ID: 1166364803

View in Genome Browser
Species Human (GRCh38)
Location 19:42272960-42272982
Sequence CTGGGTACTCACTGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166364794_1166364803 19 Left 1166364794 19:42272918-42272940 CCCGAGGATGCTGAGGTCTCTAA 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 211
1166364795_1166364803 18 Left 1166364795 19:42272919-42272941 CCGAGGATGCTGAGGTCTCTAAG 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 211
1166364791_1166364803 28 Left 1166364791 19:42272909-42272931 CCCAAACAGCCCGAGGATGCTGA 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 211
1166364790_1166364803 29 Left 1166364790 19:42272908-42272930 CCCCAAACAGCCCGAGGATGCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 211
1166364792_1166364803 27 Left 1166364792 19:42272910-42272932 CCAAACAGCCCGAGGATGCTGAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG 0: 1
1: 0
2: 2
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166364803 Original CRISPR CTGGGTACTCACTGTGAGGA GGG Intronic
900115728 1:1027049-1027071 CTGGGAACTTCCTCTGAGGAAGG + Intronic
900538894 1:3192997-3193019 CTGGGTACTCGCTGTCTGGCCGG - Intronic
901558766 1:10052939-10052961 CTGTGTCCTCACTTGGAGGAAGG + Intronic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
903650808 1:24921020-24921042 CTGGGAACTCCCTGTGGGTAGGG + Intronic
903718202 1:25385161-25385183 CTGAGGTCTCACTGTGAGGTGGG - Intronic
903952695 1:27005421-27005443 TTGGGTAATCACTGGGAGGAGGG - Exonic
905635488 1:39548538-39548560 CTGTGTACTGACTGAGGGGAAGG + Intergenic
905903461 1:41597666-41597688 CTGTGTCCTCTCTGTGAGGCTGG - Intronic
908082501 1:60596373-60596395 CTGCTTACTCACTCTGATGAAGG - Intergenic
909300248 1:74003662-74003684 CTGAGTACTTACTATGTGGAGGG - Intergenic
917617722 1:176763364-176763386 CTGAGCACTTACTGTTAGGAAGG - Intronic
919058202 1:192597346-192597368 TTGTGTACTTACTGTGAGTAAGG - Intergenic
1062918193 10:1258007-1258029 CAGGGTCCCCACTGTGTGGATGG - Intronic
1065341825 10:24714434-24714456 CTGGGTACTCACTTTGCTGATGG + Intronic
1066079161 10:31912477-31912499 CTTTGTAGTCACTGTGGGGAAGG - Intronic
1067184475 10:44015150-44015172 CTGGACAGTCACTGTGAGGGTGG - Intergenic
1067445118 10:46337080-46337102 CTGGGGCCGCACTGTGAGGTGGG + Intergenic
1069515097 10:69070948-69070970 CTGGGCACTGACTGTGTGGCTGG + Intergenic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069565630 10:69461638-69461660 CTGGGCACTCACTGTGTGCCAGG + Intronic
1070405398 10:76090171-76090193 CTGGGTCCTCACTGCTCGGAGGG - Intronic
1070829271 10:79408688-79408710 ATGGCTTCTCACTGTGAAGAGGG - Intronic
1071505456 10:86229001-86229023 GTGGGTACTCACAGTAGGGAGGG + Intronic
1072309907 10:94144834-94144856 TTGGGCACTCACTGTGAGCTGGG + Intronic
1072479606 10:95797943-95797965 CTCCCTACTCACTATGAGGATGG - Intronic
1073104998 10:101027449-101027471 AGAGGTACTCACTGGGAGGAAGG - Intronic
1073832208 10:107397671-107397693 CTGGTTGCTCAATGAGAGGAAGG + Intergenic
1075161832 10:120031121-120031143 CTGGGTCCTCACAGGGTGGAAGG - Intergenic
1077443367 11:2578909-2578931 CTGGGCAGTCACTGTGCTGAGGG - Intronic
1078264599 11:9745039-9745061 CTGGGTACTTACTGTGTGCCAGG - Intronic
