ID: 1166361467

View in Genome Browser
Species Human (GRCh38)
Location 19:42254492-42254514
Sequence CACTCACGCCCTCCTCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166361459_1166361467 -4 Left 1166361459 19:42254473-42254495 CCCCGAGTCCCGGGCTCCCCACT 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1166361460_1166361467 -5 Left 1166361460 19:42254474-42254496 CCCGAGTCCCGGGCTCCCCACTC 0: 1
1: 0
2: 6
3: 29
4: 263
Right 1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1166361461_1166361467 -6 Left 1166361461 19:42254475-42254497 CCGAGTCCCGGGCTCCCCACTCA 0: 1
1: 0
2: 2
3: 18
4: 219
Right 1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1166361458_1166361467 2 Left 1166361458 19:42254467-42254489 CCAGGACCCCGAGTCCCGGGCTC 0: 1
1: 0
2: 2
3: 23
4: 247
Right 1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166361467 Original CRISPR CACTCACGCCCTCCTCCTAG AGG Intronic
903904876 1:26677911-26677933 CTCTCACCCACTCCTCCCAGTGG - Intergenic
908508856 1:64834293-64834315 CACTTAAGCACTCCTCCTTGTGG - Exonic
915661560 1:157409648-157409670 CTCTCATCCCCTCCTCCTTGGGG + Intergenic
915662449 1:157415531-157415553 CACTCAGGCCCACCTCCTTAGGG + Intergenic
918513100 1:185333037-185333059 TAATCAAGCCCTCTTCCTAGTGG - Intergenic
919820656 1:201469777-201469799 CATTCATGCCCTCCTCGTAGTGG + Intergenic
920932953 1:210406082-210406104 TACTCCCACCCTCCTCCTGGAGG - Intronic
1064136508 10:12755232-12755254 CACACACTCCCTGCTCCTGGAGG - Intronic
1068903734 10:62299392-62299414 GACTCACTCCCTTCTCCTACGGG - Intergenic
1069615799 10:69805397-69805419 CACTCACGCCATCCACCTGTGGG - Intronic
1070314258 10:75295294-75295316 CAGTCCCGCCCTCCTCCTCCTGG + Intergenic
1070409406 10:76125654-76125676 CCATCACGCCCTCCTCCTCTAGG - Intronic
1072591223 10:96830711-96830733 GACTCACACCCACCACCTAGCGG + Intergenic
1076205031 10:128590740-128590762 CAGTCACACCCTCCTCCTACTGG - Intergenic
1076720430 10:132389999-132390021 CCCTCAAACCCTCCTCCTGGTGG - Intergenic
1076793513 10:132788317-132788339 CTTTCCCGCCCTCCTCCTCGCGG + Intergenic
1077009475 11:373813-373835 CACTCACGCCCACTTCCACGTGG - Exonic
1077894516 11:6443618-6443640 CACTCCCGCCCTTCAACTAGAGG + Intergenic
1081787476 11:45757542-45757564 CAGTCACCCCCTCCTCCCTGGGG + Intergenic
1083355419 11:62062676-62062698 CCCTCCCTCCCTCTTCCTAGGGG + Intergenic
1084274612 11:68044954-68044976 CACTCACTCCCTCCTCCATCTGG - Exonic
1084765510 11:71305693-71305715 AACTGACGCCCACCTCCAAGAGG + Intergenic
1087940360 11:104089336-104089358 CAGTAACTGCCTCCTCCTAGGGG - Intronic
1088110892 11:106260080-106260102 CACTCACGCTGGGCTCCTAGTGG + Intergenic
1089494753 11:118902421-118902443 CCCTCACCCGCTCCTCCTGGGGG + Exonic
1090071323 11:123546942-123546964 CACTGAGGCCCTGCTCCTACTGG - Intronic
1092191859 12:6526973-6526995 CACTCACTGCCTGCTCCAAGTGG - Exonic
1092426678 12:8381037-8381059 CCCTCAGGCCATCCTCCTGGAGG - Intergenic
1093599258 12:21001960-21001982 CTCTCAAGCACTCCTCCTAGGGG - Intergenic
1099730120 12:86489680-86489702 CATACACTCCCTCCTCCGAGGGG + Intronic
1101736070 12:107464284-107464306 CAGTCACCACCTCCTCATAGAGG - Intronic
1102388100 12:112527728-112527750 AATCCACGCCCTCTTCCTAGGGG - Intergenic
1106562056 13:30855272-30855294 CACACACACACTCCTCCTATTGG + Intergenic
1112699107 13:101983882-101983904 CCCCCAAGCTCTCCTCCTAGGGG - Intronic
