ID: 1166368596

View in Genome Browser
Species Human (GRCh38)
Location 19:42289666-42289688
Sequence TAGGCTCCTGCACTGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166368587_1166368596 22 Left 1166368587 19:42289621-42289643 CCAGATCTTCAGGTGCAGTGTTA 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1166368596 19:42289666-42289688 TAGGCTCCTGCACTGGGCAGTGG 0: 1
1: 0
2: 0
3: 28
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166368596 Original CRISPR TAGGCTCCTGCACTGGGCAG TGG Intronic
900087941 1:907596-907618 CAGCCTCTTGCACTGGCCAGAGG + Intergenic
900104247 1:975518-975540 GGGGCTGCTGCACTGGGGAGGGG + Exonic
900106678 1:984358-984380 GCGGCTCCTGCCCTGGTCAGGGG + Intergenic
900416246 1:2536049-2536071 GAGGCTCCTGCACTGGGGGTAGG + Intergenic
900436639 1:2634158-2634180 GAGGCTCCTGCTATGGGGAGAGG + Intergenic
900522236 1:3111307-3111329 TGTGATCCTGCACTGGGCAGTGG + Intronic
900596685 1:3483210-3483232 TAGCCCCCTGCAGTGGGAAGAGG - Intergenic
900792456 1:4689462-4689484 CAGGATCATGCACAGGGCAGAGG + Intronic
901020487 1:6252762-6252784 TAGAGTCCTGCAGGGGGCAGGGG + Intronic
903354191 1:22736436-22736458 TCGGCTCATGCATTGGGAAGGGG - Intronic
903557508 1:24204338-24204360 CAGCCTTCTGCACTGGGGAGGGG + Intergenic
903656073 1:24949614-24949636 TGGCCTCCTGCACTCTGCAGTGG + Intronic
903828042 1:26159221-26159243 AAGGCTTCTGCTCTGGGCATGGG - Intronic
905852610 1:41285339-41285361 TAAGCTCCTGCACTGTGCAAGGG - Intergenic
912968083 1:114254276-114254298 TAGGCTTATTCACTTGGCAGTGG + Intergenic
913191642 1:116418301-116418323 TACACTCCTGCACCGAGCAGGGG - Intergenic
915600775 1:156921990-156922012 GAGGCTTCTGGACTGGGCACTGG + Intronic
915681242 1:157583764-157583786 TAGCCTCATGCACTGGGCTAAGG - Intronic
917120876 1:171643489-171643511 CAGCCTCCTGCAATGTGCAGAGG + Intronic
917717676 1:177754459-177754481 TTACCTCCTGCACTGGGCACTGG + Intergenic
919738339 1:200967723-200967745 AAGGCTCCTGCAGGGTGCAGTGG - Intergenic
920074260 1:203325364-203325386 CTGGCTCCTGCACTGGGATGAGG + Intergenic
920988325 1:210911761-210911783 TGGATTACTGCACTGGGCAGAGG - Intronic
921003355 1:211067515-211067537 TAGGAAGCAGCACTGGGCAGGGG - Intronic
923192504 1:231633384-231633406 GAGGGTTCTGCACTGGGGAGGGG + Intronic
923211716 1:231809295-231809317 CAGGCTCCCTCACTGGCCAGAGG - Intronic
924039601 1:239971409-239971431 TAGCCCCCTGCACAGGACAGTGG - Intergenic
924389733 1:243540688-243540710 TTGGGTCCTGGACTAGGCAGGGG - Intronic
924521026 1:244806343-244806365 TAGGCTCTTTCAGTGGGCAGAGG - Intergenic
1063879302 10:10514567-10514589 TAGGCTCCTGCTCTCGGCCAGGG - Intergenic
1065254922 10:23856600-23856622 TAGGCTCCACCTCTGGGCACAGG - Intronic