1078628003 11:12975974-12975996 CTGTGTACTCTCTGTGGGCAGGG - Intergenic
1079173002 11:18113927-18113949 CTGCATAATCACTGTGAGGCAGG - Intronic
1081781210 11:45714306-45714328 CTGGGTCATCCCTGTGAAGACGG - Intergenic
1083151414 11:60794093-60794115 CTGGGTACTCACCGTGGAGTTGG - Exonic
1083153629 11:60809413-60809435 CAGGGGACTCACTGTGGGAAAGG - Intergenic
1083325793 11:61872357-61872379 CTGCTTCCTCTCTGTGAGGAGGG - Intergenic
1088359858 11:108978747-108978769 CTTGGTGCTCACTGGGAGGATGG + Intergenic
1088606764 11:111540649-111540671 CTGGGACGTCACTGCGAGGAGGG - Exonic
1089500154 11:118927205-118927227 CTGGGGACCATCTGTGAGGAGGG - Intronic
1090393177 11:126402693-126402715 CTGAGTACTCACTGTGTGTTAGG + Intronic
1090887893 11:130895270-130895292 CTGGGTATGCCCTGTGTGGAGGG + Intronic
1093482969 12:19624229-19624251 CTGGGTACTGACTGTGCTGCAGG - Intronic
1094106796 12:26821283-26821305 CGGGGAAATCACTGTGAGCAGGG - Intronic
1094158120 12:27359390-27359412 CTCGGTACTTACTGTGGGGCTGG + Intronic
1096668048 12:53180411-53180433 CTGGGTGCTCGATGGGAGGAGGG - Intronic
1101649172 12:106659249-106659271 TTGGGGACCCACAGTGAGGAAGG + Intronic
1102381138 12:112467836-112467858 GTGAGAACTCACTGTGAGGATGG + Intronic
1102859589 12:116323874-116323896 CTGGGTTCTCTATGTGGGGAGGG + Intergenic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1105293373 13:19068691-19068713 CTGAGCACTCACTGTGAGACAGG + Intergenic
1107069749 13:36256946-36256968 CTGGGTAGGCACTGTGTGGCAGG + Intronic
1107805287 13:44148066-44148088 CTGGGAACTCACAGTCTGGAGGG - Intronic
1112569230 13:100579106-100579128 CTGGGTGCCCACTATGTGGAAGG + Intronic
1116959407 14:50954574-50954596 ATGGGTACTCACTGTGTACAAGG + Intergenic
1117312609 14:54542998-54543020 CTGGGTATATACTGTGGGGAAGG + Intergenic
1117943375 14:60992619-60992641 CTGGGGACTGAGTGTGAGGTGGG + Intronic
1118385651 14:65253595-65253617 CTGTGAACTCACAGTGAGCAAGG + Intergenic
1119602971 14:75989726-75989748 CTGGGAACTCACTGTCCGGTGGG - Intronic
1121034610 14:90690371-90690393 CTGGGTTTTCACTGTGAAGAAGG - Intronic
1121231341 14:92361038-92361060 CCGGGTGCTCGCTGAGAGGATGG - Intronic
1121988447 14:98530633-98530655 CTGTCTACTCACTGTGAGCTGGG - Intergenic
1122888716 14:104723095-104723117 CGGGACACTCCCTGTGAGGAAGG - Intergenic
1122902109 14:104786259-104786281 CTGGGAACCCACTGGGTGGAGGG - Intronic
1124631670 15:31341243-31341265 CTGGGTTTTCACTGTGAAGTGGG + Intronic
1125584597 15:40811122-40811144 CTGAGTACTCACTATGAGTCAGG - Intronic
1125768814 15:42151945-42151967 CTGAGTGCTCACTCTGAGGCAGG - Intronic
1128562570 15:68678331-68678353 CTGGGGGCTCAGTGTGAGGGAGG - Intronic
1130028256 15:80288735-80288757 CTGGGGACTTTGTGTGAGGATGG - Intergenic
1130667877 15:85885103-85885125 CAAGGGACTCCCTGTGAGGATGG + Intergenic
1131894152 15:97007577-97007599 CTGGTTGCTCACTGTGACGTGGG - Intergenic
1132506796 16:314165-314187 CTGGGACCTCCCTATGAGGAAGG - Intronic
1133916317 16:10112750-10112772 CTGGTTACTCGCTATGAGGTAGG - Intronic
1135588505 16:23689349-23689371 ATGGGAACTCACGGTGAGGTAGG - Exonic
1136580257 16:31147317-31147339 CTGGGTGCCCATTGTTAGGATGG + Intronic
1137024259 16:35457135-35457157 CTGGGGTCTCACTTTGAGGGAGG + Intergenic