1113293025 13:108926597-108926619 CACTCACGCCCTCCTGTTCCTGG - Intronic
1116695412 14:48169220-48169242 CACTCACATCCTCCTCCCACCGG - Intergenic
1121583008 14:95044850-95044872 CGATCCCGCCCTCCTCCCAGTGG - Intergenic
1121584187 14:95051622-95051644 CACTCACACACACCTCCTATTGG - Intergenic
1122793646 14:104195003-104195025 CACGCAGACCCTCCTGCTAGCGG + Intergenic
1124577833 15:30925453-30925475 CCCTAACGCCCTCCTCCCTGAGG + Intronic
1124955716 15:34359094-34359116 CTCTCACCCCCTCCTCCTCAGGG - Exonic
1125769067 15:42153184-42153206 CACCCAAGCCCTCCTCGGAGGGG - Intronic
1129461049 15:75700276-75700298 CTCTCACACCCTCCTCCCACTGG - Intronic
1129723771 15:77891449-77891471 CTCTCACACCCTCCTCCCACTGG + Intergenic
1132513222 16:354020-354042 TACTCACATCCTCCTCCTTGGGG - Intergenic
1132952232 16:2569838-2569860 GTGCCACGCCCTCCTCCTAGAGG + Intronic
1132962119 16:2630332-2630354 GTGCCACGCCCTCCTCCTAGAGG - Intergenic
1137955691 16:52826719-52826741 CACACACACACTCCTCCTACTGG - Intergenic
1141575658 16:84962019-84962041 CGGTCAAGCGCTCCTCCTAGAGG + Intergenic
1143152349 17:4815469-4815491 CACGGACACCCTCCTCCTGGTGG - Exonic
1150747117 17:67825391-67825413 CGCTCCCGCGCTCCCCCTAGCGG + Intergenic
1152568289 17:81109933-81109955 CACCCACGCCCCCCACCTGGGGG + Intronic
1157975649 18:52324083-52324105 CACTCACCCCCTCCACCTCCAGG + Intergenic
1161169953 19:2807698-2807720 CACTGGCGCCCTCCTCGTGGTGG - Exonic
1163103157 19:15109474-15109496 CTCACACTCCCTCCTCCCAGAGG + Intronic
1164645381 19:29855383-29855405 CAGTCCCGCCCTCATCCTTGGGG - Intergenic
1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG + Intronic
1168405745 19:56109385-56109407 GAAACACGCCCTCCTCGTAGAGG + Intronic
926439400 2:12872111-12872133 CTCTCACTCCCTCCTCCTGTTGG - Intergenic
927138523 2:20114412-20114434 TTCTGACGCCCTCCTCCAAGGGG + Intergenic
930818480 2:55622022-55622044 CACACACCCCCTCCTGCCAGGGG + Intergenic
938517682 2:132032349-132032371 CAAACATGCCCTCTTCCTAGCGG + Intergenic
940372204 2:152916177-152916199 GACTCTCGCCCTCCACATAGAGG - Intergenic
1169143555 20:3238929-3238951 CACCCGCGCCCTCCTCCCCGCGG + Intronic
1169247587 20:4035663-4035685 CACACACTCCTGCCTCCTAGTGG - Intergenic
1170613834 20:17933996-17934018 CTCACAGCCCCTCCTCCTAGTGG + Intergenic
1170678178 20:18501685-18501707 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678189 20:18501722-18501744 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678200 20:18501759-18501781 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678210 20:18501796-18501818 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678220 20:18501833-18501855 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1172296403 20:33814198-33814220 CACTAAGACCTTCCTCCTAGAGG - Intronic
1172539377 20:35699253-35699275 CACTGCCGCCCGCCTCCAAGCGG + Exonic
1174932014 20:54826506-54826528 CACTCAGGCCCTCCTCTAACTGG - Intergenic
1175124505 20:56741286-56741308 CAGTCCCTCCATCCTCCTAGGGG - Intergenic
1176145196 20:63562360-63562382 CACGCACGGCTTCCTCCTTGCGG + Exonic
1181040017 22:20187718-20187740 CACACACGCCCTCTTCCCAGAGG + Intergenic
1181625757 22:24121127-24121149 CAGTCAGGTCCTCCTCCTAGAGG + Intronic
1183059327 22:35326637-35326659 CACCCTCTCTCTCCTCCTAGTGG - Intronic
1183059384 22:35326861-35326883 CCCTCTCTCTCTCCTCCTAGAGG - Intronic