1070562666 10:77579613-77579635 TAGACTCCTGCTGTGGGCAATGG + Intronic
1071425672 10:85546796-85546818 TCAGCTCCTGTACTGGTCAGAGG + Intergenic
1073580350 10:104659993-104660015 GACACTCCTGCACTGGCCAGAGG + Intronic
1073932463 10:108591589-108591611 CAGGCTCCTAGACTGGCCAGTGG + Intergenic
1074719303 10:116250821-116250843 TAGCCCCCTGCACAGGGCAGCGG + Intronic
1074828504 10:117231899-117231921 TAGGCTCCTGAACAGGGGAGGGG + Intergenic
1075228541 10:120651201-120651223 TGGCCTCCTGCACGGGGCTGAGG - Intergenic
1076680668 10:132169704-132169726 GTGTCTCCTGCAGTGGGCAGCGG + Intronic
1077028732 11:453682-453704 GAGGCTCCTGGACCGGGCACTGG - Intronic
1077418383 11:2436542-2436564 CAGGCTGCTGCCCTGGGCAGGGG + Intergenic
1077913729 11:6597154-6597176 TAGGAGCCTGCACTGGGAAAGGG + Exonic
1079752106 11:24212665-24212687 TAGCCTGCTGCACTGGCCAGTGG - Intergenic
1080455871 11:32418664-32418686 TAAGCTGCTTCACTGGGCAGAGG + Intronic
1081054296 11:38388716-38388738 TAGGCTCATACACTGAGCAAGGG - Intergenic
1083961036 11:66015266-66015288 TAGGCCCCAGCCTTGGGCAGGGG - Intergenic
1084219448 11:67668196-67668218 TTGGCACCTGCTCTGGGGAGGGG + Intronic
1084664555 11:70569439-70569461 TAGGCTGCTGTGCTGGGCAGAGG + Intronic
1085151231 11:74254173-74254195 TGGGCACCTGCCCTGGGCTGAGG + Exonic
1085152786 11:74265513-74265535 TAGGATCCTTCACAGGGCTGTGG - Intronic
1085475097 11:76784185-76784207 CAGGCTCCGGCCCTGGGCTGGGG + Intronic
1086405783 11:86497935-86497957 AGAGCTCCTGCCCTGGGCAGTGG + Intronic
1089144144 11:116312126-116312148 CCGGCTCCTTCACTGGGCCGTGG + Intergenic
1089502773 11:118941958-118941980 TAGGCTACTGCTCTAGGCAGAGG - Intronic
1092194569 12:6541488-6541510 TAGGCGCCTCCCCTGGGCATGGG - Intronic
1092811576 12:12275848-12275870 ACTGCTGCTGCACTGGGCAGGGG - Intergenic
1094045157 12:26159074-26159096 CAGGCTCCAGCCATGGGCAGAGG - Intronic
1095981011 12:47974856-47974878 TAGTCTCCTGCAGGGGGAAGAGG + Exonic
1096637925 12:52973143-52973165 CAGGCTGCTGCACTGGGATGAGG - Intergenic
1097882133 12:64695733-64695755 TAGCCTACTGACCTGGGCAGAGG + Exonic
1100115078 12:91294424-91294446 CAGCCTGCTGCACTGGCCAGTGG - Intergenic
1100476949 12:94943656-94943678 TAGTCTCCAGAACTGTGCAGTGG + Intronic
1101282955 12:103278539-103278561 TCCACTCCTGCACTGGGCTGTGG + Intronic
1101346742 12:103892874-103892896 TAGATTCCTGCACAGGGAAGGGG - Intergenic
1102987541 12:117290649-117290671 TAGGATTCTGCTCTGGGGAGAGG + Intronic
1104926211 12:132315217-132315239 GAGGCTCCAGCACTTTGCAGTGG - Intronic
1104926231 12:132315323-132315345 GAGGCTCCAGCACTTTGCAGTGG - Intronic
1107735883 13:43398167-43398189 TATGCTCCAGCACTGTGCTGTGG - Intronic
1107838426 13:44431403-44431425 TAGGTTCCTGCACTGGTGTGTGG - Intergenic
