ID: 1166364497

View in Genome Browser
Species Human (GRCh38)
Location 19:42271813-42271835
Sequence TGCCACTGCCAGGACCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 192}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166364497_1166364503 7 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364503 19:42271843-42271865 CCCCCCAGCCACCAGGGCCAAGG 0: 1
1: 0
2: 4
3: 63
4: 516
1166364497_1166364514 24 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364514 19:42271860-42271882 CCAAGGCTCTGAGGCGGCGAGGG 0: 1
1: 0
2: 2
3: 5
4: 137
1166364497_1166364511 18 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364511 19:42271854-42271876 CCAGGGCCAAGGCTCTGAGGCGG 0: 1
1: 3
2: 9
3: 117
4: 640
1166364497_1166364499 0 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364499 19:42271836-42271858 GCAAGTCCCCCCCAGCCACCAGG 0: 1
1: 0
2: 4
3: 29
4: 365
1166364497_1166364512 23 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364512 19:42271859-42271881 GCCAAGGCTCTGAGGCGGCGAGG 0: 1
1: 0
2: 1
3: 14
4: 192
1166364497_1166364515 25 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364515 19:42271861-42271883 CAAGGCTCTGAGGCGGCGAGGGG 0: 1
1: 0
2: 2
3: 4
4: 170
1166364497_1166364517 30 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364517 19:42271866-42271888 CTCTGAGGCGGCGAGGGGCTGGG 0: 1
1: 0
2: 3
3: 27
4: 312
1166364497_1166364500 1 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364500 19:42271837-42271859 CAAGTCCCCCCCAGCCACCAGGG 0: 1
1: 0
2: 2
3: 28
4: 527
1166364497_1166364516 29 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364516 19:42271865-42271887 GCTCTGAGGCGGCGAGGGGCTGG 0: 1
1: 0
2: 3
3: 36
4: 375
1166364497_1166364509 15 Left 1166364497 19:42271813-42271835 CCTTTCAGGTCCTGGCAGTGGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1166364509 19:42271851-42271873 CCACCAGGGCCAAGGCTCTGAGG 0: 1
1: 0
2: 6
3: 46
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166364497 Original CRISPR TGCCACTGCCAGGACCTGAA AGG (reversed) Intronic
900540787 1:3201671-3201693 AGCCACTTCCAGCACCTGCAGGG + Intronic
900645422 1:3706715-3706737 AGCCTCTGCCAGGAGCTTAAGGG - Intronic
900739237 1:4320653-4320675 TTCCACTGCCCTGCCCTGAAAGG + Intergenic
900967016 1:5965871-5965893 TGGCACTGGCAGGACCCGAGGGG - Intronic
901017119 1:6238213-6238235 AGCTCCTGCCAGGACCTGCAGGG - Intergenic
901018032 1:6242698-6242720 TGCCGCTGCCTCGGCCTGAAAGG + Intergenic
901192739 1:7422244-7422266 TGCCCATGCTAGGAGCTGAAGGG + Intronic
901323881 1:8355788-8355810 TGCCTCTGCCTGGACCTGCCTGG + Intronic
901363810 1:8728070-8728092 AGGAACTGCCAGGAGCTGAAAGG - Intronic
902955954 1:19924136-19924158 AGCGACTCCCAGGCCCTGAACGG - Intergenic
903263875 1:22144955-22144977 GCCCACTGCCAGGACCTGCGTGG - Intergenic
903543499 1:24109825-24109847 TGCCACGGCCTGGCCTTGAATGG - Intronic
