ID: 1166367716

View in Genome Browser
Species Human (GRCh38)
Location 19:42285742-42285764
Sequence CAGTGTGAGGGGAAGCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 321}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166367700_1166367716 29 Left 1166367700 19:42285690-42285712 CCGAGCAGGGGCCTCTCTCCTCT 0: 1
1: 1
2: 3
3: 35
4: 362
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367703_1166367716 11 Left 1166367703 19:42285708-42285730 CCTCTGCTGGTTCCACTTCCCCC 0: 1
1: 0
2: 2
3: 32
4: 450
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367699_1166367716 30 Left 1166367699 19:42285689-42285711 CCCGAGCAGGGGCCTCTCTCCTC 0: 1
1: 0
2: 2
3: 45
4: 344
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367708_1166367716 -7 Left 1166367708 19:42285726-42285748 CCCCCAGGGAGCCAGGCAGTGTG 0: 1
1: 0
2: 4
3: 40
4: 458
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367710_1166367716 -9 Left 1166367710 19:42285728-42285750 CCCAGGGAGCCAGGCAGTGTGAG 0: 1
1: 0
2: 4
3: 37
4: 339
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367711_1166367716 -10 Left 1166367711 19:42285729-42285751 CCAGGGAGCCAGGCAGTGTGAGG 0: 1
1: 0
2: 5
3: 47
4: 464
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367709_1166367716 -8 Left 1166367709 19:42285727-42285749 CCCCAGGGAGCCAGGCAGTGTGA 0: 1
1: 0
2: 5
3: 39
4: 346
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367707_1166367716 -1 Left 1166367707 19:42285720-42285742 CCACTTCCCCCAGGGAGCCAGGC 0: 1
1: 0
2: 6
3: 66
4: 597
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321
1166367702_1166367716 18 Left 1166367702 19:42285701-42285723 CCTCTCTCCTCTGCTGGTTCCAC 0: 1
1: 0
2: 4
3: 38
4: 478
Right 1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG 0: 1
1: 0
2: 2
3: 20
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166367716 Original CRISPR CAGTGTGAGGGGAAGCCCAC TGG Intronic
900220816 1:1508527-1508549 CAGGGTGTGGGGACCCCCACTGG - Intergenic
900225818 1:1533239-1533261 CAGGGTGTGGGGACCCCCACTGG - Intronic
901652929 1:10753407-10753429 CAGTGAGAGGGGACCCCCGCAGG - Intronic
902942982 1:19813887-19813909 CAGTGTTAGAGGAAGCGCAGTGG + Intergenic
903201495 1:21743441-21743463 TAGTGGGAGAGGAACCCCACTGG - Intronic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
903884226 1:26531624-26531646 CTGTGAGAGGGGAAGACCAGCGG + Intronic
909089157 1:71204502-71204524 CAGGGTGACGGAAAGCCCAATGG + Intergenic
909443706 1:75724814-75724836 CAGGGTGAGAGGGAGCCCAGCGG + Exonic
910202551 1:84714249-84714271 AAGTGAGAGGGGAAGCCATCAGG + Intergenic
911969160 1:104408318-104408340 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
912923862 1:113895833-113895855 CAGTGTATGGCAAAGCCCACTGG - Exonic
912933700 1:113985102-113985124 CAGTGGAAGGGGATGCCCCCAGG - Intergenic
915237134 1:154492225-154492247 CAGTGTGTGTGAAAGCCCGCGGG - Intronic
916582346 1:166120335-166120357 CAGTGTGATGGAAAGCACACAGG - Intronic
917679920 1:177355253-177355275 CAGTGTGAGGGGATGACAAAAGG + Intergenic
919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG + Intronic
919881677 1:201905152-201905174 TAGGGTTAGGGGAAGCCCGCAGG + Intronic
920381090 1:205534922-205534944 CAGGGTGAATGGGAGCCCACAGG - Intergenic
921593547 1:217030442-217030464 CAGTGTGGTGGGAAGGCCACTGG + Intronic
921938675 1:220817696-220817718 CAGTGAGAGGTGAAGCCAGCTGG - Exonic
