ID: 1166364651

View in Genome Browser
Species Human (GRCh38)
Location 19:42272380-42272402
Sequence GCGGCAGCTGCGGTCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 288}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166364646_1166364651 -4 Left 1166364646 19:42272361-42272383 CCAGTGGCAGCTATGACCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364638_1166364651 21 Left 1166364638 19:42272336-42272358 CCAGGCCCTTGGCCCCCTGGCAG 0: 1
1: 0
2: 8
3: 48
4: 516
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364644_1166364651 7 Left 1166364644 19:42272350-42272372 CCCTGGCAGCACCAGTGGCAGCT 0: 1
1: 0
2: 0
3: 41
4: 322
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364640_1166364651 15 Left 1166364640 19:42272342-42272364 CCTTGGCCCCCTGGCAGCACCAG 0: 1
1: 0
2: 5
3: 39
4: 418
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364643_1166364651 8 Left 1166364643 19:42272349-42272371 CCCCTGGCAGCACCAGTGGCAGC 0: 1
1: 0
2: 6
3: 38
4: 382
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364639_1166364651 16 Left 1166364639 19:42272341-42272363 CCCTTGGCCCCCTGGCAGCACCA 0: 1
1: 0
2: 1
3: 18
4: 222
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364642_1166364651 9 Left 1166364642 19:42272348-42272370 CCCCCTGGCAGCACCAGTGGCAG 0: 1
1: 0
2: 4
3: 31
4: 318
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288
1166364645_1166364651 6 Left 1166364645 19:42272351-42272373 CCTGGCAGCACCAGTGGCAGCTA 0: 1
1: 0
2: 2
3: 17
4: 223
Right 1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166364651 Original CRISPR GCGGCAGCTGCGGTCCCAGC GGG Intronic
900087088 1:903945-903967 GGGGCAGCTCTGTTCCCAGCAGG + Intergenic
900113779 1:1020196-1020218 GCGGCAGCAGCGGCCGCAGCGGG - Exonic
900255814 1:1697806-1697828 GCGGCATCCACGGTCCCTGCCGG - Intronic
900264485 1:1750416-1750438 GCGGCATCCACGGTCCCTGCCGG - Intergenic
900474471 1:2869698-2869720 GTGGCAGGTGAGGTCCCGGCTGG - Intergenic
900542495 1:3210422-3210444 TCTGCAGCTGTGGTTCCAGCTGG - Intronic
900691547 1:3983485-3983507 GCAGCTTCTGAGGTCCCAGCAGG + Intergenic
901207615 1:7505847-7505869 AGGGCTGCTGAGGTCCCAGCGGG + Intronic
901813348 1:11779913-11779935 GCGGCTGCTGCAGTCACGGCTGG + Exonic
902508849 1:16954763-16954785 GCGGGACCTACGGGCCCAGCGGG + Exonic
904533010 1:31181649-31181671 GCGGCAGCTGCGGTCAGCCCAGG + Exonic
906027002 1:42682514-42682536 GCGGCAGCTGCGGCTCCTCCCGG - Exonic
906411865 1:45584790-45584812 GGGGCCGCTGCGGCTCCAGCAGG + Intronic
907960020 1:59270165-59270187 GCCTCAGCTGAGCTCCCAGCCGG + Intergenic
908186037 1:61654258-61654280 GCGGCAGCTGGAGGCCGAGCTGG + Intergenic
908355851 1:63324112-63324134 GCGGCCGCTGCGGGCACAGCGGG + Exonic
910565157 1:88635500-88635522 GCAGCAGGTGCTGTGCCAGCTGG + Intergenic
912793390 1:112674886-112674908 GCGGCGGCTGCGGCCCAGGCAGG - Exonic
912855953 1:113168968-113168990 GCGGCCTCTGCGCTGCCAGCCGG - Intergenic
