ID: 1166364169

View in Genome Browser
Species Human (GRCh38)
Location 19:42270114-42270136
Sequence GGTTTGTGCTTGGAAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166364166_1166364169 -3 Left 1166364166 19:42270094-42270116 CCCTGGGTGGGGTATGCAAAGGT 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1166364169 19:42270114-42270136 GGTTTGTGCTTGGAAAAAACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1166364159_1166364169 17 Left 1166364159 19:42270074-42270096 CCAGGCGGCATAGTTGTAGGCCC 0: 1
1: 0
2: 0
3: 3
4: 17
Right 1166364169 19:42270114-42270136 GGTTTGTGCTTGGAAAAAACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1166364167_1166364169 -4 Left 1166364167 19:42270095-42270117 CCTGGGTGGGGTATGCAAAGGTT 0: 1
1: 0
2: 0
3: 10
4: 99
Right 1166364169 19:42270114-42270136 GGTTTGTGCTTGGAAAAAACTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166364169 Original CRISPR GGTTTGTGCTTGGAAAAAAC TGG Intronic
902972146 1:20061640-20061662 CCTTTGTGCTTGAAATAAACAGG + Intronic
906124530 1:43419588-43419610 GGTCTGTCCTGGGAAAACACTGG + Intronic
907292266 1:53424265-53424287 GATTTGTCTTTGGTAAAAACAGG + Intergenic
907719642 1:56959815-56959837 TGGGTGTGCTTGGAAAACACTGG + Intronic
909131369 1:71741517-71741539 GGTAGGTGCTTGGCAAATACTGG - Intronic
909989892 1:82210680-82210702 GATTTGTGATTAGAAAAATCTGG + Intergenic
910684668 1:89904059-89904081 GGTTTGTCCTTGGACAGAACTGG - Intronic
911697211 1:100903909-100903931 GGGTTGTGCTTGGGAACACCAGG + Intronic
917675276 1:177312816-177312838 GGTTTGTGCTGTGAAATAAATGG + Intergenic
919916322 1:202141789-202141811 GTTTTGTCCTAGGAAACAACAGG - Intronic
923600837 1:235401427-235401449 GGTATTTGCTTGCAGAAAACTGG + Intronic
923984867 1:239370119-239370141 CTTTTGTGCTTGTAAAAAAATGG - Intergenic
1065166486 10:22984350-22984372 GGTTTTTGCTTGGAAAATTGTGG + Intronic
1065983632 10:30928755-30928777 GGTTTGTTCTCTGAAAAAATTGG - Intronic
1066673814 10:37866780-37866802 TGTTTGAGCTTGGGAAAAATTGG + Intergenic
1067214464 10:44290734-44290756 GATTTATCCTTGGTAAAAACGGG + Intergenic
1068888647 10:62125321-62125343 GATAAGTGCTTGTAAAAAACTGG + Intergenic
1068957966 10:62837618-62837640 GGTTTGATGTTGGAAAAACCTGG - Intronic
1069220174 10:65873060-65873082 TGTTTGTGCTTGCAAAAACATGG - Intergenic
1069412532 10:68168262-68168284 GATTTATGTTTGGAAGAAACTGG + Intronic
1071090902 10:81917004-81917026 GTTTTGGGGTTGGATAAAACTGG - Intronic
1071380485 10:85054280-85054302 GATTTGAGGTTGGAAATAACAGG - Intergenic
1071576976 10:86734679-86734701 GCTTCGTGCTTGGAAAAAATAGG - Exonic
1071787841 10:88922376-88922398 GGTTTCTGCTTGTAAAAAAAAGG + Exonic
1074921236 10:118015915-118015937 GTTTTGTGCATGGAATAAAAAGG - Intronic
1075099125 10:119493555-119493577 GGTTTGTTCTTTTAAAAAACTGG + Intergenic
1075894455 10:125983085-125983107 GGTTTGTGCTGAGAAATAAGAGG - Intronic
1079959938 11:26911751-26911773 GGTTTATGCTTGAAAAACAGAGG + Intergenic
1082846818 11:57732965-57732987 GGTTTGTGCCTGGGAGCAACAGG - Intronic