922547807 1:226471618-226471640 CAATGTGCTGGGAATCCCACAGG + Intergenic
923412468 1:233724067-233724089 CAGTGAGAGGTGAAGCCCGCTGG + Intergenic
923975234 1:239255566-239255588 CAGTGAGAGGTGAAGCCTGCTGG - Intergenic
924660162 1:246008453-246008475 CCGAGGGAGGGGAAGCCCAGAGG - Intronic
1063237467 10:4132883-4132905 CAATGTGAGGGGGTCCCCACAGG - Intergenic
1063447712 10:6130116-6130138 CACTGTGATGGGAAGGGCACAGG - Intergenic
1064009098 10:11721110-11721132 CAGTTTGATGGGAAACCCTCGGG - Intergenic
1064219429 10:13427970-13427992 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1064295281 10:14073655-14073677 CGGAGTGAGGGGAAGTCCAGGGG + Intronic
1064694360 10:17950701-17950723 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1067362876 10:45598120-45598142 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1069636590 10:69929048-69929070 CAGGGGGAGGGGAAGCCCTGGGG - Intronic
1070123947 10:73605176-73605198 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1070559348 10:77554052-77554074 GAGTGGAAGGAGAAGCCCACAGG + Intronic
1071794346 10:88989606-88989628 CAGGGTGATGGAAAGCCCTCAGG + Intronic
1072639287 10:97199377-97199399 CAGCGGGAGGGGCACCCCACAGG + Intronic
1072728522 10:97829487-97829509 CAGTGTGCTGGGGACCCCACAGG + Intergenic
1073970366 10:109040942-109040964 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1074687864 10:115976489-115976511 CACTGTGAGGGGCAGCCCAAGGG - Intergenic
1076674148 10:132139703-132139725 CAGGGTGTGGGGAGGCACACAGG + Intronic
1077533472 11:3108014-3108036 CAGAGTGAGGGGGAGCCTCCTGG - Intronic
1077887072 11:6394342-6394364 CAGTGTGTTGGGCAGCCCATAGG - Exonic
1079381983 11:19946219-19946241 AAGTGTGAATGGAAGCCCAAAGG - Intronic
1079987645 11:27215664-27215686 CAGTCTGAGGGGTAGCCTCCTGG + Intergenic
1081286308 11:41274523-41274545 CATTGAGAGGTGAAGCCAACTGG + Intronic
1081612220 11:44569335-44569357 CAGTGGAAGGGGAAGCCCGGGGG - Intronic
1081739145 11:45425952-45425974 CAGTCTGAGGTGATGCCCATTGG - Intergenic
1083729266 11:64644025-64644047 CAGTGTGCGGGTAGGCACACAGG + Intronic
1083944800 11:65917879-65917901 CGGTGTGATGGGCCGCCCACTGG + Exonic
1087404839 11:97717811-97717833 CAGTGGGAGGTGAAGCCGGCTGG - Intergenic
1088440715 11:109867278-109867300 CACTGTCATGGCAAGCCCACTGG - Intergenic
1089065441 11:115659122-115659144 CAGGGGGAGGGGAAGGACACAGG + Intergenic
1089709700 11:120306177-120306199 CACTGGGAGGGGGAGACCACAGG + Intronic
1090702697 11:129310706-129310728 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1091410937 12:238965-238987 GAGTGGGACGGGAAACCCACGGG - Intronic
1091679108 12:2513507-2513529 GAGTGTTGGGGGAAGCCCAGAGG + Intronic
1093716673 12:22390744-22390766 ACGTGTGAAGGGAAGCTCACTGG + Intronic
1094385417 12:29888692-29888714 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1097547606 12:61023721-61023743 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1097855638 12:64458972-64458994 CAGGGTGAGGGGAATCACATAGG + Intronic
1098218144 12:68241231-68241253 CACTGTGAAGGGAAGCCCTTAGG + Intergenic
1099437238 12:82659385-82659407 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1100436871 12:94579173-94579195 CAGTGAGAGGGGCAGGGCACAGG - Intronic
1101718121 12:107328946-107328968 CAGGGAGAGGGGAAGCCGGCGGG - Intronic
1102171035 12:110842669-110842691 CAGTGAGAGGGGAAGTCCGCTGG - Intergenic
