ID: 1166364195

View in Genome Browser
Species Human (GRCh38)
Location 19:42270238-42270260
Sequence CCTCACAGGCAGAGCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 346}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166364195_1166364213 21 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364213 19:42270282-42270304 AGGGCAGGCCTGGGACTCCAGGG 0: 1
1: 0
2: 10
3: 63
4: 538
1166364195_1166364208 11 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364208 19:42270272-42270294 GGCCCAAGAAAGGGCAGGCCTGG 0: 1
1: 1
2: 1
3: 50
4: 401
1166364195_1166364203 1 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364203 19:42270262-42270284 CCCCAGGATTGGCCCAAGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 141
1166364195_1166364200 -10 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364200 19:42270251-42270273 GCCTGTGAGGACCCCAGGATTGG 0: 1
1: 0
2: 1
3: 15
4: 209
1166364195_1166364215 29 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364215 19:42270290-42270312 CCTGGGACTCCAGGGTCCACAGG 0: 1
1: 0
2: 16
3: 81
4: 532
1166364195_1166364209 12 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364209 19:42270273-42270295 GCCCAAGAAAGGGCAGGCCTGGG 0: 1
1: 0
2: 5
3: 26
4: 310
1166364195_1166364207 6 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364207 19:42270267-42270289 GGATTGGCCCAAGAAAGGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 147
1166364195_1166364212 20 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364212 19:42270281-42270303 AAGGGCAGGCCTGGGACTCCAGG 0: 1
1: 0
2: 5
3: 56
4: 511
1166364195_1166364205 2 Left 1166364195 19:42270238-42270260 CCCTCCAGGCTCTGCCTGTGAGG 0: 1
1: 1
2: 3
3: 30
4: 346
Right 1166364205 19:42270263-42270285 CCCAGGATTGGCCCAAGAAAGGG 0: 1
1: 0
2: 2
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166364195 Original CRISPR CCTCACAGGCAGAGCCTGGA GGG (reversed) Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
900357999 1:2273945-2273967 CCTGACCGGCAGCGCCAGGATGG + Intronic
900394776 1:2448759-2448781 CCACCCAGGGAGAGACTGGATGG - Intronic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900605822 1:3523112-3523134 CATCACAGGCAGGACCGGGAGGG + Intronic
900630236 1:3631220-3631242 CCACATAGGCAGAGCCAGGGTGG + Intronic
900719695 1:4167309-4167331 CCTCAAGGGCAGAGCCGGGGTGG - Intergenic
901019289 1:6247861-6247883 CCCCACAGCCAGGGACTGGAGGG + Exonic
902370913 1:16006252-16006274 CCTCACAGGCGCAGCCTTCACGG - Exonic
902777246 1:18682758-18682780 CTTCCCAGGCAGACCCAGGAGGG - Intronic
902793579 1:18785469-18785491 CTTCAGAGGCAGAGCTGGGATGG + Intergenic
904044892 1:27603186-27603208 CCTGGCAGGCAGCGCCGGGAAGG - Intronic
904586886 1:31585614-31585636 TCCCACAGGCAGCACCTGGAGGG + Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905768391 1:40622013-40622035 CCTCACAGGCACAGCCATGCTGG + Exonic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
911693750 1:100864066-100864088 TCTAAATGGCAGAGCCTGGATGG - Intergenic
911857382 1:102896879-102896901 GCCCAGAGTCAGAGCCTGGAAGG - Intronic
912373682 1:109193019-109193041 CTCCACAGTCACAGCCTGGATGG - Intronic
912379727 1:109240803-109240825 TCTGACAGGCAGAGCTGGGATGG + Intergenic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
914450455 1:147786952-147786974 GCTCAAAGGCAGAGCATGGCAGG + Intergenic