1137804323 16:51289037-51289059 CTGGGAGCTCTCTCTGAGGAAGG - Intergenic
1137818795 16:51424063-51424085 CTGAGTACTTACTGTGTGGTAGG - Intergenic
1137838089 16:51613306-51613328 CTGGGGGCGCACTGTGAGGGTGG + Intergenic
1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG + Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141379736 16:83565539-83565561 CTGGGAACTCCCTGAGAGGAAGG + Intronic
1144780809 17:17807550-17807572 CTGGGCACTCACTGACAGGTTGG - Intronic
1144790092 17:17852959-17852981 GTGGGTCCTCACTGGGGGGATGG + Intronic
1147258330 17:39195141-39195163 CTGGGCCCTCTCCGTGAGGATGG - Intronic
1147690156 17:42309902-42309924 CTGGCTATCCACAGTGAGGAAGG - Intronic
1148809800 17:50283203-50283225 CAGGGTAGTGACTGTAAGGATGG - Intergenic
1150381926 17:64727665-64727687 CTGTGTTCTCATTGTGGGGATGG + Intergenic
1152367592 17:79865665-79865687 CGGGGGACTCACGGTGGGGATGG - Intergenic
1152470040 17:80486027-80486049 GTGTGTGCTCACTGTGAGCAGGG - Intergenic
1153633568 18:7094802-7094824 CTGGGCACTGCCTGTGTGGATGG - Intronic
1159881275 18:73860744-73860766 CTGTGGTCTCACTGTGGGGATGG - Intergenic
1160743570 19:699328-699350 CTGGCTCCTCACTGTGTGGCAGG - Intergenic
1161666496 19:5580156-5580178 TTGGGTACTTACTGCGAGCAGGG - Intergenic
1161729246 19:5948857-5948879 CTGGGCACTCACTGCGAGCCTGG - Intronic
1161908187 19:7173243-7173265 CTGAATACTCACAGTGAGTAAGG - Intronic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1163006078 19:14397438-14397460 CTGATGACTCACTGGGAGGAAGG + Intronic
1163061667 19:14766002-14766024 CTGATGACTCACTGGGAGGAAGG - Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1164777092 19:30861434-30861456 CTGGGACCTGACTGTGAGAAGGG + Intergenic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1166523718 19:43498014-43498036 CTTGGTGCTGACTGTGAGGCAGG - Intronic
925975844 2:9141440-9141462 CTGGGCACTCACTGTGTGGATGG + Intergenic
928217259 2:29371947-29371969 GTGGGTAATCACTATGAGCAGGG + Intronic
929942931 2:46348526-46348548 GAGGGTTCTCACTGTGGGGAAGG - Intronic
932466761 2:71929075-71929097 TTGGGTAGTCTCTGTGAGAATGG - Intergenic
934648024 2:96070598-96070620 CTGGGTACAGCCTGTGTGGAGGG - Intergenic
935483980 2:103629859-103629881 CTGTGTCCTCACAGTGTGGAAGG - Intergenic
937280895 2:120716647-120716669 CTGGGATCTCACTCTGAGAAGGG + Intergenic
941540746 2:166781197-166781219 CTGCTTATTCACAGTGAGGAAGG - Intergenic
944112882 2:196153375-196153397 CTGGGTTTTCACTGTGAGAGAGG + Intronic
944139056 2:196434967-196434989 CTGTGAACTCAATGGGAGGATGG - Intronic
946881919 2:224185104-224185126 CTGGGTACTGTCTAGGAGGAAGG + Intergenic
948789174 2:240368508-240368530 CTGGGTGCTCCCTCTGTGGAAGG - Intergenic
1168736443 20:142779-142801 CTGGCTTCTCACTGGGAGCAGGG + Intronic
1168953856 20:1820609-1820631 TTGAGTACTCACTGTGAGCCAGG + Intergenic
1171769703 20:29313242-29313264 CTCGGTCCTCACTGTGGGGTTGG - Intergenic
1172105602 20:32515520-32515542 GTGGGTGCACACTGAGAGGATGG + Intronic
1173709147 20:45139233-45139255 CTGGATACACACTGGGACGAGGG - Intergenic
1174725177 20:52854054-52854076 CTGGGTTCTTACCGTAAGGAAGG + Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1176986230 21:15440592-15440614 GTGGGTACTAACTATGAAGAAGG - Intergenic