1103963406 12:124623179-124623201 CAGTGTGAGGTGAGGCCCTGGGG + Intergenic
1104676354 12:130714719-130714741 CGGTGTGAGGGGAAGGCCGGCGG - Intronic
1105237138 13:18567803-18567825 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1105520951 13:21130455-21130477 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1105726242 13:23164985-23165007 CAGTGGGAGGGGAGGGCCACAGG - Intergenic
1105806139 13:23952770-23952792 CAGTGAGAGGTGAAGCCGAGTGG - Intergenic
1105955106 13:25274673-25274695 CAGTGTGAGTAAAAGCCCAGAGG - Intronic
1106178470 13:27351223-27351245 CAGTGAGAGGTGAAGCCACCTGG - Intergenic
1106416661 13:29551506-29551528 AGGTGTGAGGGGAAGCCCTTGGG - Intronic
1106938761 13:34753272-34753294 CACTGAGAGGTGAAGCCAACTGG + Intergenic
1108097915 13:46924023-46924045 CAGTGTTAGGGGAAGCCACGTGG - Intergenic
1108663329 13:52605732-52605754 AAGTTTCAGGGGAGGCCCACAGG + Intergenic
1108817814 13:54313268-54313290 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109138824 13:58687805-58687827 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109163836 13:59009157-59009179 TAGTGAGAGGTGAAGCCAACTGG + Intergenic
1110079274 13:71290357-71290379 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1111197523 13:84894592-84894614 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1111673113 13:91353221-91353243 CAGTGTGATAGGAAGCCTGCTGG + Intergenic
1111995281 13:95159507-95159529 CAGCATGAGGAGAAGCCCACAGG + Intronic
1113222788 13:108124345-108124367 CAGTGTGAGGGGAAGGCTGGTGG - Intergenic
1113709344 13:112453534-112453556 CAGTGAGAGGGTGAGGCCACCGG + Intergenic
1114216326 14:20660282-20660304 CAGAGGGAGAGGAAGGCCACAGG - Intergenic
1114851876 14:26391972-26391994 CAGTGAAATGGGAAGCTCACTGG - Intergenic
1115148346 14:30253571-30253593 CACTGTTAGGGAAAGCCCACTGG - Intergenic
1117255996 14:53978350-53978372 CAGTGTTAGGGGAATCCCATTGG + Intergenic
1118905504 14:70020547-70020569 CAGTGTTAGAGGGAGCCCAGAGG + Intronic
1119672507 14:76530257-76530279 TAATGTGAGGGGAAGATCACTGG - Intergenic
1120171016 14:81247416-81247438 GACTGTCAGGGGCAGCCCACAGG + Intergenic
1121514970 14:94543564-94543586 CACGGTGACGGGATGCCCACAGG - Intergenic
1121641088 14:95485358-95485380 CTGTGTGAAGTGAAGCCCATTGG - Intergenic
1121827337 14:97021130-97021152 CAGTGACAGGGAAAGCACACAGG + Intergenic
1123008053 14:105333842-105333864 CAGTGTGAGGCGTGGCCCACAGG + Intronic
1123977483 15:25566944-25566966 CATTGAGAGGTGAAGCCCGCTGG - Intergenic
1124017900 15:25893322-25893344 CAGAGTGTGTGGAATCCCACAGG + Intergenic
1124042035 15:26114483-26114505 CAGTCTGAGGTGAAGCCAGCTGG - Intergenic
1124618776 15:31262194-31262216 TGGTCTGAGGGGCAGCCCACAGG + Intergenic
1125599864 15:40909618-40909640 GAGAATGAGAGGAAGCCCACAGG + Intergenic
1127207403 15:56734452-56734474 CAGTGCTGGGGGAAGCCCTCAGG - Intronic
1129603034 15:77011355-77011377 CACTGTGCTGGGAGGCCCACAGG - Intronic
1130233424 15:82113711-82113733 CAGTGTGGGGTCAAGCCCAGGGG - Intergenic
1131382391 15:91974622-91974644 TGGGGTGAGGGGAAGACCACAGG + Intronic
1132012409 15:98287694-98287716 CAGGGTGAGGGGCTGCCCAATGG + Intergenic
1132339009 15:101066265-101066287 CAGAGCAAGGGGAAGCCCCCTGG + Intronic
1132937225 16:2487223-2487245 AAGTGCTAGGGGAACCCCACGGG - Intronic
1133285092 16:4686980-4687002 CTGTGTGAGCGGACGCCCTCAGG - Intronic
1136057283 16:27699714-27699736 CAGTGTGAAGGAAAGCGCCCTGG - Intronic