915100154 1:153493423-153493445 CCTCACACGCAAGGGCTGGAGGG - Intergenic
915116856 1:153606800-153606822 CCTCAAAGGCAGAGCAAGAAAGG - Intergenic
915318017 1:155040634-155040656 CTGCACAGGCAGAGCCTGGGGGG + Intronic
916407485 1:164511594-164511616 CCTCTGGGGCTGAGCCTGGACGG - Intergenic
917983312 1:180288503-180288525 ACTCACAGGCAGAGGCTGAAAGG + Exonic
919853252 1:201688188-201688210 GCACACAGGGAGAGCCAGGAAGG - Intronic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
922191242 1:223320448-223320470 CCACACAGGCATACCCTGGGTGG + Intronic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
923573519 1:235137800-235137822 CCTTCCAGGAAAAGCCTGGAAGG + Intronic
1062923768 10:1299227-1299249 ACCCACAAGCAGAGCCCGGAAGG + Intronic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1071462527 10:85912557-85912579 ACTGAAAGGCAGAGCCTGTAAGG + Intronic
1072392295 10:94999760-94999782 TCTCAGAGACAGAGCCTAGAAGG - Intergenic
1073026501 10:100490722-100490744 GCTCAAAGGCAAAGGCTGGATGG + Exonic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1074419179 10:113294009-113294031 CCTCTCTGGCAGGGCCTGGCTGG - Intergenic
1074819586 10:117168296-117168318 GCCCACAGGCAGAGCCGGGCGGG - Intergenic
1075088781 10:119431284-119431306 CCTCCCAGGTAGAGAATGGATGG - Intronic
1075622778 10:123939933-123939955 CCACACAGGCAGAGCTGGGTAGG + Intronic
1076103310 10:127800070-127800092 CCTCACAGACACACCCAGGATGG - Intergenic
1076106274 10:127826135-127826157 TCTCACAGGAAGTGCCTTGATGG + Intergenic
1076392039 10:130110603-130110625 CCTCACAGGCAGGGCCGCGCCGG + Intergenic
1076496420 10:130900486-130900508 ACTCAGAGGCAGAGGCTGCAGGG + Intergenic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1076613672 10:131742817-131742839 CCTCACAGGGAAAGCCAGGTGGG - Intergenic
1076762846 10:132614168-132614190 GTCCCCAGGCAGAGCCTGGACGG + Intronic
1076764370 10:132625065-132625087 TCTCACAGGCTGAGCCTTGGAGG + Intronic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077315732 11:1918634-1918656 CCCCACAGGCTGAGCGTGGGCGG - Intergenic
1077467148 11:2738761-2738783 CCACACAGACAGACCCTGGGGGG + Intronic
1077530954 11:3094511-3094533 CCCCACAGGGAGAGGCTGGTGGG + Intronic
1077776432 11:5277051-5277073 CTCCGCAGGCAGAGCCTTGATGG - Intronic
1077893333 11:6435552-6435574 CTTCAGAGGCTGAGCCCGGAAGG - Intronic
1078710563 11:13786928-13786950 CCTGACAGGAAGAGCCTGACAGG + Intergenic
1078932191 11:15921189-15921211 CCTCACAGGCTGGCCCTCGAGGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1083297323 11:61722022-61722044 CCTCAGGGGCTGAGACTGGAGGG - Intronic
1083714409 11:64567507-64567529 CCTCCCAGGCAGCTCCTGGTGGG + Intronic
1084189268 11:67491640-67491662 GCTCACAGGCAGGGTCAGGATGG - Intergenic
1084310048 11:68311868-68311890 TCACCCAGGCACAGCCTGGAAGG - Intergenic
1084330879 11:68429506-68429528 CCTCAGAACCACAGCCTGGAGGG - Intronic
1084615553 11:70233534-70233556 CCTCAGTTTCAGAGCCTGGAAGG - Intergenic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085305303 11:75482398-75482420 GATCAGAGGCAGAGCCTGGGTGG - Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1087153966 11:94883211-94883233 CCCCAGTGGCAGAGCCAGGAGGG + Intergenic
1088456340 11:110036570-110036592 CCACAGAGACAGAGACTGGATGG - Intergenic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1089659868 11:119978800-119978822 CCACACGACCAGAGCCTGGAGGG + Intergenic