913452065 1:118999291-118999313 GGGGCAGCTGCGGACTCAGTGGG - Intergenic
913972020 1:143423162-143423184 GAGGCAGCTGGGGACGCAGCTGG + Intergenic
913972270 1:143424065-143424087 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
914066401 1:144248775-144248797 GAGGCAGCTGGGGACGCAGCTGG + Intergenic
914066652 1:144249678-144249700 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
914112501 1:144716676-144716698 GGGGCAGCTGCCCCCCCAGCGGG + Intergenic
914112752 1:144717579-144717601 GAGGCAGCTGGGGACGCAGCTGG - Intergenic
914492431 1:148160694-148160716 GCGGCAGCCGCAGCCCCCGCAGG - Intergenic
914878851 1:151532437-151532459 GCAGCAGCTCCAGGCCCAGCTGG + Exonic
915004357 1:152622960-152622982 GCAGCAGCTGCGCTCGGAGCTGG + Exonic
915541038 1:156566386-156566408 GGAGCAGCTGCGGTACCAGGTGG - Exonic
920394273 1:205632197-205632219 GCGGCAGCTTGGGTCCTGGCGGG - Intergenic
920436473 1:205950139-205950161 GCCCCAGCTGAGGTCCCAGCAGG - Intergenic
922200074 1:223393850-223393872 GCGGCCGCTGGGGTGGCAGCTGG - Exonic
923551799 1:234970146-234970168 GGGGCAGCTGCGGCCGCTGCTGG - Intergenic
1062899602 10:1132852-1132874 GAGGCTGCTGCGGTCTCAGCAGG + Intergenic
1066316462 10:34252248-34252270 GAGGCAGCTGAGGTCCCTACAGG + Intronic
1067778370 10:49179027-49179049 GCTGCAGCTGGGGTCCAGGCAGG + Intronic
1074995506 10:118754519-118754541 GCGGTGGCTGCGGCCCCATCGGG + Exonic
1075561800 10:123473694-123473716 GCGGCAGGTGCAGGCCCAGGAGG - Intergenic
1075626105 10:123965540-123965562 GCTGCAGTGGCTGTCCCAGCTGG - Intergenic
1075952861 10:126497109-126497131 GAGGCTGTTGCGGTGCCAGCAGG + Intronic
1076781880 10:132728997-132729019 GTGGCCGCTGTGGTCTCAGCAGG + Intronic
1076781898 10:132729057-132729079 GTGGCCGCTGTGGTCTCAGCAGG + Intronic
1077307836 11:1875872-1875894 GAGGCAGCTGGGGACGCAGCTGG - Intronic
1078527231 11:12110465-12110487 GCGGCAGCGGCGGTGACAGCCGG + Intronic
1078801000 11:14644017-14644039 GCGGCCGCTACGGTACGAGCGGG + Exonic
1079112071 11:17610596-17610618 GCGGCAGCTGGGGTCTCTGGGGG - Exonic
1079179181 11:18173636-18173658 GCGGCGGCAGCGGTACCAGATGG - Exonic
1081775597 11:45674232-45674254 GAGGGACCTGGGGTCCCAGCTGG - Intergenic
1082991451 11:59210878-59210900 GCTGCAGCTGGGGTCACAGTGGG - Exonic
1083630013 11:64090607-64090629 GCCGCAGGAGGGGTCCCAGCTGG + Intronic
1084149379 11:67281060-67281082 GCGACAGCTGCGGTCACCACAGG - Intronic
1089758668 11:120706787-120706809 TCTGTAGCTGCTGTCCCAGCAGG + Intronic
1090074424 11:123571047-123571069 GGAGCAGCTGCAGTCCAAGCAGG + Intronic
1090345002 11:126062683-126062705 GCGGCGGCTGCGATCCGAACGGG + Intronic
1090395533 11:126415770-126415792 GCGGCAGCTGGGGACGCATCGGG - Intronic
1091279711 11:134374934-134374956 ACGTCAGCTGCCCTCCCAGCCGG + Intronic
1091584411 12:1807835-1807857 GCGGGAGCGGGGGCCCCAGCAGG + Intronic
1091727362 12:2855314-2855336 GCGGCAGCTTCAGAGCCAGCTGG + Intronic
1095261740 12:40105935-40105957 GCGGCTGCTGCCGTGGCAGCCGG - Intronic