1136062778 16:27737992-27738014 TAGTGGGAGGAGGAGCCCACGGG + Intronic
1136281378 16:29213427-29213449 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1136867073 16:33767330-33767352 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1137730768 16:50687983-50688005 CAGAGTGAGCAGAAGCTCACAGG + Intergenic
1141473787 16:84258219-84258241 CTGTGAGAGGGGAAGCCAGCTGG + Intergenic
1142006917 16:87693724-87693746 CAGTGTGAGGTGAGGCGCTCGGG + Intronic
1142085748 16:88179355-88179377 CAGTGGGAGAGGAAGCCAAAGGG - Intergenic
1203105091 16_KI270728v1_random:1348873-1348895 CAGCGCTGGGGGAAGCCCACAGG + Intergenic
1203128423 16_KI270728v1_random:1613495-1613517 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1144590608 17:16520670-16520692 CAGTGTGCTGGGAAGACAACAGG + Intergenic
1144712331 17:17409880-17409902 AGGTTTGAGGGGAAGCCCAGCGG - Intergenic
1144877888 17:18411837-18411859 CGGTGTGAGGGGAAGAAAACGGG - Intergenic
1145154341 17:20532588-20532610 CGGTGTGAGGGGAAGAAAACGGG + Intergenic
1145803780 17:27711909-27711931 GAGTGAGAGGTGAAGCCAACTGG + Intergenic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1146974220 17:37097219-37097241 CAGTCTGGAGGGAAACCCACAGG + Intronic
1147384371 17:40072736-40072758 GAGTGGGTGGGGAAGCCCAGGGG - Intronic
1150135986 17:62695370-62695392 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1151463093 17:74267017-74267039 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1153140443 18:1966530-1966552 AAATAGGAGGGGAAGCCCACTGG + Intergenic
1153407141 18:4753541-4753563 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1157123613 18:44935005-44935027 CATTGTGATGGGAAGCCATCAGG + Intronic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158835738 18:61329970-61329992 CAGAGTCAGGGGAAGACCACTGG - Intergenic
1160055258 18:75472832-75472854 CAGGGTGAGGAGGAGTCCACAGG - Intergenic
1160210658 18:76875263-76875285 CATTGCCTGGGGAAGCCCACAGG + Intronic
1160891395 19:1380570-1380592 CAGTGAGAGGGGAAGGACCCAGG - Intergenic
1161056428 19:2192932-2192954 CAGTGGGAAGAGAAGCACACAGG - Intronic
1162676997 19:12306609-12306631 CTGAGTGAGGGGAAGCACCCAGG + Intergenic
1164141172 19:22465852-22465874 CAGGGTGATGGGATGCCCTCTGG + Intronic
1164269644 19:23660213-23660235 CAGGGTGATGGGATGCCCTCTGG - Intronic
1164394516 19:27851377-27851399 CAGTGAGAAGGGAAGCCCGGCGG + Intergenic
1164394569 19:27851625-27851647 CACTGGGGAGGGAAGCCCACTGG + Intergenic
1164993341 19:32700503-32700525 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1165884556 19:39068662-39068684 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1166230835 19:41425221-41425243 CAGAGTGATGGGGAGCCCAGTGG + Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
1167376288 19:49114186-49114208 CAGTGGGAGGGGTCGCCAACAGG + Intergenic
1167741127 19:51325570-51325592 GAGTGGGAGGGGAAGCCAAGGGG - Intronic
1168165125 19:54541953-54541975 AAGTGGGAGGGGAGGCACACTGG + Intronic
1168317020 19:55488958-55488980 CAGTGTGAGGGGCAGGCCGGGGG - Intronic
1168549971 19:57284654-57284676 CAGTGCGACCAGAAGCCCACAGG - Exonic
930585155 2:53259663-53259685 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
930789873 2:55314090-55314112 GAGTCTGAGTGGAAGTCCACAGG - Intronic
931518299 2:63067031-63067053 AAGTGTTATGGGAAGCCCAGAGG - Intergenic
932197357 2:69796160-69796182 CAGCGTGTGGTGAAGACCACTGG - Intronic
