ID: 1166368664

View in Genome Browser
Species Human (GRCh38)
Location 19:42289981-42290003
Sequence TCACACTCCCTCCTAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166368658_1166368664 21 Left 1166368658 19:42289937-42289959 CCAGAGGGCAACAAGGTGAGGGC 0: 1
1: 1
2: 1
3: 19
4: 171
Right 1166368664 19:42289981-42290003 TCACACTCCCTCCTAAGCCATGG 0: 1
1: 0
2: 0
3: 15
4: 159
1166368656_1166368664 22 Left 1166368656 19:42289936-42289958 CCCAGAGGGCAACAAGGTGAGGG 0: 1
1: 0
2: 1
3: 10
4: 192
Right 1166368664 19:42289981-42290003 TCACACTCCCTCCTAAGCCATGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166368664 Original CRISPR TCACACTCCCTCCTAAGCCA TGG Intronic
900469941 1:2848825-2848847 CCACACTCCCACCCAAGGCACGG - Intergenic
901303890 1:8218426-8218448 TCCCTCTCCCTCCAAAGACAAGG - Intergenic
902228600 1:15012949-15012971 GCTCACTCCCTCCCAACCCAAGG + Intronic
902308718 1:15563989-15564011 TCACTCTCACTCCCAATCCAAGG - Exonic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903170084 1:21547328-21547350 TCACACTAGCTCCAAAGCCCTGG - Intronic
904384773 1:30134100-30134122 TCAGGCTCCCTCCTAAGGCAAGG + Intergenic
904498505 1:30901005-30901027 TCACATCCCCTACTTAGCCAGGG - Intronic
906387671 1:45385534-45385556 TATGACTCCATCCTAAGCCAAGG - Intronic
908680077 1:66650711-66650733 TCTCACTCCCACAAAAGCCATGG - Intronic
908802225 1:67892025-67892047 TCACACTCGCTCTTCAGCCCTGG - Intergenic
909541284 1:76794273-76794295 TCACTCTCTTGCCTAAGCCAGGG + Intergenic
912598982 1:110908371-110908393 TCACACTAGCTCCCCAGCCATGG + Intergenic
913126253 1:115793167-115793189 TCACAGACCCTCTGAAGCCAGGG - Intergenic
916138856 1:161676072-161676094 ACACACTCCCACCTGGGCCAGGG - Intronic
918155087 1:181836698-181836720 TCACACTAGCTCATAAGCAATGG + Intergenic
918310007 1:183279077-183279099 TCACACCCCCTCCCATGTCAGGG - Intronic
918962774 1:191302346-191302368 TCACACTAGCTCCTTAGCAATGG - Intergenic
919430811 1:197488660-197488682 TCACACTAGCTCCTCAGCAATGG + Intergenic
922464808 1:225839446-225839468 TCACACTCCCTCCTCTCCCCTGG - Intronic
922825080 1:228512153-228512175 ACACACCCCCACCTATGCCAGGG + Intergenic
923781381 1:237027986-237028008 TCAGACTCCATCCCAAGCCCAGG - Intergenic
1066202755 10:33158065-33158087 GCAGGCTCCTTCCTAAGCCAAGG - Intergenic
1067248373 10:44565688-44565710 TCTCCCTCCCTCCTCAACCATGG - Intergenic
1069774310 10:70917963-70917985 CCCCACTCCCTCCCAAACCAGGG + Intergenic
1070435009 10:76382801-76382823 TCCCACTCTCCCCCAAGCCAAGG + Intronic
1073239527 10:102047364-102047386 ACATACTCCCTCCTAAGCTGAGG - Intronic
1076969065 11:123251-123273 CCTCACCCCCTCCTCAGCCAAGG - Intergenic
1077316784 11:1922873-1922895 TCACACTTCCTCGTCAGACATGG - Exonic
1077318797 11:1931418-1931440 TCCCACACCCTCCTCACCCAGGG + Intronic
1077553925 11:3217121-3217143 TCACCCTCCCTCCTCAGCCCTGG - Intergenic
1077932953 11:6752856-6752878 TCAGACTCCCTCTTAAGCCTGGG + Intergenic
1078684448 11:13515127-13515149 TCACATTCACTTCTAAGCTATGG + Intergenic
1078914958 11:15770471-15770493 TCACACTCCCTCTTAGGGGATGG + Intergenic
1079937392 11:26634654-26634676 TAACACTCCATCCAATGCCATGG + Intronic
1083288054 11:61673746-61673768 CCTCAGTACCTCCTAAGCCAAGG - Intergenic
1083800685 11:65044718-65044740 TCACGCTCCCTCCTCAGGCTGGG - Exonic