1179307638 21:40169517-40169539 CTTGGTCCTCAGTGCGAGGACGG - Intronic
1180076774 21:45467147-45467169 CTGGGAAGTCACTCTGAGCAGGG + Intronic
1182621518 22:31621169-31621191 CTGGGTGCTCACTGTGTTGGTGG - Intronic
1182696131 22:32200424-32200446 CTGGGTTCTCAGTGTGTGTAAGG + Intronic
1183392236 22:37552257-37552279 CTTTGTTCTCACTGTGAGGTGGG - Intergenic
1185181469 22:49365902-49365924 CTCGGCACACACAGTGAGGAGGG + Intergenic
1185181475 22:49365954-49365976 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181479 22:49365980-49366002 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181497 22:49366078-49366100 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185370332 22:50457935-50457957 CTGCGTCCTCACTGTGAGCTGGG - Intronic
949578531 3:5362839-5362861 CAGGGTACTAACTTTGAGGGAGG + Intergenic
949894901 3:8761705-8761727 CTGAGTGCCCACTGTGAGCAAGG - Intronic
950573453 3:13816417-13816439 CTGGGAACCCACAGTGAGGGAGG + Exonic
953712954 3:45290464-45290486 CTGGGTAGTGAGAGTGAGGAAGG + Intergenic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
961001304 3:123375885-123375907 TTAGGTACGCACTGTGAGGAAGG + Intronic
961499593 3:127322815-127322837 CTGGGCACTCCATGTGAGAAGGG + Intergenic
962923676 3:139973074-139973096 TTTGGTGCTCACTGTGAGCAGGG + Intronic
965085738 3:164095150-164095172 CTGTGTACTTACTGTGTGCAAGG + Intergenic
965286334 3:166824697-166824719 CTGGGTAGGCACTGGAAGGAAGG + Intergenic
970311103 4:14783386-14783408 CTAGAGACTCACGGTGAGGAAGG - Intergenic
970378281 4:15480547-15480569 GTGGGTACTCACAGTGAGTCAGG + Intronic
974093611 4:57338209-57338231 TTGAGTACTCACTGTGAAGCAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978155958 4:105489520-105489542 CTGGGGAATCACTGTGAGCCAGG - Intergenic
978558427 4:110005904-110005926 CTGGGAATTCACTGTGAGATGGG - Intronic
981843620 4:149141010-149141032 CTGGGAGCTCACTGAGAGAAGGG + Intergenic
982095531 4:151918591-151918613 CTGGGAATTCACTGTAAGGCGGG + Intergenic
983201805 4:164869062-164869084 GTGGGTACTCACTGTAAAAAAGG + Intergenic
985773557 5:1827877-1827899 CTGTGTCCTCACTTTGTGGAAGG - Intergenic
987730029 5:21757908-21757930 TAGGGTACTGACTGTGAAGATGG - Intronic
989463543 5:41728317-41728339 CTGGGTATTTACAGTGAGTAGGG - Intergenic
991061882 5:62384773-62384795 TTTTGTCCTCACTGTGAGGAAGG - Intronic
991667638 5:69015018-69015040 CTGGGTTGTCTCTGTGAGAACGG - Intergenic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
995500036 5:112794641-112794663 CTGGGTAGTTAGTGTGAGAATGG - Intronic
995953832 5:117750039-117750061 CAGCGTACTCAATGTGAAGACGG - Intergenic
997593171 5:135087923-135087945 CTGGGTCCTCACTGTCAGAGTGG - Intronic
997883730 5:137612796-137612818 CTGGGTACTGACTGTATGCAGGG - Intergenic
998710628 5:144821144-144821166 CTGAGTACTCATTGTGAGTTAGG + Intergenic
998918357 5:147040684-147040706 TTAGGTACTCCGTGTGAGGAAGG + Intronic
1001279197 5:170374252-170374274 CTGAGTCTTCACTGTGAAGAAGG + Intronic
1002323466 5:178389529-178389551 GTGGGCACCCTCTGTGAGGAGGG - Intronic
1003747311 6:9017168-9017190 CTGGGTGCTGACTGGGAGAAAGG - Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1007984271 6:46191873-46191895 CTGGATACACACTGTGTGGCAGG - Intergenic
1008479684 6:51972618-51972640 CTGGGTGCTCACTCTGAGCCAGG + Intronic
