ID: 1166371259

View in Genome Browser
Species Human (GRCh38)
Location 19:42302490-42302512
Sequence TCCACCTACCTCCTAAGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166371259_1166371261 6 Left 1166371259 19:42302490-42302512 CCTTCACTTAGGAGGTAGGTGGA 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1166371261 19:42302519-42302541 AACCTTCGCTTCCCCCACGACGG 0: 1
1: 0
2: 0
3: 1
4: 57
1166371259_1166371264 17 Left 1166371259 19:42302490-42302512 CCTTCACTTAGGAGGTAGGTGGA 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1166371264 19:42302530-42302552 CCCCCACGACGGCCGCACAGTGG 0: 1
1: 0
2: 1
3: 2
4: 54
1166371259_1166371269 27 Left 1166371259 19:42302490-42302512 CCTTCACTTAGGAGGTAGGTGGA 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1166371269 19:42302540-42302562 GGCCGCACAGTGGGCTCGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 201
1166371259_1166371266 18 Left 1166371259 19:42302490-42302512 CCTTCACTTAGGAGGTAGGTGGA 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1166371266 19:42302531-42302553 CCCCACGACGGCCGCACAGTGGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166371259 Original CRISPR TCCACCTACCTCCTAAGTGA AGG (reversed) Exonic
900253263 1:1682832-1682854 TCCACCTGCCTCCAAAGTGCTGG - Intronic
901076127 1:6555695-6555717 TCCACTTGCCACCTAAGTGCTGG + Intronic
901338237 1:8470500-8470522 TCCACCCACCTCCAAAGTGCTGG + Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903749432 1:25611641-25611663 CCCAGCTGCCTCCTCAGTGAAGG + Intergenic
905339769 1:37270556-37270578 TCCAACAAGCTCCTAGGTGATGG - Intergenic
906032857 1:42734614-42734636 TCCAGAGACCTCCTAAGGGAAGG - Exonic
910518740 1:88093359-88093381 TCCAGATACTTCCTAAGTGCAGG - Intergenic
912473244 1:109920251-109920273 GCCACCTAGCTGGTAAGTGATGG - Intronic
913287701 1:117241697-117241719 TCCTCCCACCTCCTGAGTGTAGG + Intergenic
915251217 1:154590119-154590141 TCCTCCTAACTCCTAAGTGGAGG - Intronic
915962559 1:160279287-160279309 TCCAGCTACCTGCAAGGTGAAGG - Exonic
916209971 1:162352372-162352394 TCTACCTACCCCTTAAGTGTTGG + Intronic
920211514 1:204332056-204332078 TCCACCTGCCTCCTGAGGGGCGG + Intronic
920421248 1:205835378-205835400 AGCACCTACCTCATAAGTGGTGG + Intronic
920600069 1:207316185-207316207 TGCCCCTACCTCCAAAGTGGAGG + Intergenic
922909872 1:229206385-229206407 TCCACCTACCTTTTGAGTTATGG - Intergenic
922941156 1:229467682-229467704 TCCACCCACCTCCAAAGTGCTGG - Intronic
1064156914 10:12909913-12909935 TCCACCTTCCTCCCAAGGGCTGG + Intronic
1066546184 10:36503034-36503056 TCCTCCTTCCTCCTAAGTCAAGG + Intergenic
1067919872 10:50443264-50443286 TTAACCTACTTACTAAGTGACGG + Intronic
1071863170 10:89697085-89697107 TCCCATTACCTCCTTAGTGAAGG - Intergenic
1076286652 10:129305820-129305842 ACCAACTAGCTTCTAAGTGATGG - Intergenic
1078004667 11:7523628-7523650 CCCACCTACTTCCTAAGAAATGG - Intronic
1081846140 11:46241833-46241855 TCCGCCCACCTCCCAAGTGCTGG + Intergenic
1085035878 11:73299737-73299759 TCCACCAGGCCCCTAAGTGAGGG + Intergenic
