCCTTTTTCACATGGG + Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1168186892 19:54705744-54705766 GACCCTATGTTTGTTCCTGCTGG - Intergenic
927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG + Exonic
930345010 2:50169309-50169331 TACCCATTGCTTGTTCTCATGGG - Intronic
933254848 2:80069221-80069243 GCCCTAATGCTTGTGCACACTGG + Intronic
936392183 2:112085426-112085448 GACCCAATTCTAGTTCCCCCAGG + Intronic
941772738 2:169362041-169362063 GACCCTGTCTTTGTTCCCACGGG - Intronic
942750925 2:179286308-179286330 GTCCCAATTCATGTTCCCATTGG + Intergenic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1175170826 20:57080220-57080242 GAACCCATGCTTGATTCCACAGG - Intergenic
1175386769 20:58601384-58601406 GAGCCGATGCTTGTTGCCATTGG + Intergenic
1177253064 21:18621810-18621832 GACCCAGGGCTTTTTTCCACTGG + Intergenic
1181051507 22:20240289-20240311 GACCCTGTGCCTGTGCCCACAGG - Intergenic
1182126647 22:27820946-27820968 AACCCAATGCCTGGTCCCACAGG + Intergenic
1182283451 22:29231163-29231185 AACCCACTGCTCATTCCCACAGG - Intronic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
950121078 3:10482918-10482940 GAAGCAATGCTTCCTCCCACTGG + Intronic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
951491844 3:23279618-23279640 GACCCTAAGCTGGTTCCAACTGG - Intronic
952038925 3:29238133-29238155 GACCCAATGATTCTACTCACAGG - Intergenic
952132707 3:30383823-30383845 GACCCAGTGCTGGTTTCCACAGG - Intergenic
953234234 3:41092179-41092201 GACCCCATGCATGTCCACACTGG - Intergenic
963459166 3:145586142-145586164 GAGAAAATGCTTGTTCCCTCTGG - Intergenic
964402546 3:156314297-156314319 AACCCAATGCATGTTAACACTGG - Intronic
977191067 4:94001315-94001337 GACACAGTGCTTGTTTCCTCTGG - Intergenic
980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG + Intergenic
986560930 5:9060397-9060419 GACCCTATCCTTGTTGCCATGGG - Intronic
988873774 5:35420632-35420654 TATCCAATCCTTTTTCCCACTGG - Intergenic
988999850 5:36748814-36748836 GACCCTCTGCTTGTCTCCACAGG + Intergenic
990939698 5:61189111-61189133 TACCCAATGCTTGTCTCCCCAGG + Intergenic
993651876 5:90531300-90531322 GACAAAATGCTTGTTCCTACTGG - Intronic
996855561 5:128002339-128002361 AACACATTGCTTGTTACCACTGG - Intergenic
999628409 5:153544310-153544332 GACCCATTGCCTGTTGCCAGAGG - Intronic
1006505002 6:34483468-34483490 GACCCAACTCTGGTGCCCACCGG - Intronic
1017289091 6:152713953-152713975 GACCAAATGCTTGTAGCTACTGG - Intronic
1017329297 6:153177009-153177031 AACCCAATGCTTGTACCAATTGG + Intergenic
1017353155 6:153468639-153468661 AACCCAATTCTTTTTCCTACTGG - Intergenic
1019089667 6:169518113-169518135 GACCCAATGGCTGCTCTCACAGG + Intronic
1037436465 8:18869078-18869100 GACCAAATGCTTGTTCTTAATGG + Intronic
1041346418 8:56902899-56902921 GACCCACTGCTAGTTCCCCTAGG + Intergenic
1043685251 8:83076560-83076582 GACCAAATGCTTTTTCCCTAAGG + Intergenic
1047643459 8:126845338-126845360 GACCTCACGCTTGTTCCAACAGG - Intergenic
1048498086 8:134951907-134951929 GACCCAGTGTTTCTTCCCTCTGG + Intergenic
1052119915 9:24701404-24701426 GAACCAATGCTTGTGGCCAGTGG - Intergenic
1052762957 9:32611299-32611321 TACCAAATACCTGTTCCCACAGG - Intergenic
1056068688 9:82963593-82963615 GACCCAATGTTTGTTTCTCCTGG + Intergenic
1056949032 9:91027161-91027183 GACCCCATGCTTCTTCCCGTCGG - Intergenic
1062419328 9:136472111-136472133 GCCCAAATGCTTCCTCCCACAGG - Exonic
1185746656 X:2578831-2578853 AACTCAATTCTTTTTCCCACAGG + Intergenic
1190865346 X:54379968-54379990 GTCCCAATGCTTGAACTCACAGG + Intergenic