903920676 1:26798017-26798039 TGCCCTAGCCAGGACCAGAAGGG - Exonic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
907118747 1:51990668-51990690 CGCCACTGTGAGGACCTGACCGG - Exonic
907416598 1:54318696-54318718 TGCCACTTCCTGCATCTGAAGGG - Intronic
913140717 1:115938818-115938840 TGCCCATGCCAGGAACTGAATGG + Intergenic
914470527 1:147973739-147973761 TGCCTGTGCCATGTCCTGAATGG + Intronic
915064779 1:153215795-153215817 GTCTACTGCCAGGACCTCAATGG + Intergenic
916677702 1:167077541-167077563 TGCCACTGGCAGAACCTAAATGG + Intronic
917116812 1:171611628-171611650 CCCCACTGCCTGGACCTGCAGGG + Intergenic
919132122 1:193464627-193464649 TGCTACAGCCAGTACCAGAAGGG - Intergenic
919523119 1:198613959-198613981 TGCCAATACCAGGACTTGAAAGG + Intergenic
920049017 1:203152185-203152207 TGGCACAGCCTGGACCAGAATGG + Intronic
920206025 1:204292690-204292712 TGCCAGTGGCAGCACCTGAGAGG + Intronic
923470121 1:234282754-234282776 TGCCAATGCCAGGCCCAGAGAGG - Intronic
1063432083 10:5999647-5999669 TGTCCCTGCCAGGAACTGAACGG - Intergenic
1067569343 10:47360193-47360215 TGCCTCTGCCAGGCTCTGTAAGG + Intergenic
1068833097 10:61520536-61520558 TGCCACTGCAAACACCTGCATGG - Intergenic
1069739359 10:70677692-70677714 TACCACTCCCAGGGCCTGGAGGG - Intronic
1071260264 10:83913015-83913037 TGCCACTGCTAGAACGTGCAGGG + Intergenic
1072038877 10:91589352-91589374 TGCCCTTGCCAGGGCCTGGAGGG - Intergenic
1072296848 10:94017035-94017057 AGCAAATCCCAGGACCTGAATGG - Intronic
1074931278 10:118128696-118128718 TGACAAAGCCAGGGCCTGAAAGG + Intergenic
1076126986 10:127982805-127982827 TGCCATTGCCTGGACCCAAAAGG - Intronic
1076132999 10:128026522-128026544 TATCACTGCAGGGACCTGAATGG - Intronic
1077468120 11:2743355-2743377 GGCCTGTGCCAGGGCCTGAAGGG - Intronic
1077485650 11:2837346-2837368 GGCCACTCCCTGGGCCTGAAGGG - Intronic
1077499840 11:2904334-2904356 AGCCTCTGCCAGGCCCGGAATGG - Intronic
1078985046 11:16585756-16585778 TGCCACAGCCAGGACCTTCCAGG + Intronic
1079144590 11:17839459-17839481 TGCCACTCTCAGCACCTGAAAGG + Intronic
1079533674 11:21485494-21485516 TGCCACTGCCAGACCAGGAAGGG + Intronic
1081021013 11:37947775-37947797 TGCCACTGCCAGGCCAGGGATGG - Intergenic
1085254123 11:75162789-75162811 GGCCCCTGCCAGGCCCTGAGAGG - Intronic
1088172826 11:107017821-107017843 TGCCACTGCCGGGGCCAGGAGGG - Exonic
1089353142 11:117832664-117832686 TGCCACTGACATGGCTTGAATGG + Intronic
1091154583 11:133361412-133361434 CGACACCGCCAGGACCTGGAGGG - Intronic
1091648075 12:2288813-2288835 TGCCACTGCCAGCACCCAAAAGG + Intronic
1091727917 12:2858411-2858433 TGTCCCTGCCAGGAGCTGAAGGG - Exonic
1091741878 12:2965011-2965033 AACCACTGCCAGGACCTGGAAGG + Intronic
1092259598 12:6945940-6945962 TGCCACTGCCAGGGGAGGAAAGG + Exonic
1093618062 12:21252298-21252320 TCCCACTGCCTGGTCCTGTAAGG + Intergenic
1096110832 12:49028131-49028153 TGGCCCTGGCAGAACCTGAATGG - Exonic