1011379479 6:86727043-86727065 CAAGGTTCTCACTGTGAAGAAGG + Intergenic
1012444887 6:99297292-99297314 CTGAGTACTAACTGAGCGGATGG + Intronic
1016402470 6:143695340-143695362 CTGAGCACTCAATCTGAGGAAGG + Intronic
1017984862 6:159435141-159435163 CCAGGTGCTCACTGTGAAGATGG - Intergenic
1019995052 7:4718593-4718615 CCGGGTACTCACCCTGACGAGGG - Intronic
1022102334 7:27175869-27175891 CTGGATTCACACTGGGAGGAAGG - Intronic
1022894386 7:34734989-34735011 CTGGTTACTCACTCTAAGGGTGG - Intronic
1023181883 7:37492739-37492761 CTGGGAACCCACTGGGAGGGAGG + Intergenic
1023610648 7:41967187-41967209 CTGGGGACTGACAGTGGGGAGGG + Intronic
1023852647 7:44158852-44158874 CTGGATAGCCACAGTGAGGAGGG + Intronic
1025142850 7:56479816-56479838 CTGGGCAGGCACTGTGAGGGAGG + Intergenic
1027200212 7:76059506-76059528 CTGCGTCCTCACTGAGAGGGCGG + Intronic
1028482485 7:91322763-91322785 CTGGGTCATCACTCTCAGGAAGG + Intergenic
1029298287 7:99558777-99558799 CCGGGTACTCACCGAGGGGAGGG - Exonic
1029658183 7:101941195-101941217 TGGGGAACTCACTGGGAGGAGGG + Intronic
1031140737 7:117940260-117940282 CTGTGTACTAGCTGTGAGTAGGG + Intergenic
1032382810 7:131502444-131502466 ATGGCTACAGACTGTGAGGAAGG + Intronic
1034840274 7:154389070-154389092 CTGGGTGCTCACTGCGGGGACGG - Intronic
1034864426 7:154628740-154628762 CTGGGGACTCGCTTTGTGGAAGG - Intronic
1037645647 8:20790442-20790464 CTAGATACTCATTGTGAGGTTGG + Intergenic
1037963479 8:23116618-23116640 CTGGGTACACACAGAGAGGGAGG - Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1039763149 8:40599826-40599848 CCGAGGACTCACTGGGAGGAGGG - Intronic
1041830045 8:62143717-62143739 ATGGGAACTCACGGTGAGGTAGG + Intergenic
1044247156 8:89961918-89961940 CAGGGTACTGGCTGTGAGAAGGG + Intronic
1048772424 8:137909080-137909102 CTGGATACTCACTGTGGGGAAGG + Intergenic
1051798910 9:20908901-20908923 CTGGGAGCTCATTGTGAGGAAGG - Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1055426619 9:76203343-76203365 CTGGGTACTCACTGTTGACAAGG + Intronic
1055992001 9:82116436-82116458 CTGCGTTCTGACTCTGAGGAAGG - Intergenic
1057212851 9:93210033-93210055 TTGGGGCCCCACTGTGAGGATGG + Intronic
1057417159 9:94874683-94874705 CTAGGAACTCAGTGTGATGAAGG + Intronic
1057608318 9:96518000-96518022 CTGGGTTCTAGCAGTGAGGAAGG + Intronic
1057718380 9:97513659-97513681 CTGGGTACCCACTATGGGGAGGG - Intronic
1057798676 9:98175943-98175965 TTGAGTACTCACTGTGAGCCAGG + Intronic
1057975719 9:99603844-99603866 CTGGGTACCCCCTATCAGGAGGG + Intergenic
1058271827 9:102982018-102982040 CTGGGTCCTCACTTGGTGGAAGG - Intergenic
1058941330 9:109815477-109815499 CTGGTGACTCACTGTGCTGAGGG + Intronic
1060779882 9:126403692-126403714 CTGAGCACTTACTGTGAGCATGG - Intronic
1061198781 9:129124127-129124149 CTGGGTGACCACTGTCAGGAGGG - Intronic
1185518074 X:715657-715679 CTGGGTCCTCCCAGGGAGGAGGG - Intergenic
1188266912 X:28088119-28088141 CTGAGTACTTACTGTGTGCATGG + Intergenic
1189458483 X:41216642-41216664 CTTGATACTCACCGGGAGGAGGG - Exonic
1190627217 X:52347640-52347662 CTGGATACTGACTGTGATGGTGG - Intergenic
1190700816 X:52988493-52988515 CTGGATACTGACTGTGATGGTGG + Intronic
1201673930 Y:16558173-16558195 CTGGGGAAGCACTGTCAGGAAGG - Intergenic