1096466186 12:51848683-51848705 GCGGCTGCTGCGGCCGCCGCGGG + Intergenic
1101865526 12:108517080-108517102 GCGGCAGCAGCAGGGCCAGCAGG - Exonic
1103505924 12:121442404-121442426 CCGGGAGCTGCGGCACCAGCTGG - Exonic
1103703352 12:122859110-122859132 GGGGCAGCTGCAGGACCAGCAGG + Exonic
1103952461 12:124558525-124558547 GAGGCGGCTGCAGTCCCAGGTGG + Intronic
1104431796 12:128722487-128722509 CAGGCATCTGCTGTCCCAGCTGG + Intergenic
1106265713 13:28107736-28107758 GCTGCTGCTGCTGTGCCAGCTGG - Intergenic
1107133480 13:36920203-36920225 GCGGCGGCGGCGGCCCCAGCCGG + Exonic
1107851501 13:44576835-44576857 GCGGCGGCGGCGGTGGCAGCGGG + Intronic
1112652754 13:101416469-101416491 GCGTGAGCCGCGGCCCCAGCCGG - Intronic
1113325011 13:109272375-109272397 GTGACAGCTGCTGTCCCTGCTGG - Intergenic
1113443882 13:110350838-110350860 AGGGCAGCTGCTCTCCCAGCTGG - Intronic
1113672688 13:112185648-112185670 GCCCCAGCTGCAGTCCTAGCTGG + Intergenic
1115217202 14:31025851-31025873 GCGGCGGCTGGGTTCCCGGCCGG - Intronic
1117551863 14:56844778-56844800 GCGGCAGCAGCGTGGCCAGCAGG + Intergenic
1118463921 14:66013819-66013841 GCGGCAGCTGCGGCTCCTCCCGG + Intergenic
1120179594 14:81329835-81329857 GAGTCAGCTGTGGGCCCAGCTGG - Intronic
1121710813 14:96038314-96038336 CCGGCAGCTGGGGGCCCAGTAGG - Intergenic
1122193732 14:100068752-100068774 GGGGCAGCTGGGGTGCTAGCTGG + Intronic
1123061504 14:105596810-105596832 TCGGCAGCTGCTGTCCCTGCAGG + Intergenic
1123085953 14:105717721-105717743 TCGGCAGCTGCTGTCCCTGCAGG + Intergenic
1124500762 15:30225178-30225200 GCGGCAGGTGCGGGCCCCGGGGG - Intergenic
1124742808 15:32313489-32313511 GCGGCAGGTGCGGGCCCCGGGGG + Intergenic
1125426765 15:39556734-39556756 GCAGCAGCTGCAGTGGCAGCTGG - Intergenic
1125741148 15:41965891-41965913 CTGGCAGCTGCAGTCCGAGCAGG - Intronic
1125760849 15:42094521-42094543 GTGGCAGCGACGGTCCCAGTGGG + Exonic
1125919581 15:43517647-43517669 GCGGCAGCTCCGGCCTCAGCCGG - Exonic
1127855834 15:62953120-62953142 GCGGCAGCTGCGGCTCCTCCTGG - Intergenic
1128089790 15:64911790-64911812 GGGGCAGCTGCGCTCCTAGCAGG + Intronic
1129540421 15:76343153-76343175 CCGGCAGCCGCGCTCCTAGCGGG - Intergenic
1129712321 15:77826651-77826673 GTGGCAGGTCAGGTCCCAGCTGG + Intergenic
1130115637 15:81002215-81002237 GCGGCAGCGGCGGTGGTAGCGGG + Exonic
1130831165 15:87602337-87602359 GAGGCAGCTGTGGTAGCAGCAGG + Intergenic
1132375630 15:101326627-101326649 GCGGGAGCAGCCGTCCCTGCGGG + Intronic
1132544937 16:528552-528574 GGGGCTGCTGCGGCACCAGCTGG + Intronic
1132805520 16:1773419-1773441 GCGGCTGCTGCGGCCGGAGCAGG + Exonic
1132925878 16:2429040-2429062 CCGGCATCTGCGGTGCCAGATGG - Intergenic
1133063406 16:3189560-3189582 GCGGCTGGGGCGGACCCAGCAGG - Intergenic
1133232853 16:4374564-4374586 GCGGCCGCTGGGGCCCCTGCTGG + Intronic
1134021467 16:10924099-10924121 GTGGCAGCTGCGGTCCACCCAGG + Exonic
1134431599 16:14213839-14213861 GAGGCATCTGTGGTACCAGCTGG - Intronic