933747069 2:85579166-85579188 CAGTGAGACAGGGAGCCCACTGG + Exonic
934526350 2:95054202-95054224 CAGAGAGAGGGGAAGCCATCTGG - Intergenic
934774529 2:96928709-96928731 CAGGGAGATGGGAAGCCCCCAGG - Intronic
934786664 2:97014364-97014386 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
935693366 2:105749719-105749741 CGGTGTGAGGGGAGGCCGGCAGG + Intronic
938062069 2:128262022-128262044 CAGTGTGTGGGTGTGCCCACAGG + Intronic
938163359 2:129005934-129005956 CGGTGTGAGGTGAAGCCAGCTGG + Intergenic
938512641 2:131966708-131966730 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
940818149 2:158319402-158319424 AAATGTGAGGGGAAGTCCTCTGG + Intronic
941237383 2:162992195-162992217 CAGGGTGAAAGCAAGCCCACTGG - Intergenic
941240237 2:163027216-163027238 CAGCGAGAGGAGGAGCCCACTGG + Intergenic
944237151 2:197450896-197450918 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
944857275 2:203780030-203780052 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
944866712 2:203869868-203869890 TGGTGTCAGGGGAAGCCCACAGG + Intronic
945203711 2:207310187-207310209 CACTGTAAGGGGCAGCCCAAGGG + Intergenic
946114230 2:217447445-217447467 AAGTGTGAGGGGAAGGACTCTGG + Intronic
946916972 2:224533120-224533142 CAGTGTGAAGGGTTGACCACAGG + Intronic
948593330 2:239064726-239064748 CATTATGAGAGGAACCCCACTGG - Intronic
948803597 2:240443633-240443655 CAGTGGGAGGTGAGGCCCAGCGG + Intronic
1172778077 20:37419791-37419813 CAGTGAGAGGGCAAGACCCCAGG - Intergenic
1174051852 20:47772480-47772502 CAATGTAAGGGGAAGCGCAGAGG - Intronic
1174400784 20:50274811-50274833 CAGGGTGCGGGGAAGCCCTCTGG - Intergenic
1174754223 20:53141933-53141955 CAGATGGAGGTGAAGCCCACAGG - Intronic
1175658245 20:60790601-60790623 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1176781125 21:13196085-13196107 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1178845915 21:36174102-36174124 CAGTGTGGTGGGAAGAACACGGG + Intronic
1180613739 22:17114221-17114243 CAGAGTGAGGGGAGGCCCCGTGG - Exonic
1180799564 22:18625500-18625522 CAGGGTCAGGAGAAGCCCCCTGG + Intergenic
1181048771 22:20228911-20228933 GCATGTCAGGGGAAGCCCACTGG + Intergenic
1181163859 22:20973368-20973390 CAGTGGGAAGGGCAGCCCCCGGG + Exonic
1181222152 22:21369766-21369788 CAGGGTCAGGAGAAGCCCCCTGG - Intergenic
1181581921 22:23833352-23833374 CACTTTGAAGGGAAGCCCATGGG + Intronic
1183401564 22:37608092-37608114 GTGTGATAGGGGAAGCCCACGGG - Intergenic
1183466332 22:37982189-37982211 CAGGGTCAGGGGAAGTCCTCTGG + Intronic
1183831849 22:40422404-40422426 GAGTGTGAGGAGAAGCACATTGG + Intronic
1184081119 22:42220952-42220974 CAGGGTTTGGGGAAGCCAACAGG - Intronic
1184100029 22:42337170-42337192 CAGTGTCAGGGCTAGACCACAGG - Intronic
1184650304 22:45916555-45916577 CAGTGCCAGGAGAAGCCCAGTGG - Intergenic
1185257635 22:49844767-49844789 CAGTTTGAGGCGGATCCCACAGG + Intergenic
950484730 3:13266443-13266465 CTGGGTGACGGGGAGCCCACAGG + Intergenic
955497993 3:59556301-59556323 AGGTGTTAGAGGAAGCCCACCGG - Intergenic
958707913 3:97679299-97679321 CTGTGTGTGGGGACGCCCTCTGG - Intronic
959306837 3:104678034-104678056 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
960352078 3:116606274-116606296 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
960741271 3:120836125-120836147 CCTTTTGAAGGGAAGCCCACAGG + Intergenic
960855534 3:122098533-122098555 CAGTGTGAGGGGAAGGGATCTGG + Intronic