1108081530 13:46742156-46742178 TGAGCTGCTGCCCTGGGCAGAGG + Exonic
1114516564 14:23303307-23303329 TAGGCTCCTGGTTTGGGCAGGGG + Intronic
1114655533 14:24313262-24313284 TGTCCTCATGCACTGGGCAGAGG + Intronic
1115460101 14:33650798-33650820 TAGGCTGCTGCTCCTGGCAGAGG - Intronic
1115772058 14:36674359-36674381 GAGGACCCTGCATTGGGCAGGGG + Intronic
1119509424 14:75199217-75199239 TAGGTGCCTGCATTGTGCAGAGG + Intergenic
1123065452 14:105616785-105616807 TAGGTTCCTTCCCTGTGCAGGGG + Intergenic
1123069656 14:105636251-105636273 TAGGCTCCTTCCCTGTGGAGGGG + Intergenic
1123088749 14:105732034-105732056 TAGGCTCCTTCCCTGTGGAGGGG + Intergenic
1123094677 14:105761291-105761313 TAGCCTCCTTCCCTGTGCAGGGG + Intergenic
1123923008 15:25083871-25083893 TTGGCTCCTGCACTCCCCAGAGG + Intergenic
1123923916 15:25090206-25090228 TTGGCTCCTGCACTCCCCAGAGG + Intergenic
1123930752 15:25170645-25170667 TGGCCTCCTGCACTGAGCTGTGG + Intergenic
1123931216 15:25172557-25172579 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123932901 15:25180419-25180441 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123934472 15:25187458-25187480 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123936107 15:25194844-25194866 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123936706 15:25197492-25197514 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123940331 15:25213569-25213591 TGGCCTCCTGCACTGAGCTGTGG + Intergenic
1123940745 15:25215464-25215486 TTGGCTCCTGCACTGAGCTGTGG + Intergenic
1123942892 15:25225125-25225147 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123943311 15:25227028-25227050 TCGGCTCCTGCACTGAGCTCTGG + Intergenic
1123943714 15:25228890-25228912 TGGTCTCCTGCACTGAGCTGGGG + Intergenic
1123944461 15:25232310-25232332 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123945717 15:25237911-25237933 TCAGCTCCTGCACTGAGCTGGGG + Intergenic
1123947395 15:25245400-25245422 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123947791 15:25247267-25247289 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123948224 15:25249126-25249148 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1123948604 15:25250793-25250815 TGGTCTCCTGCACTGAGCTGTGG + Intergenic
1124136966 15:27043343-27043365 TGAGCTCCTGCACTAGGCATTGG + Intronic
1124693580 15:31845533-31845555 GAGGATCCGGCTCTGGGCAGGGG + Intronic
1126413460 15:48395163-48395185 CTGGCTCCTGGAATGGGCAGGGG + Intergenic
1128203460 15:65829917-65829939 TAGTCTCCCCCACTGGGCTGTGG + Intronic
1129001772 15:72341493-72341515 TAGACTCCTGGAATGGGAAGGGG + Exonic
1129242091 15:74257836-74257858 TGGGCTCCTGGATTGGGAAGAGG + Intronic
1129741037 15:77989783-77989805 TTGGCTCCTGCAGAGGGAAGGGG - Intronic