1100685448 12:96982493-96982515 TGCCATGGCCAGAACCTGTATGG - Intergenic
1100714793 12:97294359-97294381 TGCCAGTGCCAGCTCCTGATGGG + Intergenic
1105472675 13:20706255-20706277 CTCCATTTCCAGGACCTGAAGGG + Intronic
1109914285 13:68960211-68960233 TTCCACTGCCAAGACATGGAGGG - Intergenic
1112431549 13:99354867-99354889 TGCAACAGCAAGGACCTAAACGG + Intronic
1112563513 13:100533607-100533629 TCAGACTGCCAGGACCTGAGTGG - Exonic
1113224050 13:108139954-108139976 GGCCTCTGACAGGACCTGGAAGG - Intergenic
1113879880 13:113618984-113619006 TGCAACTCCCAGGGCCTGCAGGG - Intronic
1114830797 14:26139282-26139304 TGCTACTGTCAGGATCTGAAGGG + Intergenic
1120797903 14:88655546-88655568 TGCCCATGCCAAGTCCTGAATGG - Intronic
1121736975 14:96225555-96225577 AGCGACTCCCAGGAGCTGAAAGG + Intronic
1122482165 14:102054321-102054343 TGCCACATCCAGGGCCTGAAGGG + Intergenic
1123055435 14:105567073-105567095 TGCCATTCCCAGGCCCTGCAGGG + Intergenic
1123079887 14:105686917-105686939 TGCCATTCCCAGGCCCTGCAGGG + Intergenic
1123632881 15:22274309-22274331 TGCCACAGCAAGGACCGGGAAGG - Intergenic
1123893717 15:24807350-24807372 TGCCACAGCCAGGACTTTGATGG - Intergenic
1124144559 15:27111970-27111992 TTCCTCTGCCAGGACCAGGAGGG + Intronic
1124292150 15:28463124-28463146 TTCCACTGCCAGTACTTGGAAGG - Intergenic
1125932132 15:43607919-43607941 TGGCAATGCCAGAACCAGAATGG - Exonic
1125945231 15:43707393-43707415 TGGCAATGCCAGAACCAGAATGG - Intergenic
1127626327 15:60783757-60783779 AGGTACTTCCAGGACCTGAATGG - Intronic
1127827623 15:62718859-62718881 TGTCACTACCAGGAAATGAAAGG + Intronic
1128600279 15:68990086-68990108 GGCCTGTGCCAGGACCTGGAGGG - Intronic
1130562854 15:84972136-84972158 TGGCACTGCCAGAGCCAGAATGG + Intergenic
1130650924 15:85761684-85761706 TACCACTCCGAGGCCCTGAAAGG + Intronic
1130657279 15:85800564-85800586 TGCCACTGCCTTGCCCTGAGTGG - Intergenic
1132270508 15:100520083-100520105 GCCCACTTCCAGGACCTGCATGG + Intronic
1132331016 15:101012684-101012706 GGCCACTGCCAGGACCCCCACGG + Intronic
1132457660 16:33059-33081 CTCCACTGCCTGGACCTGGACGG - Intergenic
1136717230 16:32290341-32290363 TGTCACTGCCGAGACCTTAACGG - Intergenic
1136835605 16:33496595-33496617 TGTCACTGCCGAGACCTTAACGG - Intergenic
1140762710 16:78125485-78125507 TGCCACTCCCAGCACTTGACCGG - Intronic
1141778583 16:86141344-86141366 AGCCATAGCCAGCACCTGAACGG + Intergenic
1141970180 16:87476458-87476480 TGCCACAGCAAGGACCGGGAAGG + Intronic
1203009199 16_KI270728v1_random:227437-227459 TGTCACTGCCGAGACCTTAACGG + Intergenic
1203145783 16_KI270728v1_random:1796908-1796930 TGTCACTGCCGAGACCTTAATGG - Intergenic
1143165173 17:4893943-4893965 GGCCACGGGCAGGACCTGGAGGG + Intronic
1143521798 17:7448485-7448507 TGCCACAGCCTAGACCTGAGAGG - Intronic
1143863209 17:9905911-9905933 TTCCATTGCCAGAACCTGATAGG + Intergenic
1144469501 17:15524907-15524929 TGCCACTGCCAAGAGCCGAGTGG - Intronic