1085666703 11:78420442-78420464 GGTTTTTGCTGGGAAAAAAATGG + Intergenic
1085796550 11:79546083-79546105 GGTTTTAGCTTGGATAGAACTGG - Intergenic
1087548154 11:99610900-99610922 GCTATGTGCTTAGAAAAAAGCGG + Intronic
1087813222 11:102631020-102631042 GGTTTGTGATGGGAAACCACTGG + Intergenic
1091701762 12:2667983-2668005 GGTGTGTGCTGGGAAAGAAGAGG + Intronic
1093027710 12:14259943-14259965 GAATTGTCCTTGAAAAAAACAGG - Intergenic
1096393030 12:51244528-51244550 GGTTTGAGCTTGGACAACAGAGG + Intronic
1098392454 12:69983973-69983995 GCTGTGTGCCTGGAAAGAACAGG - Intergenic
1100310447 12:93390245-93390267 GGTTTGGGTTAGGAATAAACTGG - Intronic
1101592008 12:106133145-106133167 GGTTTGTGCTGGGACACAATGGG - Intronic
1102831807 12:116009007-116009029 GTTTTGTGCTTAGAAGAAGCAGG + Exonic
1103983793 12:124753956-124753978 GGTAGGTGCTTGGTAAAAATGGG + Intergenic
1105029639 12:132873824-132873846 GATTTTTGTTTGGAAAGAACAGG - Intronic
1107093867 13:36513807-36513829 CGTTTCTTCTGGGAAAAAACAGG + Intergenic
1108202490 13:48057419-48057441 GGTTGGGGCTTGGAAAATAAGGG - Intronic
1109893126 13:68644759-68644781 GCTTTGTAGTTGGAAAAGACGGG + Intergenic
1110582806 13:77151983-77152005 GTTTTGTGGTTGGCAAGAACAGG + Intronic
1112188170 13:97148027-97148049 GGTTTGCCCTTGGAAAGAAGAGG + Intergenic
1112910353 13:104475360-104475382 GGTTTGTGTTAGGAAAAAACGGG + Intergenic
1112952826 13:105022221-105022243 GATTTTTCCTTGGAAAAAAATGG - Intergenic
1114366381 14:22031609-22031631 AGTCTGTGCTAGGAAAAATCTGG - Intergenic
1114797610 14:25734408-25734430 GGATTGTTATTGGAAAAAGCAGG - Intergenic
1116097626 14:40391578-40391600 AGTTTGTTGTAGGAAAAAACAGG + Intergenic
1117085768 14:52198962-52198984 AGATTGTGTATGGAAAAAACTGG + Intergenic
1117784221 14:59265852-59265874 AGCTTATGCTTGGAAATAACAGG + Intronic
1119999572 14:79287509-79287531 GGTTTGTGCTGGGAAGAAGCAGG + Intronic
1120250119 14:82052869-82052891 AGTTTGTGCTTTAAAAAAAAAGG - Intergenic
1120755045 14:88235020-88235042 GTTTCATGCTTGGTAAAAACAGG - Intronic
1121233498 14:92375906-92375928 GGTGTGTGCTTAAAAAAAAATGG + Intronic
1121237758 14:92405305-92405327 TGTTTGTGTTTGTAAAAAAGAGG + Intronic
1124407177 15:29403715-29403737 GGTTGGTCCTGGGAAAAACCAGG - Intronic
1124643710 15:31419213-31419235 GATTTGTGCTTTTGAAAAACAGG - Intronic
1125805471 15:42490248-42490270 TATTTGTGCTTTGAATAAACTGG + Intronic
1126195878 15:45930936-45930958 GGTTTATGTTAGGAAAATACTGG + Intergenic
1128203472 15:65829963-65829985 GGCTTGTGCTGGGAGGAAACTGG - Intronic
1129093634 15:73179928-73179950 TGTTTGTAATAGGAAAAAACAGG - Intronic
1131197139 15:90364645-90364667 GATTTTTGCTCTGAAAAAACTGG + Intronic
1131570994 15:93535833-93535855 GGTATGTCCTTGGGAAAAAGTGG - Intergenic
1133726417 16:8541912-8541934 CCTTTGTTCTTGGAAAGAACAGG - Intergenic
1135406967 16:22205836-22205858 GATTTCTGCTTTGTAAAAACAGG - Intergenic
1135496442 16:22955662-22955684 GGTTTGTGCTTACAGAAAACAGG + Intergenic
1135552744 16:23410650-23410672 GCTTTGTCCTTGAGAAAAACAGG + Intronic