1134597774 16:15509669-15509691 GAAGCAGCAGGGGTCCCAGCGGG - Intronic
1134849871 16:17470899-17470921 GCGGCGGCGGCGGCCCGAGCGGG - Intergenic
1136235472 16:28911051-28911073 GCCGCTGCTGCAGCCCCAGCCGG - Intronic
1136573919 16:31112175-31112197 TCTGCAGCTGCAGTCCCTGCAGG + Exonic
1138179223 16:54931003-54931025 GCGGGCGCGGCGGTCGCAGCCGG + Exonic
1138547455 16:57728416-57728438 GCGGCAGGTGGAGACCCAGCTGG + Exonic
1139446360 16:67001006-67001028 GCCACAGCTGCGGTCCCAAAGGG - Intronic
1139528112 16:67528836-67528858 GCGGCAGCTGCGGCGCGACCAGG + Intronic
1140479052 16:75252746-75252768 GGGGCAGCTGCAGGCCCACCTGG - Intronic
1141482125 16:84313586-84313608 GGGGCACCTGAGGTTCCAGCTGG - Intronic
1142685657 17:1575672-1575694 GCTGCAGCTGCCGCTCCAGCTGG + Exonic
1143443919 17:6996225-6996247 GCTGCAGCTGCGGCCCGCGCGGG + Exonic
1143765392 17:9134400-9134422 GAGGCAGCTGCAACCCCAGCCGG - Intronic
1144339722 17:14301566-14301588 GCGGCGGCTGCGGTAGGAGCCGG - Exonic
1144469476 17:15524688-15524710 GCAGCTGCTGGGGTCCCAGAGGG + Intronic
1145013874 17:19384591-19384613 GTGGCAGCTGCGGAACCAGAAGG + Exonic
1145271202 17:21405773-21405795 GCGGCTGCTGTGGCCCCTGCAGG + Intronic
1145309406 17:21693160-21693182 GCGGCTGCTGTGGCCCCTGCAGG + Intronic
1145380445 17:22383972-22383994 GCGGCAGCCGCGGCTGCAGCAGG + Intergenic
1146926101 17:36746640-36746662 GCTGAAGCTGGGGTGCCAGCGGG + Intergenic
1147219815 17:38921935-38921957 GGGGCAGCAGAGGTCCCAGGAGG - Intergenic
1147514369 17:41101883-41101905 GCAGCAGCTGGGGTGGCAGCAGG + Exonic
1147515965 17:41117896-41117918 GCTGCAGCTGGGGTGGCAGCAGG + Exonic
1147661866 17:42121138-42121160 GCCCCAGCTGCAGCCCCAGCCGG - Exonic
1147969431 17:44211638-44211660 GTGGAAGCTGCTGTCCCAGAAGG - Exonic
1150292487 17:63989465-63989487 GCGGCAGCAGCTGTCCTCGCCGG - Intergenic
1152699927 17:81813692-81813714 GCCCTAGCTGGGGTCCCAGCAGG - Exonic
1152858401 17:82679862-82679884 GTGGCAGCTGCTGCCCGAGCAGG + Intronic
1152921380 17:83068196-83068218 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921394 17:83068230-83068252 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921557 17:83068672-83068694 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1152921627 17:83068846-83068868 GCGGCAGCGGGGGTCCCGGGAGG + Intergenic
1154940864 18:21111680-21111702 GGAGGGGCTGCGGTCCCAGCCGG + Exonic
1155918404 18:31578359-31578381 GAGTCAGCTGCAGTCGCAGCTGG - Intergenic
1157589467 18:48827724-48827746 GCAGCAGCTGCTGGCCCTGCAGG - Intronic
1160579959 18:79878039-79878061 GCGGCAGCGCCGGTGCCATCGGG - Intronic
1160725413 19:616088-616110 GCGGCAGGTGCGGGCCCCGGGGG - Exonic
1160732700 19:648497-648519 TGTGCAGCTGCGGTCACAGCGGG + Intronic
1160873199 19:1286207-1286229 GCGGCGGCAGCGGTAACAGCAGG - Exonic
1160948079 19:1652557-1652579 GCGGCGGCTGCGGGCGTAGCGGG - Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161120375 19:2522318-2522340 TGGGCAGCCGCAGTCCCAGCCGG + Intronic