1144926854 17:18818770-18818792 TGCCACTGCCAAGAGCCGAGTGG + Intergenic
1146573595 17:33973345-33973367 TGCCTCCGCCTGCACCTGAATGG - Intronic
1147392414 17:40118368-40118390 AGCAACTGCAAGGGCCTGAAGGG + Intergenic
1148152376 17:45404410-45404432 TGGTCCTGCCAGGACCTCAATGG + Intronic
1149032032 17:52094762-52094784 TGCCACTACCACCACCAGAATGG + Intronic
1150566917 17:66350090-66350112 GACCCCTGCCAGCACCTGAAAGG - Intronic
1151888910 17:76940599-76940621 TGCCTCTTCCAGGACCTGCAGGG - Intronic
1152302797 17:79505288-79505310 TCCCACTGCCAGCACCTGCCTGG + Intronic
1152544548 17:80994223-80994245 AGCAGCTGCCAGGACCTCAAAGG - Intronic
1152592813 17:81222230-81222252 TGTCCCTCCCAGGACCTGAAGGG + Intronic
1156354908 18:36332512-36332534 TGACACTGCCAGAACCAAAATGG - Intronic
1156559904 18:38111892-38111914 TAGCATTGCCAGGACCTGATTGG - Intergenic
1157275846 18:46310807-46310829 TGCCACTGCAGGCCCCTGAATGG + Intergenic
1158571244 18:58598470-58598492 TGCCTCTGCCAGGTCCTGCCTGG - Intronic
1160398466 18:78589884-78589906 GGCCAGTTCCAGGACCTGTAAGG + Intergenic
1160561541 18:79761102-79761124 ACCCACTGCCAGGATCTAAAAGG - Intergenic
1161590199 19:5126072-5126094 CCCCACTGCTAGGCCCTGAAAGG - Intronic
1165717947 19:38058597-38058619 TTCCACTCCCAGAACCTGCAGGG - Intronic
1166364497 19:42271813-42271835 TGCCACTGCCAGGACCTGAAAGG - Intronic
1167498928 19:49834938-49834960 TGCCTCTTTCAGGGCCTGAATGG + Intronic
925652071 2:6101687-6101709 TGCCATTGACAGTACCTGACAGG - Intergenic
929777295 2:44937328-44937350 TCCCACTGCCAGGCCCAGGAGGG - Intergenic
931428274 2:62190495-62190517 TGACAATGCCAGGACATGATGGG - Intergenic
931822279 2:65964137-65964159 TGCCCATGCCATGTCCTGAATGG + Intergenic
931875713 2:66509550-66509572 GGTCACTGCCAGGGACTGAAGGG + Intronic
932331039 2:70898599-70898621 TGCCACTCCCAGGGCCTGGCCGG + Intergenic
932703176 2:74004354-74004376 TGCCACTTCCAGCACCTCCATGG - Intronic
933473258 2:82755425-82755447 TGCCACTACTAGGTCCTGGAAGG + Intergenic
934677642 2:96260935-96260957 TGACACTGCCAGGCCCTGCGGGG - Intronic
935176052 2:100649500-100649522 TGCCAATTTCAGCACCTGAAAGG - Intergenic
937162415 2:119777149-119777171 TGCCAGTGCCAGGAACAAAAAGG - Intronic
938090155 2:128426062-128426084 TGCCTCTGCCAGGCCCTCAGGGG - Intergenic
938420079 2:131138732-131138754 TGCCACTGAGAGGTCCTGAAAGG + Intronic
942186070 2:173426340-173426362 TTCCCCTTCCAGGTCCTGAAGGG - Intergenic
942763706 2:179429316-179429338 TGTGAGTGCCAGGACCTGGAGGG - Intergenic
946689063 2:222297474-222297496 TGCCACTCCCCGGGCCCGAAGGG - Intronic
947396351 2:229690479-229690501 GCCCAATGCCAGGATCTGAATGG + Intronic
948739978 2:240039984-240040006 TAGCACTGCTAGCACCTGAAGGG - Intergenic
949018435 2:241726657-241726679 TGCCAGTGTCTGGGCCTGAAGGG + Exonic
1170566918 20:17612765-17612787 AGTCACTGCCACCACCTGAAGGG + Intergenic