1085025808 11:73235875-73235897 TCACACTGGCTCCTAGCCCATGG - Exonic
1085907771 11:80785318-80785340 TCACACCTCCTCCTATGCCCAGG + Intergenic
1086425893 11:86682191-86682213 TTACACACTCTCCTCAGCCATGG - Intergenic
1087886089 11:103484498-103484520 AGACAGTCCCTCCAAAGCCAAGG + Intergenic
1088537175 11:110874015-110874037 TCACATTCCAGCCTAACCCAAGG + Intergenic
1089229385 11:116958410-116958432 TCACACTCCCTCGTTAGGCATGG - Intronic
1091106005 11:132920549-132920571 GCCCACTGCCTCCGAAGCCAGGG + Intronic
1091980814 12:4862368-4862390 TTACATTCCCTCCCAGGCCAAGG + Intergenic
1095178611 12:39122081-39122103 TCACACTAGCTCATAAGCAATGG - Intergenic
1096652329 12:53068037-53068059 GCACCCTCCCTCCAAAGCCTGGG + Intronic
1099034478 12:77568212-77568234 TCACCCTCATCCCTAAGCCATGG + Intergenic
1103140012 12:118540344-118540366 TCACACTCACTGCAAAGCTAAGG - Intergenic
1110491914 13:76119119-76119141 TCACACTCACTCCCCAGCAATGG + Intergenic
1114253055 14:20978025-20978047 CCACACTCCCTTCAAAGACAAGG - Intergenic
1118681315 14:68244793-68244815 TCACACTGCATTCCAAGCCACGG + Intronic
1119528934 14:75345680-75345702 TCATTCTCCTTACTAAGCCATGG - Intergenic
1120327862 14:83052406-83052428 TCAGACTCCCTTTTAAGCCAGGG - Intergenic
1122702840 14:103601802-103601824 TCCCGCTCCCTCCTAACCCCTGG - Intronic
1124628396 15:31323705-31323727 TCTCAGTCCCTCCCAGGCCAAGG - Intergenic
1125738253 15:41943606-41943628 TCAGCCTGCCTCCAAAGCCATGG + Intronic
1126453748 15:48839291-48839313 TCACAATCCCTTCTAGTCCATGG + Intronic
1129004273 15:72359072-72359094 TCATGCTACCTCCTAAGCCCTGG - Intronic
1129783082 15:78287528-78287550 TCACACTCCAACCTTAGCCATGG - Intronic
1132052133 15:98615963-98615985 TCACAGCCCTTCCCAAGCCAGGG - Intergenic
1132952915 16:2574738-2574760 CCACACTCTCTTCAAAGCCAAGG - Intronic
1132961436 16:2625430-2625452 CCACACTCTCTTCAAAGCCAAGG + Intergenic
1139378458 16:66515432-66515454 GCACAGGCCCTCCTGAGCCATGG + Intronic
1142037786 16:87872613-87872635 ACAGACTTCCTCCTCAGCCAGGG + Intergenic
1142318800 16:89367508-89367530 CCACGCTCCCTCTTAGGCCACGG + Intronic
1143625571 17:8108754-8108776 TCCCACTCACTCCTGAGCCATGG + Intronic
1144188641 17:12822422-12822444 TCACTCTTCCTCCCAAGCCAAGG - Intronic
1149043827 17:52221266-52221288 TCACTCTCACTCATATGCCAAGG - Intergenic
1150156911 17:62861402-62861424 TCAGCCTCCCTCCCAAGACAGGG + Intergenic
1151575816 17:74952151-74952173 TCACACGCCTACCTAAGCCTAGG + Intronic
1151726576 17:75888566-75888588 TCATAGTCCCTCCTAATCCAAGG - Intronic
1152316029 17:79580769-79580791 ATACACTCCATCCTAACCCATGG + Intergenic
1152439221 17:80295232-80295254 CCACTCTCCCTCCAAGGCCAGGG - Intronic
1153234329 18:2971249-2971271 TCCCACTTCCTCCTTACCCAGGG - Intronic
1155498438 18:26464752-26464774 TCCCACTGCCCCCTAAGCCTGGG - Intronic
1160023223 18:75196884-75196906 TCACACTAGCTACTCAGCCAGGG + Exonic
1160463774 18:79058787-79058809 TCACTCTCTCACCCAAGCCAGGG - Intergenic
1161557925 19:4955027-4955049 TCCCACCCCCTCCCAAGCCTTGG + Intronic
1163575007 19:18105717-18105739 TCACAGTCCATCCTCAGACATGG - Intronic
1163664317 19:18595936-18595958 TCAGACTCCCTCCTAAGAGGGGG - Intronic
1163828932 19:19538600-19538622 CCACACTCCCGGCTTAGCCAAGG - Intronic
1166368664 19:42289981-42290003 TCACACTCCCTCCTAAGCCATGG + Intronic