1161264986 19:3359869-3359891 GCGCCAGCTCCGCCCCCAGCCGG - Intronic
1161268283 19:3375252-3375274 GTGGCAGCCACGGCCCCAGCTGG + Intronic
1161378386 19:3951475-3951497 ACGGCAGCTGCGGGCTCTGCTGG + Intergenic
1161378895 19:3954175-3954197 GCGGCAGCTGGAGGCCCTGCCGG - Intergenic
1161591472 19:5131140-5131162 GCGGCAGCTGTGGGGGCAGCAGG - Exonic
1161766021 19:6209393-6209415 GCAGCAGCTGGGGACTCAGCTGG - Intergenic
1161798900 19:6404401-6404423 GAGCCAGCTGGGGTCCCAGATGG - Intergenic
1162013169 19:7830249-7830271 GCGGCGGCCGCGGTCCCGGGGGG + Intronic
1162069440 19:8144950-8144972 GTGGCAGCCGCGGTCACAGATGG + Exonic
1162435283 19:10654452-10654474 GCGGCGGCTGCGGTCGAAGAAGG + Exonic
1162740535 19:12771184-12771206 GCTGCTGCTGCAATCCCAGCTGG - Exonic
1162904945 19:13817828-13817850 GGGGCAGCAGCGGGCCCTGCCGG + Exonic
1162967176 19:14161471-14161493 GAGGCAGATCAGGTCCCAGCTGG + Exonic
1163795734 19:19337074-19337096 GCAGCAGCTGTGGTGCCAGAAGG - Intronic
1165148638 19:33748514-33748536 GCTTCTGCTGGGGTCCCAGCTGG + Intronic
1165471401 19:36006764-36006786 CTGGCAGCTGCAGGCCCAGCTGG - Exonic
1166328543 19:42065782-42065804 GCGGCAGCTGCGTCCCCATGAGG - Intronic
1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG + Intronic
1166369923 19:42294982-42295004 GGGGCAGCAGCGGTGCCAGTGGG - Exonic
1167377493 19:49119689-49119711 GCGGCGGCTGCGGGCGGAGCTGG - Exonic
1167380161 19:49133831-49133853 TCGGCAGCTGGAGGCCCAGCTGG + Exonic
1168614017 19:57823236-57823258 GCTACAGCTGAGGTCTCAGCTGG + Intronic
1168618037 19:57854241-57854263 GCTACAGCTGAGGTCTCAGCTGG + Intronic
1168625308 19:57913407-57913429 GCTACAGCTGAGGTCTCAGCTGG - Intronic
1168721906 19:58558815-58558837 ACGGCAGCTGCGGTGACGGCGGG + Exonic
926302293 2:11613002-11613024 GCGGCAGCCTAGGTACCAGCAGG - Intronic
927135903 2:20096430-20096452 GGGGCCTCTGCGGTCCCAGTTGG - Intergenic
927727416 2:25437136-25437158 GGGGCAGCTGGTGTCCCGGCAGG + Intronic
928278278 2:29921540-29921562 GCGGCAGCGGTGGTAGCAGCTGG - Exonic
932365968 2:71153827-71153849 GTGGCAGCTGCGGCAGCAGCTGG + Intergenic
934063448 2:88318458-88318480 GCCCCAGCTCAGGTCCCAGCTGG - Intergenic
934176719 2:89584099-89584121 GAGGCAGCTGGGGACGCAGCTGG + Intergenic
934176963 2:89585002-89585024 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
934287025 2:91658459-91658481 GAGGCAGCTGGGGACGCAGCTGG + Intergenic
934287270 2:91659362-91659384 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
934559228 2:95303692-95303714 GAGGCAGCTGCGAGTCCAGCTGG + Intronic
934714900 2:96537697-96537719 GCGGGAGCTGCGGGCCAACCCGG + Intronic
934736042 2:96690378-96690400 GAGGCTGCTGCGGCCACAGCAGG + Intergenic
935592636 2:104855909-104855931 GCGGCGGCTGCGGTGGCTGCTGG - Exonic
936945804 2:117929724-117929746 GCTGCAGCTGAGGTCCCAGAAGG - Intronic
937855565 2:126670154-126670176 GTGGGAGCTGCGGTCTCAGAAGG - Intronic