1090382486 11:126337026-126337048 CCTCACACCTTGAGCCTGGAGGG - Intronic
1091345789 11:134853130-134853152 CCGCGCAGGCAGACCCTGCAGGG - Intergenic
1091385559 12:92453-92475 CCTCACAGCACGAGCCTGGGAGG - Intronic
1091548952 12:1523514-1523536 ACTCACAGACAGCTCCTGGAGGG - Intergenic
1091929702 12:4385587-4385609 CCTCTGGGGCAGAGCTTGGAAGG - Intergenic
1092732373 12:11547014-11547036 CAGCACAGGCGGAGCCTGGAGGG + Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096553782 12:52390950-52390972 CCTCACTGGCACATTCTGGAGGG + Intergenic
1096694018 12:53337528-53337550 CCTGACAGGGAGAGCTGGGAGGG - Intronic
1098918933 12:76285286-76285308 CCTCACAGGCAGAGACGCTATGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101745528 12:107538643-107538665 CCAAGCAGGAAGAGCCTGGAGGG - Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102027545 12:109722109-109722131 TCTGACGGGCAGAGCCAGGAAGG + Intronic
1102229333 12:111251743-111251765 CCCCTCAGCCAGAGCCTGGGTGG + Intronic
1103920040 12:124394612-124394634 AGACAAAGGCAGAGCCTGGAGGG + Intronic
1103991527 12:124802602-124802624 CTTCAGAGGCCGAGCCTGCATGG + Intronic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1105577180 13:21664745-21664767 CTTCACAGGGAGAACCTGGTAGG + Intergenic
1105745803 13:23375757-23375779 CCTGGCAGGCGGAGCCTGGTGGG - Intronic
1106146370 13:27053300-27053322 CTTCCCAGGCAGCTCCTGGAAGG + Intergenic
1106244977 13:27941330-27941352 CCTCACAGGAAGATACTGCATGG + Intergenic
1110072909 13:71200634-71200656 CCTCACAGTCATAGCCTTTAAGG - Intergenic
1111243940 13:85509926-85509948 CCTCTCAGACAGAGCCATGAGGG + Intergenic
1113580301 13:111423979-111424001 CCTAAAACGCAGTGCCTGGAAGG - Intergenic
1113735639 13:112677255-112677277 CATCACAGGCAGAGATTGAATGG + Intronic
1113747732 13:112756632-112756654 CCTCACCTGGAGAGCCTGGACGG + Intronic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1119229082 14:72966175-72966197 CAACACAAGCAGAGCCTGAATGG - Intergenic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1119880080 14:78092905-78092927 CCTCACCCCCAGAGCCTGGCTGG - Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1122022783 14:98853219-98853241 CCCCTCAGTCAGTGCCTGGATGG - Intergenic
1122141295 14:99664422-99664444 TCACAGAGGCAGGGCCTGGAAGG + Intronic
1124112876 15:26808308-26808330 CCACACAGCCAGGGCCTGGGAGG + Intronic
1124632361 15:31345014-31345036 CCTGACCCACAGAGCCTGGAAGG - Intronic
1124689080 15:31806832-31806854 CCCCAGAGGCAGAGCACGGACGG - Intronic
1124945567 15:34262514-34262536 CTCCACTGGCAGAGCGTGGAGGG - Intronic
1128464992 15:67903004-67903026 GCACACAGGCAAGGCCTGGAAGG - Intergenic
1128684764 15:69675648-69675670 CCTGAAAGGCAGAGCCTCGCAGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129315375 15:74739906-74739928 CTTCACAGACAGGGTCTGGAGGG + Intergenic
1129335159 15:74847658-74847680 GCTGACAGCCTGAGCCTGGAAGG - Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131322432 15:91407426-91407448 GCTCTCAGGGAGAACCTGGAAGG + Intergenic
1132233813 15:100204290-100204312 TCTCAAAGGCAGACCCTGTAAGG - Intronic
1132519843 16:381996-382018 CCCCGCAGGCCGAGCCGGGAAGG + Intronic
1132690067 16:1178204-1178226 GATCCCAGGCAGAGCCGGGAGGG - Intronic
1132804562 16:1769545-1769567 CTGCCCAGGCAGAGCCTGGGGGG - Exonic