1172327649 20:34049131-34049153 TGCCAAAGCCAGGCTCTGAAGGG - Intronic
1172446526 20:34996320-34996342 TGCCAGGGCCAGGGCCAGAATGG - Intronic
1173231623 20:41203256-41203278 TACCACTGCCGGAACTTGAAGGG - Exonic
1175820939 20:61908558-61908580 TGCCACAGGCAGGTCCTGCAAGG - Intronic
1176227342 20:64008534-64008556 TGCCAAAGGCAGGAGCTGAAAGG - Intronic
1180913512 22:19469757-19469779 TGCCCATGCCAGGAGCTGGAAGG + Intronic
1182620916 22:31618107-31618129 TGCCGCCGACAGGACCTGAGGGG - Exonic
1183431617 22:37769250-37769272 TGCCTCTCCCAGGAGCTGCATGG + Exonic
1183564945 22:38607625-38607647 TGCTCCTGGGAGGACCTGAAAGG - Intronic
1183753087 22:39733330-39733352 TCCCACTGCCAGGAGCTGCTGGG - Intergenic
1184206129 22:43004770-43004792 GGCCTCTGCCTGGACCTGCAGGG - Intronic
1184343729 22:43900524-43900546 TGTCAGTGCCAGGATCAGAACGG + Intergenic
1184597492 22:45523107-45523129 TCACTGTGCCAGGACCTGAATGG + Intronic
949873868 3:8611479-8611501 TGCCATTGTTAGTACCTGAAGGG + Intergenic
950692174 3:14668303-14668325 TGCTCCTGCCAGTACCTCAAAGG - Intronic
953913881 3:46905971-46905993 TTCCACTGCCAATACCTGGATGG - Intergenic
954793069 3:53147123-53147145 TGCCTCTGCAAGAACCAGAAAGG + Intergenic
955397753 3:58569211-58569233 TGCCTCAGCTATGACCTGAAGGG - Intronic
956593991 3:70946727-70946749 TACAAGTTCCAGGACCTGAAAGG - Intergenic
962212097 3:133487563-133487585 TGCCACTGCCATCACTTGGAAGG + Intergenic
963172533 3:142265624-142265646 TGCCTCTGCCAGGACCTTGAAGG + Intergenic
967720494 3:192811061-192811083 AGCCACTGCCAGGAAGTGCAGGG + Intronic
968319514 3:197752260-197752282 TGGCAGAGGCAGGACCTGAAAGG - Intronic
968677970 4:1895739-1895761 TGACACTGGTAGGACCTGCAGGG - Intronic
970058285 4:12000246-12000268 GGCCACTGCTAGAGCCTGAATGG + Intergenic
970822858 4:20239275-20239297 AGCCACTGTCAGGAACTGAGTGG + Intergenic
974595958 4:64014710-64014732 TGTCCCAGCCAGGACCTCAAGGG - Intergenic
974699380 4:65419634-65419656 TTCTACTGGCTGGACCTGAATGG - Intronic
975243595 4:72092412-72092434 TGCCACTGACAGGACTAGACAGG - Intronic
976685098 4:87804988-87805010 TTCCACTGCCATGACCTTAATGG - Intronic
979777794 4:124613005-124613027 TGCCCATGCCAATACCTGAATGG + Intergenic
980524639 4:133973601-133973623 AGCCACTGAAAGGAACTGAATGG + Intergenic
982515685 4:156346104-156346126 TGCCACTGTGATGATCTGAAAGG + Intergenic
985369052 4:189265768-189265790 TGCCACTTCTAGGACCAGTAAGG - Intergenic
985542415 5:493017-493039 CGCCCCTGCCAGGACCTCAGAGG + Intronic
985758361 5:1732506-1732528 TGCTACTGCCAGGCCCTGGGTGG + Intergenic
986059858 5:4177904-4177926 GTCCTCTGCCAGGATCTGAAAGG + Intergenic
990563607 5:57007500-57007522 TGCCACTGAGAGGAACAGAAAGG - Intergenic
992762192 5:79960561-79960583 TGGCAATGCAAGGACCTCAAAGG - Intergenic
996435034 5:123424562-123424584 TGCCTGTGATAGGACCTGAAAGG - Intergenic
997304521 5:132827904-132827926 TCCCCCTCCCAGGACCAGAAGGG - Intronic