1085838997 11:79988613-79988635 TCCACATATCTCCTAAAAGATGG - Intergenic
1086192981 11:84102606-84102628 GCCAAATACCTCCTGAGTGAAGG - Intronic
1086894967 11:92301444-92301466 TCCCCCTCCCTCCTAACGGAAGG - Intergenic
1088647352 11:111927374-111927396 AGCACCTACCTCTTAAATGATGG - Exonic
1088735177 11:112722943-112722965 TGCATCGACCTCCTAAGTGGGGG - Intergenic
1089197201 11:116701275-116701297 TCATCCCACCTCCTAAGAGATGG + Intergenic
1092179117 12:6432929-6432951 TCTCCCTACCTCCTTAGTGTAGG - Intergenic
1092683515 12:11015701-11015723 ACTACATACCTCCTAAGTGAAGG - Intronic
1093149591 12:15605306-15605328 CCCACATACCTCCTAAGAGCTGG + Intergenic
1095602188 12:44026420-44026442 TCCACGTGCCTCCAAAGAGACGG + Intronic
1098337689 12:69420667-69420689 TCCTTCTGCCTCCTAAATGAAGG - Intergenic
1098424694 12:70348388-70348410 TCTAACAAGCTCCTAAGTGACGG + Intronic
1101969875 12:109305476-109305498 TCGACCTCCCTCCAAAGTGCTGG - Intronic
1103775719 12:123364974-123364996 CCCGCCTCCCTCCTAGGTGAAGG + Intergenic
1106282646 13:28289518-28289540 TCCACCCACCCCCAAAGTGTTGG + Intronic
1112700461 13:102001881-102001903 CCCACCTGCCACCTAAATGAGGG - Intronic
1115101659 14:29708608-29708630 TCCACCTGCTTCCAAAGTGCAGG - Intronic
1119963402 14:78884988-78885010 TTCACCTACCTAATAAGTGTAGG - Intronic
1122111752 14:99508331-99508353 ACCACCCATCTCCTCAGTGAAGG - Exonic
1123723023 15:23076559-23076581 TACACCTCCCTCCCAAATGAAGG - Intergenic
1125285090 15:38083906-38083928 TTGACTTACCTCCAAAGTGATGG - Intergenic
1126383134 15:48068227-48068249 GCCACCTCCCACCTATGTGACGG - Intergenic
1126532178 15:49723124-49723146 CTCTCTTACCTCCTAAGTGATGG + Intergenic
1131050309 15:89343317-89343339 CCCACCAACCTCCAGAGTGAAGG - Intergenic
1132622022 16:872296-872318 TCAACCTTCCTCCTGAGTTACGG - Intronic
1132839174 16:1970240-1970262 TCCTCCTGCCTCCAAAGTGTTGG + Intergenic
1136179297 16:28539807-28539829 GCCACCCTCCTCCTAGGTGAGGG - Intergenic
1137423803 16:48359473-48359495 TCCGCCTGCCTCCCAAGTGCTGG - Intronic
1138750890 16:59419832-59419854 TCCACCTACATGGTATGTGAAGG - Intergenic
1145178986 17:20728336-20728358 TCCACCTACATCCCAAGGAATGG - Intergenic
1146176465 17:30668709-30668731 TCCATCTGCCTCCCAAGTCAAGG + Intergenic
1146349925 17:32084823-32084845 TCCATCTGCCTCCCAAGTCAAGG + Intergenic
1149838642 17:59937920-59937942 TCCAACTACATCCTAAGGAATGG - Intronic
1151339760 17:73463466-73463488 TGCACCTACCTCCCAGCTGAAGG + Intronic
1151343226 17:73485221-73485243 TCCACCTCCCTCCTGAGGGCAGG + Intronic
1151807404 17:76414698-76414720 TCCAACTGCCTGCTAAGTGAGGG + Intronic
1154476590 18:14765663-14765685 TCCATCTATCTTCTATGTGAAGG - Intronic
1155611856 18:27674948-27674970 TTTAACTACCTCCTGAGTGAGGG - Intergenic
1158928935 18:62301971-62301993 GCCACCTAGCTACTAAGTGGAGG + Intronic
1164537957 19:29100441-29100463 TCCCCCTACCTCCTACCTGAAGG + Intergenic
1166371259 19:42302490-42302512 TCCACCTACCTCCTAAGTGAAGG - Exonic
928026379 2:27742778-27742800 TCCACCCACCTCCCAAGTGCTGG + Intergenic
930474214 2:51859306-51859328 TCCACCTTCCTCCCAACTGCTGG + Intergenic