961722818 3:128907662-128907684 CAGAGTGGGCAGAAGCCCACTGG + Intronic
962259270 3:133892779-133892801 CAGCGTGAGGGCCAGCCCTCAGG + Intronic
962270054 3:133971029-133971051 CAGTGTGAGGCAAATGCCACTGG + Intronic
962413896 3:135165360-135165382 CAGTGGAATGGGAAGCCTACGGG - Intronic
964734400 3:159901370-159901392 CAGTTTGAGGTGAATCCTACTGG - Intergenic
968336162 3:197915511-197915533 CAGTGTGTGAGTAAGTCCACAGG + Intronic
968352633 3:198072967-198072989 CAGTGTGTGGGAAAGCACAGAGG - Intergenic
968579408 4:1383005-1383027 CCTTGTGTGGGGAACCCCACAGG + Intronic
969047706 4:4349127-4349149 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
969304969 4:6320488-6320510 CAGTGGGTGGGGATGCCCATGGG - Intergenic
972128615 4:35801858-35801880 CTGTGAGAGGTGAAGCCCGCTGG - Intergenic
972634365 4:40870278-40870300 CAGAGTGAGGGGCAGCGCAGAGG + Intronic
974919065 4:68214547-68214569 AAGTTTGAGTGGAAGCTCACAGG - Intergenic
980760197 4:137222826-137222848 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
981726188 4:147849927-147849949 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
982210393 4:153029982-153030004 CAGTGTCAGTGGAGACCCACTGG + Intergenic
982773712 4:159421093-159421115 CAGTGAGAGGGGAAGCTGGCTGG + Intergenic
983957797 4:173717631-173717653 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
984172878 4:176381856-176381878 CAGTGTGAGGGGCAGGGCAGTGG - Intergenic
984830744 4:183970547-183970569 AAGTGTCAGGGGAATCACACAGG + Intronic
986040968 5:3993756-3993778 CAGTGTCTGAGGAAGCACACAGG + Intergenic
986418351 5:7550773-7550795 GAGTGTGAGTGGAACCGCACAGG - Intronic
986832908 5:11600919-11600941 CAGTGAGAAGGCAAGCTCACAGG + Intronic
987363417 5:17127073-17127095 CATTGTGAAGGGGAGCTCACTGG - Intronic
988724417 5:33911697-33911719 CAGCCTGAGGAGAATCCCACAGG + Intergenic
988905663 5:35785959-35785981 CAGCGTGAGGGTTAGCCCAGAGG - Intronic
989757681 5:44975312-44975334 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
990377496 5:55186271-55186293 CAGTGTTAGAAGAAGCCCTCTGG - Intergenic
990985939 5:61641011-61641033 CAGAGGGAAAGGAAGCCCACTGG - Intronic
991034091 5:62110280-62110302 CAGTGCGAGGGTAGCCCCACTGG - Intergenic
993733906 5:91453027-91453049 AAGTGTTAGTGGAAGCCCAGAGG - Intergenic
995408187 5:111826078-111826100 CAGTGAGAGGTGAAGCCACCTGG + Intronic
996422015 5:123272539-123272561 CAGAATGAGAGGAAGCCCACAGG - Intergenic
996680001 5:126221220-126221242 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
997072005 5:130633380-130633402 CATTGAGAGGTGAAGCCCGCTGG + Intergenic
997361744 5:133299621-133299643 CATCCAGAGGGGAAGCCCACTGG + Intronic
997646412 5:135484953-135484975 CTGAGTGAAGGGAAGCCCAGAGG - Intergenic
999930778 5:156431338-156431360 CAGGATGAGGGCAACCCCACAGG - Intronic
1001751140 5:174132346-174132368 GAGTGTGAGGAGAAACCAACTGG - Intronic
1002326051 5:178407114-178407136 CAGTGTCAGTGGAAGCCCCATGG + Intronic
1002409554 5:179062725-179062747 CACTGGGAGGGGAAGGCCCCAGG - Intronic
1002615563 5:180452993-180453015 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1002758148 6:180464-180486 CAGTGAGATGGCAAACCCACTGG + Intergenic
1003040778 6:2685532-2685554 AAGTGTGAGGAGACGGCCACAGG - Exonic
1003137020 6:3441586-3441608 CAGTGGGCAGGGAAGCCCAGGGG - Intronic
1003193426 6:3893874-3893896 CAGTGAGAGGTGAAGCCAACTGG - Intergenic
1003487536 6:6592519-6592541 CAGGGTGAGGGGAAGCATAAGGG + Intronic