1133779241 16:8924456-8924478 CTCTACAGGCAGTGCCTGGAAGG + Intronic
1133932710 16:10245168-10245190 CCTCAGAGGCAGAGCAAGCAGGG - Intergenic
1134421486 16:14095110-14095132 CCTGAAAGGCAGTGCATGGAAGG + Intronic
1135265400 16:21021358-21021380 CCTCACAGGGATATCCTAGAGGG - Intronic
1135913261 16:26580165-26580187 GAGCACTGGCAGAGCCTGGAGGG - Intergenic
1136621030 16:31428308-31428330 CCTCAGAGGCAAAGCCATGATGG + Exonic
1136716299 16:32286437-32286459 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1136834685 16:33492715-33492737 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1137793599 16:51196186-51196208 ACTGACAGGCAGGTCCTGGAGGG + Intergenic
1138391740 16:56675539-56675561 CCTCAGAGGAGGAGCATGGAGGG + Intronic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1140692697 16:77499489-77499511 CCTGACAGGCTGAGCAGGGACGG + Intergenic
1141436717 16:84003852-84003874 CCTCAGGCACAGAGCCTGGAGGG + Intergenic
1141506428 16:84481425-84481447 CCTCACAGGCAGCACCCGGCAGG - Intronic
1141914570 16:87086321-87086343 CCTCACAGGCCCACCATGGAAGG + Intronic
1141996768 16:87640986-87641008 CCTCACAACCCCAGCCTGGAAGG + Intronic
1142033795 16:87851670-87851692 ACACACAGGCAAAGCCTCGAGGG + Intronic
1142231038 16:88900424-88900446 CCTCAGCGGCAGAGCCAGGGAGG + Intronic
1203010118 16_KI270728v1_random:231317-231339 ACCCACAGGCAGACCCTGGGAGG + Intergenic
1203144854 16_KI270728v1_random:1793003-1793025 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1142491827 17:284574-284596 CCCCACTGGGAGAGCATGGAGGG - Intronic
1143167132 17:4902366-4902388 CCTCCCAGGCAGCGCCAGGTGGG - Exonic
1143379059 17:6484439-6484461 TTTCAGAGGCAGGGCCTGGATGG - Intronic
1143777127 17:9206674-9206696 TCTCACAGGAGGAGCCAGGAAGG - Intronic
1145056786 17:19708199-19708221 CGGCACAGGCAGGGCCAGGATGG + Intronic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146062529 17:29614613-29614635 CCTCACTGGCTGAGCCGGGAAGG - Exonic
1148132496 17:45270537-45270559 CCTCACAGGCGGAGGCTCGCTGG + Exonic
1148446611 17:47741724-47741746 CTCCACAGGCAGTTCCTGGAAGG - Intronic
1150445419 17:65224397-65224419 CCCCTCAGGCAGAGCCGGGGTGG - Intronic
1151455241 17:74222000-74222022 CCACTGAGGCAGGGCCTGGAAGG - Intronic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1152779616 17:82220392-82220414 CCTCACAGGCAGCCCCTGCCTGG + Intergenic
1154360143 18:13654081-13654103 CTTCAGAGGCACAGCCTGCATGG - Intergenic
1157199999 18:45651982-45652004 CCTGACAGGCAGATCTTAGAGGG - Intronic
1157859100 18:51124949-51124971 CCTGACAGGCAGGGCTTGCAGGG + Intergenic
1157877592 18:51287978-51288000 CCTCACAGTTAGGCCCTGGAGGG + Intergenic
1159535367 18:69707984-69708006 CAGCACAGGCAGAGCACGGATGG + Intronic
1159559537 18:69978747-69978769 CCTCACAGACACACCCAGGATGG + Intergenic
1161010549 19:1957643-1957665 CCACACAGGCAGAGACTGGAGGG + Intronic
1161194088 19:2976720-2976742 CCTCTCAGGCAGAGCTGGGCTGG - Intergenic
1161340591 19:3739850-3739872 CCTCACAAGAAGAGGCGGGAGGG - Intronic
1162531388 19:11238181-11238203 ACTGACCGGCAGAGCCTGGCTGG + Exonic
1163055195 19:14712690-14712712 CAACACAGGCAGAGACGGGAGGG - Intronic
1163150033 19:15405977-15405999 CCTCCCAAGCAGAGCCCTGATGG - Intronic
1163175603 19:15562366-15562388 GCTCACAGTCAGAGCAAGGACGG + Intergenic
1164462940 19:28464173-28464195 CCTCAAAGGCAGAGCTGGAAGGG + Intergenic