937986434 2:127640195-127640217 GCTGCAGCTGTGAGCCCAGCCGG - Intronic
938448185 2:131393660-131393682 GAGGAAGCTGCCGGCCCAGCAGG - Intergenic
942565994 2:177264896-177264918 CTGCCAGCTGGGGTCCCAGCAGG + Exonic
942670910 2:178375848-178375870 GCAGTACCTGGGGTCCCAGCTGG - Intronic
944221684 2:197310293-197310315 GCGGCGGCCGCGGGCCCGGCGGG - Intronic
946391429 2:219418939-219418961 GCGGGAGCTGCGGCGCCAGGTGG + Exonic
948378215 2:237536283-237536305 AAGGCAGCTGTGGTCCCTGCTGG - Intronic
1169074543 20:2752692-2752714 GCGGCAGGGGAGGTCCCAGGCGG - Intronic
1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG + Exonic
1172851404 20:37968937-37968959 GCATCAGCTGCGGTCCCACACGG + Intergenic
1173479234 20:43386094-43386116 GCCGCAGCTGGAGTGCCAGCAGG - Intergenic
1173783730 20:45777091-45777113 GAGGCAGGTGCGGCCACAGCCGG + Exonic
1174048499 20:47750806-47750828 GAGGCAGATGCGGTCTCAGCAGG - Intronic
1175248913 20:57597261-57597283 GGGGCCGCTGGGGTCACAGCTGG + Intergenic
1175321904 20:58094239-58094261 GTGGCAGCAGCGGCCCCACCTGG - Intergenic
1175826568 20:61939421-61939443 GCGGAAGCTGCAGTGCCAGCTGG + Exonic
1176062323 20:63177857-63177879 GCGGCAGCAGCGGCTCCCGCCGG + Intergenic
1179931500 21:44573877-44573899 GCAGCAGCTGGGGGCGCAGCAGG - Exonic
1179976840 21:44873305-44873327 GCGGGAGCTGCCGTCGCGGCTGG - Intronic
1179998084 21:44983083-44983105 GCGGCAGCTGAGAACCCACCAGG - Intergenic
1180799703 22:18626027-18626049 GGGGCAGGTGCGTGCCCAGCTGG + Intergenic
1180921434 22:19523508-19523530 GCGGAAGCCGCGGTCCATGCGGG + Exonic
1181222013 22:21369239-21369261 GGGGCAGGTGCGTGCCCAGCTGG - Intergenic
1183683779 22:39350248-39350270 GCGGCGGCAGCGGGCCCCGCAGG - Intronic
951217632 3:20040230-20040252 GCGGCAGCTGCTCCCCCAGGAGG - Exonic
953697326 3:45170242-45170264 GTGCCAGCTAAGGTCCCAGCTGG - Intergenic
953705063 3:45225186-45225208 GCGGCTGCGGTGGTCCCTGCGGG + Exonic
954437354 3:50503276-50503298 GCGGCAGCAGCAGCCACAGCGGG + Exonic
956678027 3:71753681-71753703 GCGGCGGCGGCGGGCCCGGCGGG + Intronic
958165854 3:89877259-89877281 TCAGCAGCTGCTGTCCCTGCAGG + Intergenic
960380948 3:116960824-116960846 GTGGCAGCTGCCATCTCAGCTGG + Intronic
963497586 3:146086128-146086150 GCAGAAGCTGAGGTCCCAGAGGG - Intronic
968035413 3:195543903-195543925 GCGGCCTCTGCGGGCCCAGGAGG - Intergenic
968707039 4:2084035-2084057 GAGGCATCTGAGATCCCAGCTGG + Intronic
968978535 4:3834490-3834512 GGGGCAGCTGCGGGCCAAGCTGG + Intergenic
969342331 4:6550040-6550062 GGTGCAGCTGAGGTCACAGCGGG + Intronic
973037097 4:45420293-45420315 TCCGCAGCTGCGGGCCCAGATGG - Intergenic
973760404 4:54109786-54109808 GCGACCCCTGCGCTCCCAGCAGG + Intronic
974027515 4:56746696-56746718 GCTGGAGCTTCAGTCCCAGCAGG - Intergenic
975393914 4:73853340-73853362 GTTGCAGCTGAGGTTCCAGCAGG - Exonic
984930783 4:184845282-184845304 GGGCCAGATGCGCTCCCAGCTGG + Intergenic
985768306 5:1793444-1793466 AAGGCAGCTGCAGCCCCAGCTGG + Intergenic