1129844683 15:78762769-78762791 TCGGCTCCTGCAGAGGGAAGGGG + Intronic
1131440143 15:92453788-92453810 TAGGCTCCAGCCCTGTGCTGGGG + Intronic
1132854177 16:2037425-2037447 TGTGCTCCTCCACTCGGCAGGGG - Intronic
1135015164 16:18919041-18919063 TAAGCTACTGCACTGGGCCACGG - Intronic
1136393996 16:29983035-29983057 TAGGCTGCTGGACAGGGAAGGGG - Intronic
1138230525 16:55332561-55332583 CAGGCTCCTGCTTTGGGCTGGGG - Intergenic
1138923083 16:61556314-61556336 AACGCTGCTGCACTGGGCTGTGG - Intergenic
1139292303 16:65870004-65870026 GAGGCTCCTGCACTAGGGAAGGG - Intergenic
1140294840 16:73698799-73698821 TAGGGTCCTGCACTGGGTTCTGG + Intergenic
1140514614 16:75532978-75533000 CAGGGTCCTGCACTCTGCAGGGG - Intronic
1141679637 16:85536685-85536707 CAGGCTCCTGGAGAGGGCAGGGG - Intergenic
1142289622 16:89187615-89187637 TGGGCTCCTGCAGAAGGCAGCGG + Intronic
1143421949 17:6800307-6800329 TTGGCTCCTGCACTGAACACTGG - Intronic
1143598708 17:7930484-7930506 TAGGCTGTTGCTCTGGGCAGGGG + Exonic
1144124822 17:12193310-12193332 TAGGCCTCTGCCCTGGGCTGTGG + Intergenic
1147561138 17:41509989-41510011 AAGGCTCCTCCACAGGGAAGAGG + Intergenic
1151454448 17:74217739-74217761 GGGGCTTCTGCACTGGGCAGGGG - Intronic
1151674417 17:75590180-75590202 GAGGCTCCTGCCCTTGGCACCGG - Intergenic
1152700785 17:81817931-81817953 GAGGCTTCTGCAGTGGACAGTGG - Intergenic
1153884386 18:9450392-9450414 TAGTCTCCTGCACTGGGCCCCGG + Intergenic
1157810749 18:50693989-50694011 AAGGCTCATGCACAGGGCTGTGG + Intronic
1159868273 18:73731266-73731288 GGGCCTCCTGCACTGTGCAGAGG - Intergenic
1160014596 18:75130810-75130832 TGGCCTCGTGCACTGGGCCGCGG + Intergenic
1160203828 18:76816783-76816805 TCTGCTCCTGCACTGGGCTATGG + Exonic
1160366379 18:78329473-78329495 TGTGCTCCTGCCCTGGGCTGGGG + Intergenic
1165154489 19:33778866-33778888 TCCCCTCCTGCACTGGCCAGAGG + Intergenic
1166368596 19:42289666-42289688 TAGGCTCCTGCACTGGGCAGTGG + Intronic
1166423210 19:42654073-42654095 AATGCTCCTGCCCTGGGAAGAGG + Intronic
1167262413 19:48466717-48466739 TATGATCCAGCACTGGGGAGAGG - Intronic
1167687344 19:50964781-50964803 TGGGCTCCTCCACTTGGCACTGG + Intronic
1168343079 19:55636889-55636911 GAGGCTGGTGCACTGGGCAAGGG + Intronic
1168344499 19:55643759-55643781 GAGGCTGCTGCACTGGGTACGGG + Intronic
925262737 2:2542539-2542561 TGGGCACTTGGACTGGGCAGTGG - Intergenic
928410811 2:31052559-31052581 CAGGCTGCTGCAGTGGGAAGGGG - Intronic
929465298 2:42138431-42138453 TGTGGTCCAGCACTGGGCAGTGG + Intergenic
930010349 2:46933132-46933154 TGGGCTCCTGCTCTGGAGAGGGG + Intronic
931997827 2:67856112-67856134 AATGCTCCTGCACCAGGCAGAGG + Intergenic
932186839 2:69704614-69704636 TAGGCTCATTCACAGAGCAGTGG + Intronic