931027568 2:58130106-58130128 TCCCCCTACCCCCCAATTGAGGG - Intronic
931143134 2:59485673-59485695 GCCACCTACCTTCTAATTAAAGG - Intergenic
933260866 2:80129759-80129781 TCCACATAACTGGTAAGTGATGG + Intronic
935204246 2:100883836-100883858 GCCACCTACCTGGTCAGTGATGG + Intronic
935317587 2:101851588-101851610 CCCAGCTACCTCCAAATTGAGGG + Intronic
935384912 2:102489767-102489789 TTCACCTCACTCCTAAATGAGGG - Intronic
935548697 2:104428856-104428878 TACATCTACCTTCTAAGGGAAGG - Intergenic
935592334 2:104854961-104854983 TCCGTCCACCTGCTAAGTGAAGG - Intergenic
936510070 2:113138033-113138055 ACCACATAGCTCCTAAGTCAGGG + Intergenic
937530842 2:122825223-122825245 TCCACCTACTCCCAAAGTAAAGG + Intergenic
940631728 2:156248702-156248724 TCCACATAACTCCTAACTGAAGG - Intergenic
940973897 2:159922378-159922400 TCCACCTCTCTCCTGAGTGCTGG + Intergenic
941857157 2:170242794-170242816 CCAACCCACCTCCTAAATGATGG + Intronic
944243664 2:197510202-197510224 TCCACCCGCCTCCAAAGTGCTGG + Intronic
944592398 2:201229902-201229924 TCCAGCTAGCACCTTAGTGATGG + Intergenic
945002579 2:205367340-205367362 TCCATCCTCCTCTTAAGTGAGGG + Intronic
948011438 2:234652191-234652213 ATCACCTACCTCCTCAGTAAAGG - Intergenic
948016141 2:234692414-234692436 TTTACCTAGCTCCTCAGTGAGGG + Intergenic
1171092757 20:22301525-22301547 GCCACCCACCTCCTAAGACATGG + Intergenic
1172670891 20:36633775-36633797 TCCAGGTACCTCCTGAGTCAGGG + Intronic
1172821776 20:37742178-37742200 TCCACATCCCTCCTAAAAGATGG + Intronic
1173879232 20:46398760-46398782 TACACCTCCCTCCTAAAAGAAGG + Exonic
1182341150 22:29621942-29621964 ACCACATAGCTTCTAAGTGATGG + Intronic
1182926333 22:34128926-34128948 ACCTCCTACCTCCAGAGTGATGG + Intergenic
949123509 3:417428-417450 TCTACCTACCACCTAAGTCAAGG - Intergenic
949634382 3:5967053-5967075 TCCACCTTTTTCCTAAGTGTTGG + Intergenic
950523173 3:13508281-13508303 AGCACCTACCTCCTAGGTGTTGG + Intergenic
951991897 3:28684380-28684402 TCCACCCACCTCCCAAATGCTGG + Intergenic
953797758 3:45998431-45998453 TCCACCCACCTAATAAGTGGTGG + Intergenic
955598174 3:60614359-60614381 TCCATCCACCTCCAAAGTGCTGG - Intronic
959070859 3:101701005-101701027 TCCACCCACCTCTGAAGGGATGG - Intergenic
959693264 3:109221916-109221938 TCCACCTACTTCCAAAGTGCTGG + Intergenic
962942158 3:140134860-140134882 TGCAACTACCCCCTAAATGATGG + Intronic
964265106 3:154887393-154887415 TCCACATTCCTCCTGAATGAAGG + Intergenic
966450680 3:180057271-180057293 TTCACCTGCCTCTGAAGTGAAGG - Intergenic
968391651 4:197850-197872 TCAACCCTCCTGCTAAGTGATGG + Intergenic
968441660 4:627532-627554 TCCACCTCCCTCCTAAGAAGTGG + Intronic
973650225 4:52991668-52991690 TCCACCCAACTCCCAAATGAGGG + Intronic
974374652 4:61060924-61060946 TCTACCTACCTCCAATGTGGAGG - Intergenic
975462289 4:74668468-74668490 TCTACCTACATCCTCAATGAGGG - Intergenic
981031914 4:140134199-140134221 TCCCCGTACTTCCTAAGTTAGGG - Intronic
981608267 4:146563623-146563645 TCCACCTCCTTTCTGAGTGATGG - Intergenic
981655552 4:147108463-147108485 TGCACCTACCACATATGTGAGGG + Intergenic
