ID: 1166361860

View in Genome Browser
Species Human (GRCh38)
Location 19:42255779-42255801
Sequence CTGGTCACTTCCTCCCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166361860_1166361864 18 Left 1166361860 19:42255779-42255801 CCAGCTGGGGAGGAAGTGACCAG No data
Right 1166361864 19:42255820-42255842 CCCCCACCACCACCGTCCCCAGG No data
1166361860_1166361861 -8 Left 1166361860 19:42255779-42255801 CCAGCTGGGGAGGAAGTGACCAG No data
Right 1166361861 19:42255794-42255816 GTGACCAGAGAGAATGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166361860 Original CRISPR CTGGTCACTTCCTCCCCAGC TGG (reversed) Intergenic
No off target data available for this crispr