985801558 5:2007951-2007973 GAGGCAGCGGCGACCCCAGCGGG + Intergenic
985890931 5:2714845-2714867 GGGGGAGCTGCTGCCCCAGCTGG + Intergenic
986589979 5:9358407-9358429 GTGGCAGCTGTCATCCCAGCTGG - Intronic
988564891 5:32312892-32312914 GCCGCCGCTGCTGCCCCAGCTGG - Exonic
988688626 5:33549723-33549745 GGGGCAGATGCTGTGCCAGCAGG - Intronic
991017912 5:61950928-61950950 CCGGCTGCTAAGGTCCCAGCAGG + Intergenic
997528428 5:134567975-134567997 GAAGCAGCTTCGGTCCCAGAAGG - Intronic
997878151 5:137567342-137567364 GAGGCAGCTGCCGGCCAAGCAGG + Intronic
999143702 5:149379261-149379283 GCGGCATCTGGGGTTCCAGGCGG - Exonic
1001014071 5:168125006-168125028 TCTGCAGCTGCGATCCCAACTGG + Exonic
1001456268 5:171862690-171862712 GCTGCTGCTGTGGCCCCAGCAGG - Exonic
1001694448 5:173659651-173659673 GCTCCAGCTGAGCTCCCAGCTGG + Intergenic
1002021191 5:176365476-176365498 GCGGCCGCAGCAGTCGCAGCGGG + Exonic
1002140507 5:177134493-177134515 CCTGCAGCTGCGGATCCAGCAGG + Intronic
1002184267 5:177446970-177446992 GCGGCGGCTGCGGGCCGGGCGGG + Intronic
1002421986 5:179153684-179153706 GAGGCAGCTGAGGCCCCTGCTGG + Intronic
1002426581 5:179180339-179180361 GCCTCGGCTGCTGTCCCAGCTGG - Intronic
1002793697 6:453323-453345 GCAGCAGCGGCATTCCCAGCTGG - Intergenic
1003139171 6:3456796-3456818 GCGGCGGCTGAGGGCCCGGCCGG - Intronic
1003311638 6:4974185-4974207 GGGGCAGCTCCGGTTTCAGCCGG + Intergenic
1004811485 6:19268899-19268921 GCAGCAGCTGGGCTCCCAGCAGG - Intergenic
1005059597 6:21763375-21763397 GTGGCACCTGCAGTCCAAGCAGG - Intergenic
1013949866 6:115766913-115766935 GCAGGAGCTGCGATCCCAGCAGG - Intergenic
1014538405 6:122645492-122645514 GCAGCAGATGGTGTCCCAGCAGG + Intronic
1017103165 6:150865957-150865979 GCGGCCGCCGCTGTCCAAGCAGG - Exonic
1017870101 6:158479852-158479874 CCTGCAGCTGCTGTGCCAGCAGG + Exonic
1018049589 6:159997298-159997320 GTGGCTGCTGCAGTCTCAGCAGG + Intronic
1018908457 6:168088517-168088539 GCAGCAGCTGAGGTCCCACAAGG - Intergenic
1018960116 6:168441718-168441740 GAGGCAGGTGGGGTCCCAGCCGG - Intronic
1019295545 7:272172-272194 GCGGCACCTGAGGCCCCTGCAGG + Intergenic
1022348162 7:29538713-29538735 GCTCCAGCTGCTGTCTCAGCAGG - Intergenic
1023269830 7:38450458-38450480 GCTGCAGCTGCAGTGCCATCTGG + Intronic
1023418261 7:39951234-39951256 GCTGCTGCGGCGGTCCCGGCGGG - Exonic
1025925300 7:65954273-65954295 GCGGCAGCTGCAACCCAAGCAGG + Exonic
1026955933 7:74376501-74376523 GCGGCACTGGCGGGCCCAGCTGG + Exonic
1027263834 7:76483094-76483116 GCAGGTGCTGCGGTCCCAGGTGG - Exonic
1027315207 7:76981207-76981229 GCAGGTGCTGCGGTCCCAGGTGG - Intergenic
1028899858 7:96085139-96085161 GCAGCAGCTGCAGCCTCAGCTGG - Intronic
1029539000 7:101172159-101172181 GCCCCAGCTGTGGTCACAGCTGG - Exonic
1030057990 7:105600259-105600281 CGGGCACCTGCAGTCCCAGCGGG - Intronic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1033159057 7:138981147-138981169 GCGGCGGCGGCGGGCGCAGCGGG + Exonic