1164595071 19:29526926-29526948 CCGCACCGCCAGAGCCTGGCTGG - Intronic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165314789 19:35048212-35048234 CCGCACAGTGAGAGCCAGGATGG + Intronic
1165778678 19:38419854-38419876 CCTCACCGTGATAGCCTGGAAGG + Exonic
1165936160 19:39390259-39390281 CCTCTCAGGCAGAGTCCGGTGGG + Exonic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166422728 19:42651390-42651412 CCTCAGTGTCAGAGCCTGGATGG + Intronic
1167011725 19:46813190-46813212 CCTCCCAGGAGGGGCCTGGAGGG + Intergenic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1168297038 19:55382380-55382402 CCTGACAGGGAGTGCCTTGAGGG - Intronic
1168310292 19:55456561-55456583 CCTCACACTCAGAGCCTGGCAGG + Intronic
925051486 2:819176-819198 CCTCACAGGCAGTCCCAAGACGG + Intergenic
925082358 2:1080314-1080336 AGTCACAGGCAGTGTCTGGAAGG - Intronic
926057045 2:9779899-9779921 CATCACAGGCAGAGGCAGGCTGG - Intergenic
926121529 2:10243636-10243658 CCACACAGGCAGAGCAGGGCTGG + Intergenic
926987207 2:18638273-18638295 CCTCACAGACACACCCAGGAAGG - Intergenic
928321026 2:30282980-30283002 CCTCATATGCAGAGCCCTGAAGG + Intronic
928394734 2:30934745-30934767 GCTCAGAGGCAGAGCGTTGAGGG - Intronic
929245826 2:39702353-39702375 CCCCACTGGCAAAGACTGGAAGG - Intronic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
930199618 2:48540527-48540549 GCACCCAGGCAGAGCATGGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
932206676 2:69889513-69889535 CCACACAGGCAGAGATTGGATGG - Intergenic
932460028 2:71876078-71876100 CCTCCCAGCCAGAACCTGCAGGG + Intergenic
933357346 2:81228649-81228671 CCTCAGAGTCTGAGGCTGGAGGG + Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
933906731 2:86901401-86901423 CCACACAGGCACAGGCAGGAAGG + Intergenic
934708272 2:96499699-96499721 CCACTCAGGCAGCGGCTGGAGGG - Intronic
935033121 2:99341427-99341449 CCCCACAGGGACAGCATGGAAGG - Intronic
935775819 2:106470310-106470332 CCACACAGGCACAGGCAGGAAGG - Intergenic
936365431 2:111850270-111850292 CCACACAGGCACAGGCAGGAAGG - Intronic
937438364 2:121897321-121897343 CCTCACAGGCTTAGCCTCCAGGG - Intergenic
937729771 2:125214597-125214619 CATGACAAGCAGAGCCAGGAAGG - Intergenic
938236007 2:129707901-129707923 TCCCACAGGCAGAGACAGGAGGG + Intergenic
938619011 2:133030295-133030317 CCTCACACTCAGTGCCTGCAAGG + Intronic
939135227 2:138285673-138285695 CCACAGAGGCAGAGATTGGATGG - Intergenic
939525422 2:143287890-143287912 CCTGAAAGGCATAGCCTGCAGGG - Intronic
942061602 2:172233038-172233060 CCTCAGAGACAGTGCCTGGGTGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
947603252 2:231467677-231467699 CTTCAGTGGAAGAGCCTGGAAGG - Intronic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
947794286 2:232884547-232884569 TCCCACAGGCAGAGCTTGGTGGG - Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
948789197 2:240368686-240368708 CAAGACAGGCAGAGCCTGGAGGG + Intergenic
948878190 2:240841296-240841318 GGCCACAGGCAGATCCTGGAAGG - Intergenic
948911005 2:241002652-241002674 CCTCACAGGCAGCCCCTGAGAGG + Intronic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170538241 20:17362943-17362965 CCTCACAGCTAGAACCGGGAAGG + Intronic
1172718838 20:36983933-36983955 TCTAACAAGCAGAGCCTGGAGGG - Intergenic
1172775625 20:37405033-37405055 CCCCACTGGCAGGGCCTGGCTGG - Exonic