932658055 2:73627268-73627290 AAGGCTGCTGCACTGGTCTGGGG + Intergenic
932664682 2:73687304-73687326 AAGGCTGCTGCACTGGTCTGGGG + Intergenic
935134047 2:100283760-100283782 TGGGCTCCTGCACTGAACAATGG + Exonic
936348112 2:111690653-111690675 TTGACTCCTGTACTGGGCAGTGG - Intergenic
938721449 2:134070680-134070702 TAGGCTCCTCCACTCTGCTGGGG + Intergenic
942777062 2:179594848-179594870 TAGGCCACTGCACTGAGCTGGGG - Intronic
945921761 2:215762217-215762239 TAGCCTCCTTCCCTGTGCAGAGG + Intergenic
948031530 2:234821641-234821663 TATGCTCCTAGACTGGGCTGAGG + Intergenic
1169543770 20:6630065-6630087 CTGGCTCCTACACTGGGAAGAGG - Intergenic
1171423185 20:25032596-25032618 TGGGCCCCTGCAGAGGGCAGGGG - Intronic
1175543410 20:59762380-59762402 GTGGCTACTGCACTGGACAGGGG - Intronic
1175667580 20:60873365-60873387 AAGGCACGGGCACTGGGCAGAGG - Intergenic
1178534142 21:33398783-33398805 CAGGCTCCAGCACCGGACAGGGG - Intergenic
1179396796 21:41047384-41047406 CAGCCTCCTTCACTGGGCTGTGG - Intergenic
1180095743 21:45554612-45554634 CAGGTCCCTGCACGGGGCAGCGG + Intergenic
1180608894 22:17083257-17083279 CAGTGTCTTGCACTGGGCAGAGG + Intergenic
1180854782 22:19039010-19039032 GAGGCCCCCGCAGTGGGCAGAGG + Exonic
1181455993 22:23060612-23060634 TATGCTCCTGCAGTGCCCAGTGG + Intronic
1182099053 22:27645163-27645185 TTGTCTCCTGGACAGGGCAGCGG + Intergenic
1182183522 22:28376653-28376675 CAGGCTCCAGCTCTGGGAAGGGG + Intronic
1183061081 22:35336749-35336771 CACCCTCCTGCACTGGGCAGGGG + Intronic
1183398998 22:37590030-37590052 TTGGCTCCTGTGCTGGGCTGAGG - Intergenic
1183581335 22:38728324-38728346 TGGCCTCCTGTCCTGGGCAGTGG + Intronic
1184214491 22:43057738-43057760 TGGGCTCCTGGAGTGGGCAGGGG + Intronic
1185285466 22:49997924-49997946 TAGGCTCCAGGGCTGGGCAAGGG + Intronic
952917591 3:38260825-38260847 TAGAGTCCTGCCTTGGGCAGAGG - Intergenic
954215723 3:49123367-49123389 TAGGCACCTAAATTGGGCAGAGG + Exonic
954437564 3:50503934-50503956 TATGCTCCTGCCTTGGGCCGCGG - Intronic
955081932 3:55665789-55665811 TGGGCTCCAGAACTGGGCAAGGG + Intronic
955373185 3:58371380-58371402 TGGGCCACTGCACTGGGGAGAGG - Intronic
959089940 3:101891017-101891039 TAGCCTCCTGCACTAGGCCCTGG - Intergenic
959363450 3:105425401-105425423 GAGACTCCTGCATTGGGCATTGG + Intronic
963123685 3:141796564-141796586 AAGGCTGCAGCAGTGGGCAGTGG + Intronic
964164748 3:153689444-153689466 TAGCCTCCTGAACTGGGCCTGGG - Intergenic
964499395 3:157331605-157331627 TAGGCTATTGCCCTGGCCAGAGG - Intronic
965360758 3:167735345-167735367 TGGGGACTTGCACTGGGCAGAGG + Intronic
965911651 3:173785157-173785179 CTGGCTTCTGCACTCGGCAGGGG + Intronic
968650679 4:1759144-1759166 CAGGCTCCTGGAGTGGGAAGTGG + Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