999765931 5:154740899-154740921 TGTCACTGTCCTGACCTGAAAGG - Intronic
1006370773 6:33642443-33642465 GGGCTCTGCCAGGACCGGAAGGG + Intronic
1006910172 6:37558531-37558553 AGCCACTGCAAGGCCCTGGAGGG + Intergenic
1007602416 6:43090768-43090790 TTCTACTCCCAGGACCTGAAAGG + Intronic
1012825094 6:104138081-104138103 TGCCCATGCCATGTCCTGAATGG + Intergenic
1015552816 6:134430153-134430175 GCCCATTGCCAGGACCTGTACGG - Intergenic
1016038944 6:139411960-139411982 TGCCACGGCCAGCCCCTGCAAGG - Intergenic
1018972606 6:168539078-168539100 TGACACTGACGGGACCTGGACGG + Intronic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1021545138 7:21804705-21804727 TGCCACAGCCTGGACCAGCATGG - Intronic
1022838601 7:34140914-34140936 TCCCACTGCCAAGACCTGGATGG - Intronic
1026229852 7:68473201-68473223 AGACACTGCCAGGCACTGAAAGG + Intergenic
1029380533 7:100211504-100211526 TGCCCAGGCCAGGACCTGAAGGG - Exonic
1032445509 7:131979414-131979436 TGCCCATGCCATGTCCTGAATGG + Intergenic
1033474079 7:141674129-141674151 TGCCTCTGCCGGGACCAGCATGG + Exonic
1035046777 7:155973084-155973106 TGCCACTGCCTGGAGCTGAAAGG - Intergenic
1035465563 7:159073767-159073789 TGGCACTGCCTGTGCCTGAAAGG - Intronic
1035579160 8:729134-729156 TGCCGCAGCCAGGGCCTGAGGGG + Intronic
1036191174 8:6671549-6671571 TCCCACAGCCAGGGTCTGAAGGG + Intergenic
1038607317 8:29021295-29021317 TCCCATTGCCAGGATATGAAGGG - Intronic
1041393941 8:57373210-57373232 TGCCACTGCTGGGGCCTGCAGGG - Intergenic
1044714446 8:95087856-95087878 TGCCACTCCCCGGCCCTGAAGGG - Intronic
1045682613 8:104678986-104679008 GGCCACTGCCAGGAATTGAATGG + Intronic
1046058165 8:109103405-109103427 TGCTACTGCCTTGACCTCAAAGG + Intronic
1047871611 8:129089045-129089067 TCCCACTGCAAGGGTCTGAATGG - Intergenic
1048955092 8:139529323-139529345 TCCCCCTGCATGGACCTGAATGG + Intergenic
1051609580 9:18948185-18948207 TGCCACTGTCAGGAAATGTAGGG - Intronic
1054810229 9:69428481-69428503 TGCCTCTGCCTGGACCAGGAGGG + Exonic
1057545692 9:96019429-96019451 TCCCACTGCCAGTACCTAAGTGG + Intergenic
1058962798 9:110007665-110007687 TGCCACTGTAGGGAACTGAAAGG + Intronic
1061284603 9:129614984-129615006 TGGCACTGCCAGGTCCAGCAAGG - Intronic
1062137294 9:134936226-134936248 TGTCACTGCCATGACCAGATCGG - Intergenic
1189148954 X:38684913-38684935 TGCCACTGATAGCACCTGAAGGG + Intronic
1191145275 X:57158915-57158937 TGCCCATGCCATGTCCTGAATGG + Intergenic
1193663966 X:84293170-84293192 TGCCACTCTCATGACCTGTAAGG + Intergenic
1194324932 X:92502781-92502803 TGCCTCTGCTATGTCCTGAATGG - Intronic
1195517156 X:105790189-105790211 GGAGACTGCCATGACCTGAAAGG + Intergenic
1196164710 X:112526166-112526188 TGACACTGCCATGGCCAGAATGG - Intergenic
1197819322 X:130529558-130529580 GGCCACTGCCAAGGGCTGAAAGG - Intergenic
1200633664 Y:5621956-5621978 TGCCTCTGCTATGCCCTGAATGG - Intronic
1200794222 Y:7325898-7325920 TGCCACGTCCAGAACCTGCAGGG - Intergenic