1034343649 7:150372794-150372816 GCTGAAGCTGCGGTCGCAGTCGG - Exonic
1034509292 7:151520698-151520720 ACGGCACCTGCGTTCCCGGCCGG - Intergenic
1034869115 7:154667812-154667834 TGGGCAGCTGCCTTCCCAGCTGG + Intronic
1037688524 8:21163797-21163819 CCAGCAGCTGCCATCCCAGCGGG + Intergenic
1037877423 8:22554821-22554843 GCGGCAGCTCAGGGCCCAGCAGG - Intronic
1041489036 8:58411344-58411366 GCGGCAGGTGCGTCCGCAGCGGG + Exonic
1042155687 8:65841955-65841977 GCGGCGGCGGCGGCCCGAGCTGG - Intronic
1042253013 8:66775200-66775222 GCGCCAGCTGCGCTCCCTGCGGG - Exonic
1043464086 8:80487412-80487434 GCGGCAGCTGCAGCAGCAGCAGG + Exonic
1044716165 8:95101848-95101870 GAGGCAGCTTCTGACCCAGCTGG + Intronic
1044995990 8:97838649-97838671 GCCCCAGCTGCAGTCCCAACTGG - Intronic
1049180762 8:141220870-141220892 CCGGCAGCTCCGCGCCCAGCAGG + Intronic
1050091030 9:2016539-2016561 GCGGCGGCTGCGGGCCCGGGAGG + Intronic
1052362131 9:27573110-27573132 GCAGCGGCAGCGCTCCCAGCGGG + Intronic
1053372739 9:37576280-37576302 CCGGCTGCTGCGGCTCCAGCGGG - Intronic
1057311501 9:93946052-93946074 GCGGCAGCTCCGCTTCCACCAGG - Intergenic
1058912581 9:109534362-109534384 GCGGCAGCTGCGGCTCCTCCCGG + Intergenic
1059754840 9:117282789-117282811 TCGGCAGCTGCAGTCACTGCAGG - Intronic
1060814360 9:126626919-126626941 GCGGACGCTGCGGGCCCGGCCGG - Intronic
1061482578 9:130904205-130904227 GTGGCAGTTGCGGTACCACCAGG + Exonic
1061897435 9:133655750-133655772 GCAGCAGCTCAGATCCCAGCAGG - Intronic
1062285322 9:135770217-135770239 GGGGCACCTGCAGACCCAGCCGG + Intronic
1062373121 9:136250346-136250368 GTGGCGGCTGCAGTCACAGCTGG - Intergenic
1062379181 9:136278595-136278617 ATGGCAGCTGCGGTCACTGCTGG + Intergenic
1062472490 9:136712586-136712608 GCGGCCGCTGCGGGCCGGGCCGG + Exonic
1062726267 9:138075767-138075789 GCGGCTCCTGCAGACCCAGCAGG + Intronic
1186574875 X:10754344-10754366 GTGGCAGCTGATGTACCAGCAGG - Intronic
1187205131 X:17174778-17174800 GCGGCAGCAGCAGTGACAGCAGG - Intergenic
1190665852 X:52695461-52695483 GAGGCAGTTGTGGTCACAGCAGG - Intronic
1190673566 X:52762949-52762971 GAGGCAGTTGTGGTCACAGCAGG + Intronic
1192546466 X:72018620-72018642 GCGGCCGGTGCGGGCGCAGCCGG + Intergenic
1197081711 X:122426250-122426272 GCATCAGCTGCGGTCCCATAGGG + Intergenic
1197754464 X:129984200-129984222 ACGGCTGCGGCGGCCCCAGCAGG - Intronic
1198750463 X:139932677-139932699 GCGGCAGCCGCGGACCGAGGAGG - Intronic
1200128915 X:153830658-153830680 GCGGCAGCGGCGGGCCCCGCGGG - Intergenic
1200234014 X:154459630-154459652 GAGGCAGCTGGGGCCCCTGCAGG + Intronic
1200684249 Y:6245508-6245530 GCAGCCGCTGCGGTGCCTGCTGG - Intergenic
1200690866 Y:6305787-6305809 GCAGCGGCTGCGGTGCCTGCTGG + Intergenic
1201010841 Y:9547354-9547376 GCAGCGGCTGCGGTGCCTGCTGG - Intergenic
1201044406 Y:9868929-9868951 GCAGCGGCTGCGGTGCCTGCTGG - Intergenic
1201048385 Y:9908878-9908900 GCAGCCGCTGCGGTGCCTGCTGG + Intergenic
1202197151 Y:22307687-22307709 GCGGCAGCAGGAGGCCCAGCAGG - Intergenic