1173132558 20:40408373-40408395 CCTCAGAGGAAGAACCTGGGTGG - Intergenic
1173553061 20:43946769-43946791 CCTCCCAGGCACAGCTGGGATGG - Intronic
1173844402 20:46178843-46178865 CCTAAGAGGCTGAGCCTAGAGGG + Intronic
1174187663 20:48718168-48718190 CCTGAATGTCAGAGCCTGGAGGG - Intronic
1174614276 20:51823967-51823989 TCTCAGAGGTAGAGCCTCGAGGG - Intergenic
1174619689 20:51864604-51864626 CCTTCCAGGTAGAGCCTGGGTGG - Intergenic
1175414404 20:58792416-58792438 TCTGCCAGCCAGAGCCTGGATGG + Intergenic
1175507124 20:59494001-59494023 CCTGAAAGCCAGAGCCTGGTTGG - Intergenic
1175605818 20:60311524-60311546 CCTCACAAACACAGCCTAGAAGG - Intergenic
1175650219 20:60715387-60715409 GATCCCAGGCAGAGCCTGGTGGG - Intergenic
1176151493 20:63593607-63593629 ACCCACAGGAAGAGCCAGGACGG - Intronic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1179878767 21:44284885-44284907 CCCCGCAGGCATGGCCTGGAGGG - Intergenic
1180198845 21:46213038-46213060 CCTCACAGGATGGGCCTTGACGG - Exonic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1181065999 22:20306344-20306366 CCTCTCATGCAGGGCCGGGAGGG - Intergenic
1181098750 22:20524560-20524582 CCCCACAGTCAGAGTATGGATGG - Intronic
1181632274 22:24157411-24157433 CATCACAGACAGAGCCAGGCCGG - Intronic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1181811523 22:25406105-25406127 TCACCCAGGCACAGCCTGGAAGG + Intergenic
1182546936 22:31081945-31081967 CCTAACAGGCAGAGATTGGGAGG + Intronic
1184330498 22:43824154-43824176 GCTCCCAGGCAGAGACTGGGAGG + Intergenic
1184445425 22:44544340-44544362 GCTGAGAAGCAGAGCCTGGAGGG + Intergenic
1185155608 22:49191784-49191806 CCTCACACCCAGAACCTGGGTGG - Intergenic
1185265598 22:49901041-49901063 GCACACAGGCAGAGCATGGCAGG + Exonic
1185281521 22:49971929-49971951 CCCCACAGCCAGACGCTGGACGG - Intergenic
950710135 3:14808071-14808093 CTTCTCTGGAAGAGCCTGGAAGG - Intergenic
952233234 3:31453578-31453600 CCTCACCACCACAGCCTGGAGGG - Intergenic
952860165 3:37806475-37806497 CCTGAGAGGCAGAGCCAGGTGGG - Intronic
954347565 3:50013134-50013156 CCTCAAAGGAAGAGTCTGGTGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955137706 3:56236376-56236398 CTTCACATTCAGGGCCTGGATGG - Intronic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
956710492 3:72034940-72034962 CCTCAGAAGCACAGCCTGCAGGG - Intergenic
958491313 3:94777317-94777339 ACTCACTGGCAAAGCCTTGAAGG + Intergenic
960055233 3:113272402-113272424 CCTCAGCGGTGGAGCCTGGAGGG - Exonic
960621940 3:119645649-119645671 CTTCACAGGCATAGAATGGAGGG + Intronic
961159530 3:124711511-124711533 CCTCATGGGCAGGGCTTGGATGG + Intronic
961237008 3:125375526-125375548 CCTCCCAGGCCCAGCCTGGGGGG - Intergenic
961665917 3:128493012-128493034 GCTCACCAGCAGAGCCTGGGCGG + Exonic
961825240 3:129595798-129595820 CCAAACAGGCATGGCCTGGAAGG + Intronic
962732112 3:138293039-138293061 CATCCCTGGCAAAGCCTGGAGGG - Intronic
963909291 3:150801141-150801163 CCCCACAGTCATAGCCTGGCTGG + Intergenic
965737278 3:171834536-171834558 TATCACAGGCAGAGCCAGCAAGG - Intergenic
965786651 3:172342199-172342221 CCTCACAGGCAGTGTCTACATGG - Intronic
966736456 3:183190681-183190703 CCTCACAGGCATTTCCTGGCTGG + Intronic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
968649846 4:1756198-1756220 CGCCACAGGAAGAGCCGGGAAGG - Intergenic
968817990 4:2831630-2831652 CCTCACAGGCTGACACTGGCGGG + Exonic