1141195616 16:81858618-81858640 GGTATGTGCTGGGGGAAAACAGG + Intronic
1143691471 17:8570616-8570638 GATTTATGTTTGGAAAAAGCAGG - Intronic
1143929811 17:10410664-10410686 GGTTTGTGATCTGAACAAACTGG - Intronic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1147531810 17:41286122-41286144 GGGGAATGCTTGGAAAAAACTGG - Intergenic
1147594451 17:41707712-41707734 GGTTTCTGTTTAGTAAAAACTGG - Intergenic
1148704654 17:49619068-49619090 GGTTTGTGCAAGGCAAAGACTGG - Exonic
1149696644 17:58621504-58621526 GGGGTGTGCTTGGAAAGAAAAGG - Intronic
1151021030 17:70617664-70617686 TCTTTGTTCTTGGAAATAACTGG - Intergenic
1151031372 17:70744291-70744313 GATTTGGGTTTGGGAAAAACTGG - Intergenic
1155601434 18:27553333-27553355 GGTTTGAGCTTGGGAAGAAGAGG - Intergenic
1156763483 18:40622125-40622147 GGTTTTTGCTTGGAAACTAAAGG + Intergenic
1158734225 18:60061625-60061647 GGTTTGTGCTCAGAAAACAGAGG - Intergenic
1160551840 18:79698404-79698426 GGTTTGTGCTTGGGAGAACTGGG + Intronic
1165004596 19:32794501-32794523 AGTTAGGGCTTGGAAAATACTGG + Intronic
1166364169 19:42270114-42270136 GGTTTGTGCTTGGAAAAAACTGG + Intronic
1167539198 19:50074547-50074569 GATTTGAGATTGGAAAAGACGGG + Intergenic
1167630509 19:50623311-50623333 GATTTGAGATTGGAAAAGACGGG - Intronic
1168314660 19:55479322-55479344 GGTTTGCGCTGGGAAAGAGCGGG + Intronic
928856994 2:35814223-35814245 GGTTGGTGCATGGAAATAAGGGG - Intergenic
929675195 2:43919699-43919721 AGTTTCTGCTTGTGAAAAACTGG + Intronic
933580694 2:84123552-84123574 GATTCGTGCTTAGAAAAATCAGG + Intergenic
933820286 2:86105045-86105067 GCTTGGTGCCTGGAAAAAACTGG + Intronic
934493363 2:94777741-94777763 GGTTTCTGCTTGGAAACAGTCGG - Intergenic
937500858 2:122477165-122477187 GATATGTAATTGGAAAAAACAGG - Intergenic
940735942 2:157452495-157452517 TGTTTGTGATTGCAAAAAACCGG + Intronic
941409765 2:165140067-165140089 TGTTTGTGCATGGAAAAAATTGG - Intronic
942517527 2:176769386-176769408 GTTTTGTGCTTGTAGAAAAGTGG + Intergenic
944627471 2:201586296-201586318 GGTTGATGCTTGGACAACACAGG - Intronic
946516759 2:220420373-220420395 GGTATGTGCTAGTAAAATACAGG + Intergenic
946682939 2:222236396-222236418 GTTTTGCTCTTGGTAAAAACTGG - Intronic
947720959 2:232368993-232369015 GGTTTTTGCTTTGGAAAAATGGG + Intergenic
1170446619 20:16434541-16434563 AGATTGTACTTGGAAAAAACTGG + Intronic
1172862346 20:38064482-38064504 GGTTGGTGCTTTGAAACAAAGGG - Intronic
1178305932 21:31489978-31490000 AGTTTGTTCTAGGAAAAAAAAGG + Intronic
1181819423 22:25463825-25463847 TGTCTGTGCTAGCAAAAAACTGG + Intergenic
1183275606 22:36895405-36895427 GTTTTGTGCTAGGGATAAACAGG - Intergenic
951807985 3:26667776-26667798 GTGTTGTGCCTGGCAAAAACAGG + Intronic
953270816 3:41442247-41442269 TGTTTGTGCTAAGGAAAAACGGG + Intronic
953924762 3:46977074-46977096 GGTTAGTACTTGGGCAAAACCGG - Intronic
956027345 3:64997483-64997505 GGTTTCTACTTGGAAAGAAGAGG - Intergenic
956438018 3:69253367-69253389 GGTATGTTTTTGGTAAAAACTGG + Intronic