970933581 4:21541563-21541585 TAGGATACTGGACTGTGCAGTGG - Intronic
977839693 4:101687582-101687604 TAGGCTCTTTCACGAGGCAGAGG - Intronic
980002045 4:127501021-127501043 TGGGCTTGTCCACTGGGCAGTGG - Intergenic
983561773 4:169108820-169108842 TAGGGCCCTGCACTAGGCACTGG - Intronic
983603395 4:169556076-169556098 TAGGCTCCTTTTCTGGGCAGTGG - Exonic
984255137 4:177381868-177381890 TGGGCTCCTGGAGTGGGGAGAGG + Intergenic
984818357 4:183858448-183858470 GAGGCTCCGGCCGTGGGCAGAGG - Intronic
985132812 4:186756365-186756387 GAGGCTCCTCCACTGAGCAGAGG - Intergenic
986794295 5:11193702-11193724 TTAGCTCCTGCTCTGGGGAGAGG + Intronic
986874852 5:12095444-12095466 TGGGCTCTAGCACTGGGAAGAGG + Intergenic
987418783 5:17693391-17693413 TAAGCTCATGCAATGTGCAGAGG - Intergenic
988465484 5:31487182-31487204 TAGCTTCCTGCACTGTTCAGTGG - Intronic
991488768 5:67164282-67164304 TGGGCTTCAGCACAGGGCAGAGG - Exonic
992005577 5:72474277-72474299 CAGGCTCCTGCACGGAGCTGGGG + Intronic
994094010 5:95832530-95832552 GGGGCACCTGCAGTGGGCAGAGG - Intergenic
995188049 5:109291370-109291392 GAGTCCACTGCACTGGGCAGGGG - Intergenic
997227891 5:132223068-132223090 TAGTCTCCTCCACTGGGCTGAGG - Intronic
998142672 5:139709135-139709157 TTGCCTCCTGCACTGAGGAGAGG - Intergenic
998419462 5:141970174-141970196 TAGGCTTCTTCACTGGGGTGAGG - Intronic
999196169 5:149783024-149783046 GAGGTTCCTGAAGTGGGCAGTGG + Intronic
999290475 5:150422243-150422265 AAGGCTCCTTCCCTGGGCGGTGG - Intergenic
1000559388 5:162767145-162767167 TATGCTCCTGCTCTGGCCATGGG - Intergenic
1001101778 5:168820232-168820254 TAGGCTCCTGGGCTGTGCAGAGG + Intronic
1002626491 5:180533182-180533204 TAGAGTCCTGCCTTGGGCAGGGG + Intronic
1003840773 6:10117042-10117064 TGGGCCCCTTCACAGGGCAGCGG + Intronic
1004218428 6:13723944-13723966 ATGGCTCTTCCACTGGGCAGAGG + Intergenic
1006247836 6:32756035-32756057 TATGTTCCTTCACTTGGCAGTGG + Intergenic
1006599433 6:35215677-35215699 TGGGCTCCTGCTCTGTGAAGAGG + Intronic
1007268038 6:40611989-40612011 CAGGCTACTGCAGTGGTCAGAGG + Intergenic
1017045101 6:150339897-150339919 TAGGCTCATTCACTGGCCACAGG - Intergenic
1017969416 6:159298817-159298839 GAGGCTCCTGCAGTGCCCAGGGG - Intergenic
1018795988 6:167186054-167186076 CAGATTCCTCCACTGGGCAGTGG - Intronic
1018820330 6:167369010-167369032 CAGATTCCTCCACTGGGCAGTGG + Intronic
1019624659 7:2009823-2009845 TCAGCTCCTGTGCTGGGCAGCGG + Intronic
1019739971 7:2667896-2667918 CTGGCTGCTGCACTGGGAAGGGG + Intergenic
1019968329 7:4519673-4519695 GAGTCTGCTTCACTGGGCAGCGG - Intergenic
1020009702 7:4801362-4801384 GTCACTCCTGCACTGGGCAGAGG - Intronic
1021791855 7:24213745-24213767 TAGGCTCCAGGTCTGGGCAGAGG + Intergenic