1167666886 19:50827510-50827532 ACACACTCCTTCCTAACCCAGGG + Intronic
1168036628 19:53724877-53724899 TCAAACTCCCTCCCAAGCTCAGG + Intergenic
925319344 2:2950257-2950279 CCACCCACCTTCCTAAGCCATGG + Intergenic
927435914 2:23066050-23066072 TCCCATTCCCGCCTAAGCCCTGG + Intergenic
927721805 2:25387869-25387891 TTACAGTCCCTTCTAGGCCAGGG + Intronic
932841830 2:75090284-75090306 ACAGACTTCCTCCTCAGCCAGGG + Intronic
933573496 2:84040607-84040629 TCACCCACCCTGCCAAGCCATGG - Intergenic
933985163 2:87584628-87584650 TATCTCTCCCTCCTAAGCCCCGG + Intergenic
935918231 2:107982278-107982300 TCACACTCAGTCCTTAGCAACGG - Intergenic
936308679 2:111366183-111366205 TGTCTCTCCCTCCTAAGCCCCGG - Intergenic
941631514 2:167890486-167890508 TCACACTACCTCATCAGCAATGG - Intergenic
943014478 2:182494721-182494743 TTACCCTCCCTCCCAAGCCCAGG + Intronic
944137616 2:196416242-196416264 TCTCACTCTCTCCTATGCCTAGG + Intronic
946881439 2:224180926-224180948 GCACGTTCCCTCCTAAGACATGG + Intergenic
947037559 2:225876397-225876419 TCACACTCCCTTCTACCACAGGG + Intergenic
1171244839 20:23602905-23602927 GCTCCCTCCCTCCTTAGCCAGGG + Exonic
1171361703 20:24590607-24590629 TCACACTGCAACCTAAGCCCAGG - Intronic
1173382224 20:42556123-42556145 TCACACTATCTCCTCAGGCAGGG + Intronic
1173674227 20:44820150-44820172 TCACTTTCTCTCCTGAGCCAAGG + Intergenic
1174251372 20:49222167-49222189 TTACACTCCAGCCTAAGCAATGG - Intronic
1175940617 20:62535977-62535999 TCACCCTCCCTTCTAGGCCTGGG - Intergenic
1178512016 21:33213276-33213298 TCCCACTGCCTCCTAGTCCAGGG + Intergenic
1181100629 22:20536627-20536649 TCTCAGTCCCTCCCAAGGCAAGG - Intronic
949570623 3:5289220-5289242 TCCCATCCCCACCTAAGCCAGGG - Intergenic
950169408 3:10827547-10827569 TCACACTGCCTCCAACTCCAGGG + Intronic
950406310 3:12807289-12807311 TCCCACTCCCTGCTCAGCCTGGG + Exonic
951323857 3:21279279-21279301 TCTCACTCCTTCCGGAGCCAAGG - Intergenic
953546738 3:43869042-43869064 TCAATGTCCCTCCTAAGCTACGG - Intergenic
956017596 3:64900260-64900282 ACACCCTCCATCCTAAGCCCTGG + Intergenic
960723224 3:120644988-120645010 AAACACTCACTCCTAAGCAAAGG - Intronic
961682347 3:128607827-128607849 CCACACTCCCGGCTAAGCAAAGG + Intergenic
962925439 3:139988980-139989002 CCATACTCCCTCCTCAGCAAGGG + Intronic
966691303 3:182744425-182744447 TCACAGCCCCTCCAAGGCCATGG + Intergenic
967645887 3:191923113-191923135 TCACACTAGCTCCCAAGCAATGG - Intergenic
968131454 3:196194955-196194977 ACACTCTCCCCCCTAAGCCAGGG - Intergenic
968417718 4:454542-454564 TCACTCTCCTTGCAAAGCCATGG + Intronic
969215956 4:5722652-5722674 TCTCCCTCCCTCCAAAGCAAAGG - Intronic
974534189 4:63153576-63153598 TCACACTAGCTCCCAAGCAATGG - Intergenic
979068882 4:116175513-116175535 TCACACTAGCTCCTTAGCAATGG - Intergenic
983690536 4:170464388-170464410 TCACACTGGCTCCCCAGCCATGG - Intergenic
984519757 4:180787652-180787674 TCAAACAACCTCCTGAGCCAGGG + Intergenic
985047067 4:185951361-185951383 TCACCCTGCCTCCTAATCCAGGG + Intronic
985610506 5:885307-885329 GCACCCTGTCTCCTAAGCCAAGG + Intronic
986977595 5:13410968-13410990 TCACAGTCGCTCCTATGCCCTGG + Intergenic
993451906 5:88082016-88082038 TGACCCTGCCTCCTCAGCCAAGG + Intergenic
994220716 5:97192310-97192332 TCACACTACCTCACAAGCAATGG - Intergenic