1003907940 6:10719986-10720008 CAGCGAGAGGTGAAGCCCGCTGG - Intergenic
1004631681 6:17427321-17427343 CACTGTGATGGGAAGCCACCCGG + Intronic
1005500044 6:26421712-26421734 CTGGGAGAGGGAAAGCCCACCGG + Intergenic
1006245919 6:32735667-32735689 CTGTGAGGTGGGAAGCCCACTGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006435859 6:34025956-34025978 CAGTGTGAGGGGAAGGCCAAGGG + Intronic
1006471315 6:34230730-34230752 CAGTGAGAGGGCAAGCCCTGAGG + Intergenic
1007409691 6:41654488-41654510 CAAGGGGAGGGGAAGCCCAGAGG + Intergenic
1007726258 6:43917637-43917659 CAGTGTGGGGGGCTGCCCTCAGG - Intergenic
1008185762 6:48388677-48388699 CAGTGTGATGGAAGCCCCACAGG - Intergenic
1010045716 6:71440896-71440918 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1011599319 6:89045238-89045260 CAGTGTGGTGGGAAGCAGACTGG + Intergenic
1011731939 6:90273771-90273793 GAGTGTGGAGGGAAGCTCACAGG + Intronic
1013350251 6:109299208-109299230 GAGTGAGACAGGAAGCCCACAGG - Intergenic
1013607095 6:111760640-111760662 CAGCTTGAGGGGAGGCCCATGGG - Intronic
1014143033 6:117965739-117965761 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1014754869 6:125291912-125291934 GAGTGTGAGGGGAAGTGCCCAGG - Intronic
1016182833 6:141168317-141168339 CATTGAGAGGTGAAGCCGACTGG + Intergenic
1016802780 6:148183428-148183450 CAGTGTGAGGAGATGGCTACGGG - Intergenic
1016894583 6:149039649-149039671 AAGCGTGGTGGGAAGCCCACAGG - Intronic
1017199757 6:151739952-151739974 CCATGTGAGGGGCAGCACACTGG + Intronic
1017332362 6:153214663-153214685 GAGTGTGAGTGGGAACCCACAGG - Intergenic
1017520293 6:155195896-155195918 CAGTGAGAGGTGAGGCCCAGAGG + Intronic
1018111399 6:160540009-160540031 CAGCGTGGGGTGAAGACCACAGG + Intronic
1018131844 6:160739220-160739242 CAGCGTGGGGTGAAGACCACAGG - Intronic
1018734844 6:166679949-166679971 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1019148515 6:169988899-169988921 CCGTGGGAGGGGGAGGCCACTGG - Intergenic
1019647332 7:2138111-2138133 CAGTGTCAGGGGCTGCCCAGTGG - Intronic
1020801613 7:12739371-12739393 CATTGTGAGCTGAAGCCAACTGG - Intergenic
1021006124 7:15397066-15397088 CAGTGACAGGTGAAGCCAACTGG - Intronic
1021498474 7:21303091-21303113 CAGAGTGAGGGGAAGCCAGCAGG - Intergenic
1022531322 7:31068685-31068707 CAGGGTGAGGGGAGGCCCCTGGG + Intronic
1024265541 7:47603507-47603529 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1026172758 7:67968789-67968811 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1027372535 7:77521303-77521325 TAGTGAGATGGGAAGCCAACTGG + Intergenic
1028867062 7:95725646-95725668 CAGTGTGAGGGGCAGGCCTGAGG - Intergenic
1029686792 7:102153917-102153939 CAGTGTGAAGCGAAACCAACAGG + Intronic
1030950900 7:115789908-115789930 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1031985415 7:128161527-128161549 GAGTGTGAGGTGAAGCACAAAGG - Intergenic
1032722680 7:134563568-134563590 CAGTGAGAGGTGAAGCCACCTGG + Intronic
1034621436 7:152460207-152460229 CAGGGTGAGGGCAAGGCCAGTGG + Intergenic
1035390260 7:158499317-158499339 CAGTGTGGTGGGCAGCCCAGCGG - Intronic
1035915537 8:3617529-3617551 AGATGTGAGGGGAAGTCCACAGG + Intronic
1036152043 8:6307938-6307960 CAGTGAGCGGGAAAACCCACAGG - Intergenic
1040464142 8:47678950-47678972 CAGTGGGCTGGGAATCCCACTGG - Intronic
1040638808 8:49306613-49306635 CAGTGAGAGGTGAAGCCGACTGG + Intergenic