962425908 3:135269176-135269198 ACTTTGTGTTTGGAAAATACCGG - Intergenic
964330308 3:155594652-155594674 GGTTTCTAGTGGGAAAAAACAGG - Intronic
964683637 3:159370000-159370022 GGTTGGTACTTGGAAAATATGGG - Intronic
967091697 3:186140029-186140051 AATTTCTGCTTGGAAACAACTGG + Intronic
975412280 4:74067466-74067488 GATTTGTGTTTGGTAAAAATGGG - Intergenic
977981637 4:103329805-103329827 GGTTTGTGCTTGCAGAAAGGAGG + Intergenic
980820107 4:138004121-138004143 GCATTGTGCTTTGGAAAAACAGG + Intergenic
982570445 4:157044095-157044117 GCTATGTGCTTGGAAGAAATAGG - Intergenic
983329816 4:166311143-166311165 TATTTGTGATTGGAAAAAAAGGG - Intergenic
983643165 4:169962724-169962746 GGTTTGTGATGGGCAAAAACAGG + Intergenic
983812725 4:172083319-172083341 GTTTTGTGCATGGAAATGACAGG - Intronic
986500018 5:8388873-8388895 TGTTGGTGCTAGCAAAAAACTGG + Intergenic
986587179 5:9330518-9330540 GGTGTGTGCTTTTAACAAACTGG - Intronic
987582289 5:19809834-19809856 GGTTTATGATGGGAAAAAATGGG - Intronic
988789873 5:34597655-34597677 CATTTGGGCTTGGCAAAAACAGG + Intergenic
988793318 5:34629158-34629180 GGGTTTTGCTTGGAAAAATAAGG - Intergenic
989311063 5:40018490-40018512 GGTTTGTGCTTCCAAAACAATGG - Intergenic
991356248 5:65772183-65772205 GGTAAGTACTTGGAAAAAAGAGG - Intronic
992192311 5:74305364-74305386 GCTTTGTGCTAGAAAGAAACAGG + Intergenic
993058125 5:83006350-83006372 GGGTTGTGCTTGGAAAGATCTGG - Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
998135098 5:139670254-139670276 GGCCTGAGCGTGGAAAAAACTGG - Intronic
998174046 5:139890111-139890133 GGTGAGTGTGTGGAAAAAACAGG - Intronic
999615504 5:153418509-153418531 GGTTAGTTCTTGGAAAAGATTGG + Intergenic
999806314 5:155084666-155084688 TGTTTGTGCAGGGAAGAAACTGG + Intergenic
1001218766 5:169880989-169881011 GGTTTGGGATTTGAAAAATCTGG + Intronic
1002057644 5:176607841-176607863 GTTTTGTGCTTGGGCACAACTGG - Intronic
1004735889 6:18406201-18406223 GGTTTGTGCTATGGAAAAATAGG + Intronic
1006559480 6:34897498-34897520 AGTTTGTTCTTAGAAAAATCAGG + Intronic
1008777069 6:55052838-55052860 GATTTGGGCTTTGAAACAACAGG - Intergenic
1010284598 6:74060720-74060742 GGTTTGAGCATGGCAATAACTGG + Intergenic
1012127623 6:95451144-95451166 GGTTTGTAGATGGAAGAAACTGG - Intergenic
1014094826 6:117448241-117448263 GGTCTGTACCTGGCAAAAACAGG + Intronic
1014545222 6:122727365-122727387 GCTTGGTGCTGGGAGAAAACAGG + Intergenic
1014581227 6:123139725-123139747 GATTTGTGCTTGGAAATAGTGGG - Intergenic
1014739693 6:125134458-125134480 GGTTTGTGATAGCACAAAACTGG + Intronic
1014954646 6:127599934-127599956 GGTATGTGCTAGGAAAAGAAAGG - Intergenic
1015526400 6:134178177-134178199 GATTTGTGGTTGGAAAAGAAAGG + Intronic
1017899579 6:158707974-158707996 GGTTTGTGCTAAGAGAACACGGG + Intronic
1021150044 7:17139414-17139436 GGTTTGTGGTTGGATCTAACAGG + Intergenic
1024418048 7:49131277-49131299 GATTTGTGCTAGGAAAAATAAGG + Intergenic
1024472029 7:49774837-49774859 GGGTTGTGCTGGGAAAATGCGGG - Intronic
1027195960 7:76030399-76030421 GGTAAGTACTTGGAAAAAAGCGG - Exonic