1023326080 7:39058415-39058437 CAGTCTCCTGCACAGTGCAGAGG + Intronic
1024063305 7:45714467-45714489 GCGGCTCCAGCCCTGGGCAGCGG + Exonic
1024119760 7:46225038-46225060 CAGGCTCCCACACTGGGCTGTGG - Intergenic
1024522818 7:50321622-50321644 TAGACTCCTGCATTGGCCAAAGG - Intronic
1024701267 7:51906772-51906794 TTGGCTACTGCACTGGGTAGAGG + Intergenic
1029408166 7:100390266-100390288 GAGGCTCCTGCAGTGGGGCGGGG + Intronic
1029899755 7:104026425-104026447 TAGGATCCTGCACTGGTCAAGGG - Intergenic
1032795199 7:135270813-135270835 GCTGCTCCTGCAGTGGGCAGAGG - Intergenic
1033142314 7:138838449-138838471 TAGGCTCCAGTCCAGGGCAGAGG - Intronic
1033307818 7:140238105-140238127 TAGAATCCTGGACTGGCCAGAGG - Intergenic
1034202451 7:149290968-149290990 CAGGCACCTGCAGGGGGCAGGGG + Intronic
1034404837 7:150896433-150896455 AAGGCTCCTACCCTGGGGAGGGG - Intergenic
1034466901 7:151235176-151235198 TACTCTACTTCACTGGGCAGCGG + Exonic
1035813836 8:2517148-2517170 TGGTCCCCTGCACCGGGCAGAGG - Intergenic
1037327927 8:17712841-17712863 TAGGCTGCTGAACTGGGAAAAGG + Intronic
1037952757 8:23029440-23029462 GAGGCTGCTGCAGGGGGCAGGGG + Intronic
1039658316 8:39434181-39434203 AAGGCTCCAGAACTGGACAGAGG + Intergenic
1041544826 8:59031329-59031351 TAGGCACCTGCAATGGGCACTGG - Intronic
1048879261 8:138859449-138859471 TGGGCTCCTGGAATGGGCACTGG + Intronic
1049299555 8:141862373-141862395 TAGTCTCCTGCACCCGGCTGAGG + Intergenic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1050417100 9:5429317-5429339 GGTGCTGCTGCACTGGGCAGTGG - Intronic
1051817088 9:21121055-21121077 TAGGCCACTTCACTGGGCAGGGG - Intergenic
1054902625 9:70385999-70386021 TGGGCTCCTGCAGTGGGCGCGGG - Exonic
1058109705 9:101018664-101018686 TAGGCTCCTGAAGTTGACAGTGG - Intergenic
1059031917 9:110707064-110707086 TGAGCCCCTGCACTGGTCAGAGG - Intronic
1059208158 9:112486267-112486289 TGGGCACCTTCACGGGGCAGCGG + Intronic
1059434092 9:114266111-114266133 ATGACTCCTGCACAGGGCAGGGG + Intronic
1061052978 9:128206927-128206949 GAGGCTGCTGCAGTGGGCAGGGG + Intronic
1062149332 9:135009459-135009481 TGGCCTGCTGCACTGGGAAGCGG - Intergenic
1062200307 9:135299402-135299424 GAGGCTCCGTCTCTGGGCAGGGG - Intergenic
1187223017 X:17347947-17347969 TAGGCTCCACCTCTGGGCACAGG - Intergenic
1192380756 X:70613859-70613881 TAGGATAGGGCACTGGGCAGAGG + Intronic
1193216926 X:78875090-78875112 CAGCCTGCTGCACTGGCCAGTGG - Intergenic
1195533349 X:105982542-105982564 ATAGCTCCTGCACTGGTCAGTGG - Intergenic
1196310750 X:114162368-114162390 TAGGCTGCAGCAGTTGGCAGCGG + Intergenic
1199553106 X:149078642-149078664 AGGGCTTCTGCACTGGGCAATGG - Intergenic
1201947174 Y:19523839-19523861 CAGGCTCCTGCATTGGGCTTAGG - Intergenic