1041168834 8:55119599-55119621 GAGTGTCAGGGGAGGCTCACAGG + Intronic
1041318149 8:56585218-56585240 ATGTGTGAGGGGAGGCCCAGAGG + Intergenic
1042227523 8:66525546-66525568 CAGTGGGAGGGGCAGGGCACAGG + Intergenic
1044175795 8:89120604-89120626 CAGTGTGAGGGGAGGCCTGAAGG - Intergenic
1044191736 8:89327039-89327061 CAGTGTGTGTGAAAGCCCATGGG - Intergenic
1044302872 8:90606264-90606286 CAGTGAGAGGTGAAGCCGGCCGG - Intergenic
1044621072 8:94191105-94191127 AAATGAGAGGGGAAGTCCACTGG + Intronic
1048522560 8:135170529-135170551 CAGTCTGGGGTGAAGCACACAGG - Intergenic
1050872619 9:10592556-10592578 TAGTGAGAGGGGAAGCCAGCTGG + Intronic
1050923978 9:11240585-11240607 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1052873584 9:33533276-33533298 CAGTGTGTGGGAAAGCACAGAGG + Intronic
1053502510 9:38611462-38611484 CAGTGTGTGGGAAAGCACAGAGG - Intergenic
1055951111 9:81730521-81730543 CAGTGAGAGGCGAAGCCAGCTGG + Intergenic
1057153584 9:92818156-92818178 CAGTGTGTGGGAAAGCACAGAGG + Intergenic
1057250816 9:93500214-93500236 AAGTGTGACGGGAAGCCAATGGG - Intronic
1057341327 9:94204502-94204524 CAGTGAGAGGCGAAGCCAGCTGG + Intergenic
1057547616 9:96030007-96030029 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1057682339 9:97200705-97200727 CAGTGTGTGGGAAAGCACAGAGG - Intergenic
1057953618 9:99389531-99389553 CTGGGTGTGGGGAAGCACACAGG - Intergenic
1058709630 9:107668000-107668022 CAGTGTGAGGCGGAGGCCGCGGG - Intergenic
1059337398 9:113577807-113577829 CAGTGTGAAGGAAAACCCTCGGG - Intronic
1060069564 9:120534285-120534307 CAGTGCGAGTGGAAGTCCAGAGG - Intronic
1060182762 9:121545670-121545692 CAGTGCGAGGGGAGGGCCGCTGG + Intergenic
1060779520 9:126401128-126401150 CAGTGTTAGGGAAAGGTCACAGG - Intronic
1060960147 9:127675043-127675065 CAATGTGAGGGGAAGCAGAATGG + Intronic
1061062565 9:128258010-128258032 CTGTGTGTGGGGAGACCCACCGG - Exonic
1061281681 9:129601333-129601355 GAGTGTGAGGGGAAGCACAGAGG + Intergenic
1062327197 9:136017993-136018015 CAGTGTGATGGGAAGTCCCCCGG + Intronic
1187477670 X:19626425-19626447 CATTGTGAGGGGAAGAGGACAGG + Intronic
1187562110 X:20412840-20412862 CAGCCTCAGGGGAAGCCCACAGG - Intergenic
1188078217 X:25805705-25805727 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1190630430 X:52380755-52380777 GAGTGTGAGGAGGAGCCCGCGGG + Intergenic
1192054600 X:67760357-67760379 CAGGGTGAGTGGAAGCCCACTGG - Intergenic
1193697178 X:84723642-84723664 CACTGTGAATGGAAGGCCACAGG - Intergenic
1193790145 X:85807835-85807857 CAGTGGGAGCGGCAGCCCAGCGG + Intergenic
1194035360 X:88864072-88864094 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1194077720 X:89417272-89417294 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1194971697 X:100351267-100351289 CAGGGTGAAGGGCAGTCCACAGG + Intronic
1196663646 X:118294407-118294429 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1196853043 X:119956903-119956925 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1199554045 X:149087253-149087275 CAGTGAGAGGCGAAGCCAGCTGG - Intergenic
1199556383 X:149113931-149113953 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1200614374 Y:5361334-5361356 CAGTGTGACGGGAAACCCTTTGG + Intronic
1200749343 Y:6930513-6930535 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1202372901 Y:24210345-24210367 CTGTGTGTGGGGACACCCACTGG - Intergenic
1202497881 Y:25459775-25459797 CTGTGTGTGGGGACACCCACTGG + Intergenic