982277886 4:153655622-153655644 TCCTTCTACCAGCTAAGTGAAGG - Intergenic
985264759 4:188147301-188147323 TCCCCCTGCCTCCCAAATGAGGG + Exonic
985403531 4:189615153-189615175 TCCACCTGCCTCCCCAGTGCAGG - Intergenic
987161491 5:15148827-15148849 TCCAACTCCCTCCCAAGTGCTGG - Intergenic
992093833 5:73342243-73342265 GCCCCCTGCCTCCCAAGTGAGGG - Intergenic
996402985 5:123083344-123083366 TCCAGCTACCCTCTAAATGAGGG - Intergenic
998622248 5:143807796-143807818 TCCACCTGCTTTCTCAGTGAGGG - Intergenic
1002763194 6:217627-217649 ACCACCCAGCTCCTAAGTGGAGG - Intergenic
1005781997 6:29201964-29201986 TCCACATACCTCGTGAGTGTGGG + Intergenic
1006340527 6:33443947-33443969 TTCACCTACCTGCTTGGTGATGG - Exonic
1006861274 6:37172870-37172892 TTCACCTAGCTCCTGAGAGAAGG + Intronic
1007795781 6:44346036-44346058 TCCACCCACCTCAAAAGTGCTGG - Intronic
1009625173 6:66129938-66129960 TCCACAAACCTCCTAAATGCAGG - Intergenic
1010175131 6:73019148-73019170 TTCACCTACATGTTAAGTGAAGG + Intronic
1010242309 6:73627869-73627891 TCCACCTGCCTCAAAAGTGCTGG + Intronic
1013150383 6:107440135-107440157 GCCATCTACCTCATAAGGGATGG + Intronic
1013184456 6:107745745-107745767 TCCACCTGCCTCCCAAATGCTGG - Intronic
1015141417 6:129938011-129938033 TCTACCTACCTCTTAAGTGTGGG - Intergenic
1017465373 6:154688308-154688330 TCCACCTATTTCCTAAGGGAAGG - Intergenic
1019315204 7:380976-380998 ATCACCTGCCTCCTGAGTGAAGG - Intergenic
1032476643 7:132215726-132215748 TCCATCAACACCCTAAGTGAAGG + Intronic
1033591484 7:142812487-142812509 TCCACCCAGTCCCTAAGTGAAGG + Intergenic
1038772187 8:30493296-30493318 TCCTGCTACCTGCTAAATGAAGG - Intronic
1038948927 8:32392480-32392502 TCCATGTTCCTCCTAAATGAAGG + Intronic
1040647429 8:49415702-49415724 TCCTCCTACATCTTAAATGAAGG + Intergenic
1042312327 8:67391478-67391500 TCCACCTGCCTCCAAAGTACAGG - Intergenic
1042599474 8:70484080-70484102 TCCATGTATCTCCTGAGTGAAGG - Intergenic
1042867900 8:73371667-73371689 TCCACCTAATTCCTAAGAAATGG + Intergenic
1044513343 8:93109621-93109643 TCTACCTAACTCGTGAGTGATGG + Intergenic
1047691994 8:127365430-127365452 TCCAGCTACCACCAAAGTCAGGG - Intergenic
1050139766 9:2505505-2505527 ACCACATCCCACCTAAGTGATGG + Intergenic
1051828197 9:21245624-21245646 ACCAACCACCTCCTAAGAGATGG + Intergenic
1055256619 9:74379424-74379446 ACCACCTACTGCCTAAGAGAAGG + Intergenic
1055729673 9:79267572-79267594 TACACCCACCTGCTGAGTGATGG - Intergenic
1056673050 9:88647935-88647957 TTCACCCACCTCCACAGTGAGGG - Intergenic
1058556961 9:106179366-106179388 TCCACCTCCCTCCCAAGAGAAGG - Intergenic
1203655975 Un_KI270752v1:25158-25180 TGCACCTGACTCCTAAGTGCTGG + Intergenic
1186418740 X:9406563-9406585 GCCACCAATTTCCTAAGTGAAGG - Intergenic
1189439000 X:41017769-41017791 CCCCCCTACCTACTAACTGAGGG - Intergenic
1189684360 X:43548528-43548550 TCCTCCTGCCTCCAAAGTGCTGG - Intergenic
1195537183 X:106022201-106022223 TGCTCCTACCTCCACAGTGAAGG - Intergenic
1199895297 X:152120714-152120736 TCCACCCACCCCCACAGTGAGGG - Intergenic
1201384552 Y:13424474-13424496 TCCGCCCGCCTCCAAAGTGATGG - Intronic