1027262409 7:76474397-76474419 GGTTTCTGCTTGTAAAAGTCTGG + Intronic
1027313787 7:76972489-76972511 GGTTTCTGCTTGTAAAAGTCTGG + Intergenic
1028318672 7:89435180-89435202 GGTGTATGCTGGGAAAAAAATGG - Intergenic
1029036926 7:97532279-97532301 GGATTTTGCTTGGCAAACACAGG + Intergenic
1032299373 7:130672478-130672500 GGTCTGTGCTTTGAAGAAACAGG - Intronic
1032769811 7:135039898-135039920 CATTTGTGCTTGGAAAAGATTGG + Intronic
1033217084 7:139500987-139501009 GGTTTGGCTTTGGAAACAACAGG - Intergenic
1036040391 8:5073137-5073159 GGACAGTGCTTGGAACAAACAGG + Intergenic
1037378918 8:18263423-18263445 GATTTGTGCTGAGAAAAAAAAGG + Intergenic
1038057749 8:23876979-23877001 GGTTTGTGTTGGGAAATCACGGG + Intergenic
1038714772 8:29981782-29981804 GGTTGGTGCATGAAACAAACAGG - Intergenic
1038935466 8:32245101-32245123 GGTTTGTGCAGGGAAAAGTCTGG + Intronic
1039406470 8:37316955-37316977 GATTTGTGGTTGGACAAATCTGG + Intergenic
1039916056 8:41861114-41861136 GATGCGTGCTTGGAAAAGACAGG + Intronic
1041686582 8:60650836-60650858 GGTATTTGCTTTAAAAAAACTGG - Intergenic
1041854446 8:62434739-62434761 TGTTTGTGATTTGAAAAAAATGG + Intronic
1043060217 8:75491041-75491063 AGTTTGTGTTTGGAAAGTACAGG + Intronic
1047535309 8:125713867-125713889 GGTTTGAGCTTGTAAAAAAATGG + Intergenic
1050520846 9:6498355-6498377 GGGTTGTGCTTGGGAAAAGTTGG + Intronic
1052204261 9:25819789-25819811 GGATTGTGGTGGGAAATAACAGG - Intergenic
1052477645 9:28980920-28980942 GGTTTGTGCCTGGCATATACTGG + Intergenic
1053479435 9:38405068-38405090 GGTTTATGCATGGAGAAAAGAGG + Intergenic
1054702777 9:68430652-68430674 TTTTTATGCTTGGAAAAAAATGG - Intronic
1056276397 9:84998190-84998212 TGCTTGTGCCTGGAAAACACTGG - Intronic
1058177181 9:101749501-101749523 GGTTGGTGCTTTGAAAAAATAGG + Intergenic
1058645009 9:107123364-107123386 GCTTTCTGCATGGAAAAAATGGG - Intergenic
1059261886 9:112984960-112984982 GGTTCTTACTTGGAAAAAAAGGG + Intergenic
1060609277 9:124947449-124947471 GGCTTGTGTTTGGATAAAATGGG - Intronic
1060751690 9:126173869-126173891 AGTTTGTGCTTGGAAGGCACAGG - Intergenic
1185985997 X:4834426-4834448 AGTTTGTGTTTGGAGAAAAAGGG + Intergenic
1187285069 X:17897297-17897319 TGTTTGTGGTTTGAAGAAACGGG - Intergenic
1187680483 X:21762280-21762302 GGTTTGTGCATGGAAGAATAGGG - Intergenic
1189396213 X:40625069-40625091 CGTTAGTTCTTGGACAAAACAGG + Intergenic
1189427535 X:40914750-40914772 TGTTTGTAGTTGCAAAAAACTGG - Intergenic
1195354560 X:104026695-104026717 AGTTTGTGTTTTTAAAAAACAGG + Intergenic
1195845070 X:109218491-109218513 GGTTTCTGCTTTGAGCAAACAGG + Intergenic
1196900915 X:120381859-120381881 GGTTTGAGCTTGGCTAGAACCGG + Exonic
1197656579 X:129123089-129123111 GGTATGGGCTTAGAAAAAAAAGG + Intergenic
1197814983 X:130488673-130488695 GTTTTGTGCCTGGATAAAAAAGG + Intergenic
1199160136 X:144599527-144599549 GGTTTGAGATAGGAAACAACAGG - Intergenic
1199166936 X:144687473-144687495 GATTTATGCTTGAAAACAACTGG - Intergenic
1199355643 X:146860436-146860458 GGTTTGTCTTTAGTAAAAACAGG - Intergenic