995883511 5:116868087-116868109 TCACACACCCTCCTAGCCCTAGG - Intergenic
996823705 5:127657757-127657779 ACACCATCCCTCCTAAGCAAGGG - Exonic
997445066 5:133934589-133934611 TCACACTCCCTGCACACCCACGG + Intergenic
997868461 5:137486005-137486027 ACACACTCCCTACCAATCCAGGG + Intronic
1001203086 5:169737232-169737254 TCAAACTCCCTCCTATCTCAGGG - Intronic
1005912691 6:30325362-30325384 TCTCTCTCCCTCCGAAGCCACGG + Intergenic
1006718024 6:36132424-36132446 GCAAACTCCCTCCAAATCCAGGG + Intronic
1008150223 6:47941097-47941119 TCACTCTCCCTCGTAACACAGGG + Intronic
1009876580 6:69513183-69513205 TCACACTAGCTCCTCAGCAATGG + Intergenic
1012219586 6:96632473-96632495 TCCCATTCCCTCCTAACCCCTGG + Intergenic
1012570993 6:100728758-100728780 TCCCACTCTCTCCTTTGCCAAGG + Intronic
1018735720 6:166685935-166685957 TCCCCCTCCCTCCTAGGGCATGG - Intronic
1018797535 6:167198924-167198946 TCACACTTCCTCTTCAGCAAGGG - Intergenic
1018945819 6:168346099-168346121 CCACACTCCCTCCTCTCCCAAGG - Intergenic
1021295442 7:18900537-18900559 TCACACTGCCTTCTTGGCCATGG - Intronic
1032508094 7:132451115-132451137 TCACGCTCCTTCCTTAGACACGG - Intronic
1034736234 7:153431824-153431846 CCCCACCCCCTCCTAAACCAAGG + Intergenic
1038088654 8:24229095-24229117 TCACACTCCTCCCAGAGCCAAGG - Intergenic
1039112292 8:34053018-34053040 TCACACTAGCTCCCTAGCCATGG + Intergenic
1040555886 8:48477295-48477317 GCACACTCCCTGCTCATCCAAGG - Intergenic
1043427124 8:80158473-80158495 GCTCACTTCCTCCTCAGCCAGGG + Intronic
1043531709 8:81158365-81158387 TCAAACTCTCTCCCAAGCCCAGG + Intergenic
1044249036 8:89984691-89984713 TCGCACTCCCGCCTCATCCAAGG - Exonic
1044740916 8:95325574-95325596 TCACAATCCCTCCTCAACAAAGG + Intergenic
1044824389 8:96182573-96182595 CCACCCTCCCTCCAAACCCAGGG + Intergenic
1047340491 8:123976103-123976125 TAACACTGCCTGCTAGGCCAGGG + Intronic
1049340090 8:142107471-142107493 TCACACTTCCAGGTAAGCCAGGG - Intergenic
1050133803 9:2440877-2440899 TCACACTAGCTCCCCAGCCATGG - Intergenic
1050992628 9:12172575-12172597 TCAAACTCCCTCTTAAGCCTGGG + Intergenic
1053162995 9:35826451-35826473 TCAGACTCCCTCCTGGGACATGG - Intronic
1057560544 9:96124918-96124940 TCACAGTCCCTCCTCTACCAGGG + Intergenic
1058841986 9:108918801-108918823 TCCCACTCACTTCCAAGCCAGGG + Exonic
1060155004 9:121313418-121313440 CCACTGTCCCTCCCAAGCCATGG - Intronic
1061595151 9:131624102-131624124 TTACACTTCCTCCCAAGCCGAGG - Intronic
1203579372 Un_KI270745v1:28574-28596 CCTCACCCCCTCCTCAGCCAAGG + Intergenic
1185943073 X:4342726-4342748 TCACTCTGCCACCTAAGCTAGGG - Intergenic
1189422048 X:40864765-40864787 CCACACTGCCTCATAAGCAATGG + Intergenic
1189851325 X:45178960-45178982 TCACCCTTACTCCTAAGACATGG - Intronic
1190175478 X:48145585-48145607 ATAGACTCCCTCCTAAGCCAGGG + Intergenic
1190182776 X:48207508-48207530 AAAGACTTCCTCCTAAGCCAGGG + Intronic
1191033057 X:55996391-55996413 CCACACTAGCTCCTAAGCAATGG - Intergenic
1192207772 X:69107505-69107527 TCACACATTCTTCTAAGCCAAGG - Intergenic
1197079836 X:122398704-122398726 TCACACTACCTCTTCAGCAATGG + Intergenic
1197493691 X:127152090-127152112 TCACACTAGCTCCCAAGCGATGG - Intergenic
1199851891 X:151729673-151729695 CCACTGTCCCTCCTAAGCCTGGG + Intergenic
1202080446 Y:21078698-21078720 TCACAATACCTCCTAAGAAAAGG - Intergenic