968832331 4:2939389-2939411 CCTCTCAGCCAGAGCCTGCTTGG + Intronic
969137895 4:5045187-5045209 CCGCTCAGGCAGAGCCTGGCAGG - Intergenic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969388550 4:6873469-6873491 CCTCTCAGGAAGAGCTAGGAGGG + Intronic
969523919 4:7694572-7694594 CATCACAGGCGGAGCCGGGCAGG - Intronic
969992159 4:11275826-11275848 CCTCACTGGCAGAGCTTTAATGG - Intergenic
970099346 4:12503055-12503077 CTTCAGAGGCAGAGCCTTCATGG - Intergenic
970542737 4:17095907-17095929 CTCCACAGGGGGAGCCTGGATGG - Intergenic
971004385 4:22357196-22357218 CCCCTCAGGCAGAGGCTGGCAGG - Intronic
972271789 4:37517943-37517965 ACTCACAGACAGAGCATAGAAGG - Intronic
973857944 4:55032415-55032437 CCTCACCGGCAGAGCTGGGATGG + Intergenic
976090904 4:81456596-81456618 ATTCCCAGGCAGAGCCTGGGTGG - Intronic
978323230 4:107521568-107521590 CCACAAGGGCAGAGCCTGTATGG - Intergenic
980914936 4:139025202-139025224 TCTCACAGACAAAGCCGGGAAGG - Intronic
984922978 4:184782039-184782061 CCCCATAGGCAGGGCCAGGATGG - Intronic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
985521156 5:374416-374438 CGTCTCTGGCTGAGCCTGGAGGG + Intronic
985778529 5:1857728-1857750 CCGCTCAGCCAGAGCCAGGAGGG + Intergenic
990097154 5:52130973-52130995 CCGTACAGACAGAGCATGGAAGG + Intergenic
991295747 5:65078468-65078490 ACTCCCATGGAGAGCCTGGAAGG + Intergenic
991474431 5:67004334-67004356 CCTCCCAGCCGGACCCTGGAAGG + Intronic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
996773975 5:127115093-127115115 CCTCACAGGCAGCCCCTGCTTGG + Intergenic
997677443 5:135723649-135723671 GCTTACAGGCAGGCCCTGGAAGG - Intergenic
999311711 5:150555723-150555745 CCTCTCTCGCAGAGCATGGAAGG + Exonic
999331202 5:150674517-150674539 CCTCACAGGAACAGGCTGGGTGG - Intronic
999700031 5:154219427-154219449 TCACACAGGCACAGCCTGAAAGG - Intronic
999748827 5:154611123-154611145 CCTCACCGTCAGCTCCTGGAGGG + Intergenic
1000037809 5:157461996-157462018 ACTCCCAGGCAGTGCCTGGAAGG - Intronic
1000506091 5:162120006-162120028 CCTCTCAGACAGAGGCTGGTGGG + Intronic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001686177 5:173596602-173596624 CCACACAGGTAGAGCCTTGCTGG + Intergenic
1001963305 5:175893705-175893727 GCTGACTGCCAGAGCCTGGAGGG - Intergenic
1001963686 5:175895484-175895506 CCTCACACGGACAGGCTGGAAGG + Intergenic
1004706992 6:18133926-18133948 CTACACAGGCAAAGGCTGGAGGG + Intronic
1005400053 6:25422863-25422885 CCTCAGGGGCAGAGCAAGGAGGG - Intronic
1005989069 6:30892172-30892194 ACTCACCTGCATAGCCTGGAAGG - Exonic
1013233184 6:108175167-108175189 CCACACAGGCAGCGCTTGGGGGG + Intronic
1014820763 6:125986459-125986481 CCACAGAGACAGAGCCTGAAGGG - Exonic
1015784126 6:136903271-136903293 ACACACAGACAGAGACTGGATGG - Intronic
1017742497 6:157419169-157419191 CATCACAGCCAAAGACTGGAGGG - Intronic
1017845324 6:158253266-158253288 CCTCACACCTAGATCCTGGAGGG - Intronic
1018319762 6:162595096-162595118 CCTGAGAGGCAGAGCTTGCAGGG + Intronic
1019028835 6:168993426-168993448 CCCAACAGGCAGAGGCTGCAGGG - Intergenic
1019320971 7:415132-415154 TCACCCAGGCTGAGCCTGGAGGG - Intergenic
1019320988 7:415189-415211 TCACCCAGGCTGAGCCTGGAGGG - Intergenic
1019532086 7:1508705-1508727 AGTCAGAGGCAGAGGCTGGAGGG - Intergenic
1019576001 7:1737945-1737967 TCCCACAGGCAGGGCCTGGAGGG - Intronic
1019594654 7:1852856-1852878 CCGCACGTGCTGAGCCTGGAAGG + Intronic