1185060337 22:48603242-48603264 CACTCAAGCCCTCCCCCTACCGG - Intronic
953925934 3:46982433-46982455 CACCCACCCCCTCCCCCTGGGGG + Intronic
954442217 3:50528042-50528064 CACTCAGGCCCCACTGCTAGGGG - Intergenic
954590200 3:51776445-51776467 CACTCACCTCCTCTTCCTTGGGG + Intergenic
954971113 3:54652515-54652537 CACACATGCTCTCCTCCAAGAGG - Intronic
964706617 3:159625268-159625290 CAATCACACCTGCCTCCTAGGGG + Intronic
966486472 3:180476528-180476550 AACTCAGCCCCTGCTCCTAGAGG - Intergenic
966711656 3:182979375-182979397 CACACACACCCTCCTCAAAGAGG + Intronic
967176711 3:186867166-186867188 CACACACTCCTGCCTCCTAGTGG - Intergenic
969321824 4:6417208-6417230 CTCTTACTCCCTCCTCCTCGTGG - Intronic
969859075 4:10021511-10021533 AACTCCCGCCCTCCTTCCAGTGG - Intronic
972199200 4:36693078-36693100 CACCCACTCCCTCCTCCTTCTGG + Intergenic
974965163 4:68751283-68751305 CAGTCAAGCCCTCCTTCTATAGG - Intergenic
980762926 4:137260553-137260575 CACTCAAGCCCGTCTCCTACAGG + Intergenic
984105489 4:175540760-175540782 CGCTCACTCCCTCCTGCAAGGGG - Intergenic
992179752 5:74184443-74184465 CACTGGAGCCCTCCTTCTAGAGG + Intergenic
1001011670 5:168104478-168104500 GACTCAGGCCCTCCTGCCAGGGG + Intronic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006409650 6:33865211-33865233 CACTCACTCGCTCCTGCGAGGGG + Intergenic
1010722003 6:79293438-79293460 CACTCACTCCCTCCTCCTTTTGG + Intergenic
1019302213 7:311594-311616 CACCCCCGCCCCCCTCCTGGAGG + Intergenic
1019409896 7:901806-901828 CCCGCCCTCCCTCCTCCTAGAGG + Intronic
1019552443 7:1609916-1609938 CACTCACTCCCCCTCCCTAGGGG - Intergenic
1019595290 7:1855600-1855622 CACCCACGGCCTCCTCAGAGCGG + Intronic
1022896090 7:34751616-34751638 CACTCACTGCCTGCTCCAAGTGG + Intronic
1025853802 7:65261821-65261843 CACACACTCCTGCCTCCTAGTGG - Intergenic
1027219285 7:76203762-76203784 CACTCGCGCTGTCCTCCTGGAGG + Intronic
1035688993 8:1547531-1547553 CACTCACACCTTCCTCCTTCTGG - Intronic
1035934224 8:3818929-3818951 CACTCACACCCTTCTTCTAAGGG + Intronic
1039317123 8:36385987-36386009 CACTCATCTCCTCCTCCTAGGGG - Intergenic
1047345150 8:124020623-124020645 CACTCACCACCTCTTCCCAGAGG - Intronic
1049988528 9:972672-972694 GACTCACGCCCTCCTACTACTGG + Intergenic
1055451313 9:76433579-76433601 CACACACCCCCTCCTGCCAGGGG + Intronic
1058800849 9:108543301-108543323 TACTCACACCCACCTCCCAGGGG + Intergenic
1059405761 9:114097726-114097748 CAGGCACCCCCTCCCCCTAGGGG + Exonic
1061571700 9:131481836-131481858 CACTCACACACTCATCCCAGGGG - Intronic
1062427999 9:136514882-136514904 CACTCAAGTCATCCTCCCAGGGG + Intronic
1062653588 9:137590615-137590637 CGCACTCGCCCTCCTCCTATTGG - Intergenic
1189378693 X:40486068-40486090 CCATCACTCCCTCCTCCTATTGG + Intergenic
1190971827 X:55357006-55357028 CAGCCACCCCTTCCTCCTAGGGG - Intergenic
1192225167 X:69222650-69222672 CAGCCACCCCCTCCTCCTGGTGG + Intergenic
1193583573 X:83294026-83294048 CACTCACAACTTCCTCCTGGTGG - Intergenic
1193596856 X:83457348-83457370 CACTCAAGCCCTCATCCATGTGG - Intergenic
1196106642 X:111903605-111903627 CACTCACTCCATTCTCCTGGAGG - Intronic
1197926110 X:131648064-131648086 CTCTCCCACCCTCTTCCTAGTGG + Intergenic
1198675343 X:139124926-139124948 CAGTCGCACCCTCTTCCTAGGGG - Intronic
1199597957 X:149522934-149522956 AACTCACTCCCTTCTCCAAGGGG - Intronic
1200115709 X:153768869-153768891 GGGACACGCCCTCCTCCTAGTGG - Intronic