1021508667 7:21411759-21411781 CCTCACAGCCCCAGCCTGGAGGG + Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1023991629 7:45132210-45132232 CCTCACAGCCAGAGACTTGGAGG + Intergenic
1025149968 7:56540125-56540147 CCTCTCAGGCAGGGCATGGTTGG + Intergenic
1026846107 7:73699990-73700012 CCCCACAAGCAGAGCCCTGAGGG - Exonic
1026983904 7:74542814-74542836 ACTCACAGCCAGAGGCTGGGTGG + Intronic
1027305781 7:76895128-76895150 TCTTACAGGCAGGGTCTGGACGG + Intergenic
1029572485 7:101379387-101379409 CCCATCAGGCAGAGCCAGGACGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031154629 7:118095239-118095261 CCTCACATCCAGAACCTAGAAGG + Intergenic
1034531940 7:151701223-151701245 CAGCACAGGTAGAGACTGGAGGG - Intronic
1034738882 7:153454982-153455004 CCTCCCAGGAAATGCCTGGATGG + Intergenic
1034970719 7:155417753-155417775 ACTCACGGGCAGGGCATGGAGGG - Intergenic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037774582 8:21824993-21825015 CCACATGGGCAGAGCCTTGAGGG - Intergenic
1039610930 8:38918907-38918929 TCTCACTGGCAGATCCTGGCTGG - Intronic
1039847623 8:41336915-41336937 CCTCAGAGTCTGAGCCTGCATGG - Intergenic
1039925957 8:41932680-41932702 CCTCACACGCAGAGATTGCAAGG - Exonic
1042557048 8:70042541-70042563 CCAGGCAGCCAGAGCCTGGAGGG + Intergenic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044581135 8:93827469-93827491 CCTCCCAGGCTGAGCCTGGTAGG - Intergenic
1045249976 8:100475023-100475045 CCTCACTGACAGAGATTGGAGGG + Intergenic
1047717760 8:127611300-127611322 ACACAGAGGCAGAGACTGGAGGG + Intergenic
1047735410 8:127760912-127760934 CCTCCAGGGCAGAGCCAGGATGG - Intergenic
1049458219 8:142705734-142705756 ACACACAGGCAGAGCCTGACAGG - Intergenic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1049839379 8:144761240-144761262 CCTCCCAGGCCGAGCCCTGATGG - Intergenic
1051748160 9:20315538-20315560 CCTCACAGTCAGGGCCTGCAGGG - Intergenic
1053034478 9:34812581-34812603 CCTCAGAGACAGAACCTGAATGG - Intergenic
1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG + Intronic
1053464444 9:38295133-38295155 CCCCACAGAGAGGGCCTGGAGGG + Intergenic
1056480506 9:86998958-86998980 CTTCTCAGGCAGAGCTTGAAAGG - Intergenic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1060520068 9:124289319-124289341 CTGCAGAGGCAGAGCTTGGATGG - Intronic
1060747656 9:126148313-126148335 CTTCACAGGCAGAACCTGAGAGG + Intergenic
1060763575 9:126276186-126276208 CCTCAGAGCCAGAGCCAGGGAGG - Intergenic
1061234421 9:129334332-129334354 CCTTCCAGGCAGAGCCTTCAGGG - Intergenic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1062368606 9:136224482-136224504 CCTCACAGGCAGAGCCCCCCAGG + Intronic
1062726418 9:138076499-138076521 AGTAACAGGCAGAACCTGGAGGG + Intronic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1188985123 X:36762228-36762250 CCTGATAGGCAGTGCCTGGGTGG - Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1190007472 X:46754560-46754582 GCTCATAGGCAGAGTCTGAAGGG - Intronic
1192260851 X:69505164-69505186 CCCCCGAGGTAGAGCCTGGACGG + Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1195577693 X:106468806-106468828 CCACAGGGGCAGAGCCTGGATGG + Intergenic
1198104055 X:133445847-133445869 TCTCAAAGCCAGAGACTGGAAGG - Intergenic
1198235695 X:134734304-134734326 TCTCAGAGGCAAAGCCTGGCTGG + Intronic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic