ID: 1166371504

View in Genome Browser
Species Human (GRCh38)
Location 19:42303822-42303844
Sequence CTCTGGGGAGGAAGAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1422
Summary {0: 1, 1: 0, 2: 14, 3: 184, 4: 1223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166371504 Original CRISPR CTCTGGGGAGGAAGAGGAGA AGG Intronic
900126867 1:1072639-1072661 CTCTGGGGCGAGAGAGGGGAGGG - Intronic
900166728 1:1246943-1246965 GTCTGGGGAGGAGGAGGCGAGGG - Intergenic
900247138 1:1641782-1641804 TTCTGAGGAAGAAGAGGAGGAGG - Exonic
900258362 1:1708914-1708936 TTCTGAGGAAGAAGAGGAGGAGG - Exonic
900376180 1:2355891-2355913 CCCTGGGCAGGAAGATGTGAGGG + Intronic
900601361 1:3504106-3504128 CCCAGGGGAGGCAGAGGAGGGGG + Intronic
900601374 1:3504134-3504156 CCCAGGGGAGGCAGAGGAGGGGG + Intronic
900658358 1:3771281-3771303 CTCTCTGGAGGAGGAGGAGAGGG + Intronic
901142045 1:7041253-7041275 CTCTGCAGAGGAAGCCGAGAAGG - Intronic
901147224 1:7073453-7073475 GACTGGGGAGGGAGTGGAGATGG + Intronic
901215937 1:7555456-7555478 CTCAGGAGAGAAAGAGGAGAAGG - Intronic
901345330 1:8535751-8535773 CTAGGAAGAGGAAGAGGAGAAGG + Intronic
901380511 1:8870639-8870661 TTCTGGGGGGAAAGGGGAGAGGG - Intronic
901630761 1:10647088-10647110 CTCTGGGGAGGAGGAGGGGGAGG + Intronic
901640147 1:10688971-10688993 CTCTGAAGATGAGGAGGAGAAGG + Intronic
901731356 1:11282476-11282498 CTCTGGGGAGGAAAAAGATCTGG - Intronic
901740402 1:11338223-11338245 CGAGGAGGAGGAAGAGGAGAAGG - Intergenic
901881353 1:12195684-12195706 CTCTATGGAGGAGGAGGACAAGG + Intronic
901928911 1:12584279-12584301 CCCTGGAGAGGAAGTGGAGCAGG + Intronic
902255686 1:15187280-15187302 CGCAGGGGAGGAAGAGATGAGGG - Intronic
902388211 1:16088128-16088150 CTCCTGGGAGGAAGAGGGGGAGG + Intergenic
902439184 1:16418159-16418181 CTGTGGGGGAGAAGAGGAGAGGG - Intronic
902572120 1:17353575-17353597 CTCCTGGGAGGCAGGGGAGATGG + Intronic
902673005 1:17987979-17988001 CCCTGGGGAGGGAGAGCAGGCGG + Intergenic
902730968 1:18368677-18368699 GTCAGGGGAGGAAGAGGCCATGG - Intronic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902918420 1:19652489-19652511 CACTGGGGAGGAAGGGCAGCTGG - Intronic
903115618 1:21176521-21176543 CTGGGGGGAGGAGGAGGAGGGGG + Intronic
903398039 1:23017622-23017644 TTGTGGGGAGAAAGATGAGAAGG - Intergenic
903467686 1:23563640-23563662 CTGAGGGGAGGAGAAGGAGAAGG - Intergenic
903500665 1:23798656-23798678 CTCTGTGGAGTTTGAGGAGATGG - Exonic
903535390 1:24063233-24063255 GGCTGGGGAGACAGAGGAGAAGG + Exonic
903649226 1:24912938-24912960 CTTGGGAGAGGAAGATGAGAAGG + Intronic
903733616 1:25516267-25516289 CTCTGAGGAGGAAGAGAGGCAGG - Intergenic
904417693 1:30373219-30373241 CCTTGGGGAGAAAGAGGAGGAGG - Intergenic
904521783 1:31101366-31101388 CTCTGGGTAGGAATAGGAACAGG + Intergenic
904621297 1:31776884-31776906 ATCTGGGGAGGCAGGGCAGAGGG + Intergenic
904911502 1:33937610-33937632 CTCAGAGGAGGAAGAGAGGAAGG - Intronic
904961835 1:34339485-34339507 TTCAAGGTAGGAAGAGGAGAAGG + Intergenic
904975449 1:34452565-34452587 CTCTGGGGAGAAATGGGTGAGGG + Intergenic
905442993 1:38006246-38006268 CTCAGGGGTGGTGGAGGAGAGGG + Intergenic
905584528 1:39106023-39106045 TGCTGGGGAGGAGGAGGAGGAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905787936 1:40772744-40772766 CTCCTGGGAGGAAGATCAGAGGG - Intergenic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
905977806 1:42191497-42191519 CGATGGGGAGGATGTGGAGATGG + Exonic
906205780 1:43985634-43985656 CTCTGGGGAGTAAGGGGTGAGGG - Intronic
906522379 1:46475080-46475102 GTCTGGGGAGGAAGAGGAGTAGG + Intergenic
906665766 1:47620945-47620967 CCCTGGGGTAGAAGAGGAGGGGG + Intergenic
906929056 1:50150602-50150624 CTATTGGGTTGAAGAGGAGAGGG + Intronic
907427039 1:54386408-54386430 AGCTGGGGAGGATGGGGAGATGG + Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907537000 1:55171876-55171898 CACTGTGAAGGAAGAGGAGGAGG + Intronic
908044514 1:60154202-60154224 TTCTAGGGAGGAACAGGAAATGG - Intergenic
908387163 1:63653688-63653710 CGCTGGGGAGGAAAAAGAGAGGG + Intronic
908474782 1:64476796-64476818 CTTGGGGGAGGGAGAGGAGATGG + Intronic
908792705 1:67798589-67798611 CACTGGGTAGGCTGAGGAGAAGG - Intronic
908901609 1:68962883-68962905 CTCTGGAGGGGCAGAGGTGAAGG - Intergenic
909127502 1:71692629-71692651 CACTGGGGAGTAAGAGGAGGAGG - Intronic
909436541 1:75648546-75648568 CTCAGGGGAGGAAGAAGGGAAGG + Intergenic
909601178 1:77463230-77463252 CTCTGGGGAGGAGTAAGTGAGGG + Intronic
909887233 1:80957512-80957534 CTCTCTGGAAGAAAAGGAGAAGG - Intergenic
910288222 1:85577198-85577220 CCCTGCGGAGGGAGCGGAGAGGG - Intronic
910542358 1:88374547-88374569 CTAAGAGGAAGAAGAGGAGAAGG - Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910855621 1:91692346-91692368 CTCTGGGGAGTGAGAAAAGAAGG + Intronic
911061475 1:93751693-93751715 CTCTGGGGGCCAAGAGGAAAGGG - Intronic
912329061 1:108800521-108800543 CTATGTGAAGGAAGAGGAGGTGG - Intronic
912408620 1:109464397-109464419 TTCTGGGGAGGAAGGAGGGAGGG + Intergenic
912855738 1:113167455-113167477 GTCTGGGGAGGTAGAAGTGAAGG + Intergenic
913100917 1:115564459-115564481 CTATGGCGAGGAGGAGGAGGTGG + Intergenic
913320406 1:117584136-117584158 GGCTGAGGAGGAGGAGGAGAAGG + Intergenic
913341053 1:117758609-117758631 CACTGGGGAGACAGAGGTGAAGG + Intergenic
915095640 1:153460312-153460334 ATCCAGGGAGGAAGAGGACAGGG + Intronic
915291644 1:154888170-154888192 CTCTAGGGATGAGGAGGAGTTGG - Intergenic
915320447 1:155053187-155053209 CTCTGGGCAGGAAGCCGAGAAGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915348442 1:155209708-155209730 AAGTGAGGAGGAAGAGGAGAAGG - Intronic
915455134 1:156035568-156035590 CTTTGAGGAAGGAGAGGAGAGGG - Exonic
915633733 1:157172166-157172188 CTCCGGGGAAGAATAGGGGAGGG + Intergenic
915637558 1:157197120-157197142 CTCCGGGGAAGAATAGGGGAGGG + Intergenic
915658002 1:157377474-157377496 CTCTGGGGAAGAATGGGGGAGGG + Intergenic
915931234 1:160062152-160062174 CTCTGGGCAGGCTGGGGAGATGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916276421 1:162998971-162998993 CTAGGGGGAGGTAGATGAGAAGG + Intergenic
916658144 1:166896261-166896283 CTATTTGGAGGAAGAGCAGATGG + Intergenic
916792228 1:168135515-168135537 CTCAGGGCAGAAAGAGGAGGTGG - Intronic
917098035 1:171418989-171419011 GACTGGGGAGGAGGAGGAAATGG + Intergenic
917437975 1:175040291-175040313 CACTGGGAAGGAAGTGTAGAGGG + Intergenic
917674405 1:177305329-177305351 GTAAGGGGAGGAAGAGGTGAGGG - Intergenic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918837567 1:189487487-189487509 CTCAGGGGAGTAATAAGAGATGG - Intergenic
919494308 1:198245179-198245201 CATTGGGTAGGCAGAGGAGAAGG + Intronic
919943466 1:202304087-202304109 CTCGGAGGAGGGAGAAGAGATGG - Intronic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920039260 1:203085266-203085288 CAGTGGGGAGGAAGTGCAGAAGG - Intronic
920081208 1:203374055-203374077 CTCAGGGGAGGGAAAGGAGGAGG + Intergenic
920113150 1:203601141-203601163 CTCTGGAGGAGAACAGGAGAGGG - Intergenic
920205128 1:204285924-204285946 CTTGGGGGAGGAGGAGGAAAGGG + Intronic
920221802 1:204409782-204409804 TTCTGGGGAGGAAGATGACTGGG - Exonic
920345837 1:205305181-205305203 CTCTGGTGAGTAAGAGGTGTGGG - Exonic
921092852 1:211859679-211859701 CTATGGGTAGGAAAAGCAGAGGG + Intergenic
922132175 1:222790665-222790687 ATATGGGGGGGAAGAGGAAATGG + Intergenic
922133453 1:222801701-222801723 CTCCCGGGAGGAAGAGTGGAAGG + Intergenic
922159620 1:223069153-223069175 CTTTGAGGAGGTACAGGAGAAGG - Intergenic
922319289 1:224471377-224471399 GAGTGGGGAGGAAGAGGGGATGG - Intronic
922440810 1:225653498-225653520 CTCTGGGGAGCGGGAGGCGACGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922507282 1:226133868-226133890 GCCTGGGGAGGGAGAGGAGCTGG + Intergenic
922911551 1:229221937-229221959 TTCTGGAAAGGAAGGGGAGAAGG + Intergenic
922917557 1:229271104-229271126 CCGCGAGGAGGAAGAGGAGATGG - Intronic
923268490 1:232334651-232334673 TGATGGGGAGAAAGAGGAGAAGG - Intergenic
923275065 1:232388352-232388374 CTCTGGGGAGAAAGAGGAGGAGG + Intergenic
923280117 1:232435830-232435852 CTCTTGTGAGGAAGAGGGTAGGG - Intronic
923354479 1:233140667-233140689 CTCTGGGGAGGAGGAGCAGCTGG + Intronic
923397798 1:233584204-233584226 CTCTCAGCAGGAAGAGGAGCTGG - Intergenic
923438880 1:233996522-233996544 CTCAGGGGAGGATGAGGACTTGG + Intronic
923524734 1:234763825-234763847 ATCAGGGGAGGAAGAAGAGTTGG - Intergenic
923756557 1:236795927-236795949 GCCTGGGGAGAAAGAGGTGAAGG - Intronic
923814149 1:237356809-237356831 CTCTTGGGAGAAAGTGGAGTAGG - Intronic
923836308 1:237615014-237615036 ATCTGGGAAACAAGAGGAGATGG - Intronic
923986289 1:239386583-239386605 GTCCGGGGAGGAGGAGGAGCAGG + Intronic
1062766671 10:71388-71410 CTTTGGGGAGGCCGAGGTGAGGG + Intergenic
1062821413 10:537107-537129 CTCTGTGGGGGAAGAAGTGAGGG + Intronic
1063493943 10:6489705-6489727 GGCAGGGGAGGGAGAGGAGAGGG + Intronic
1063499023 10:6536602-6536624 CTGGCTGGAGGAAGAGGAGAAGG - Intronic
1063610190 10:7555053-7555075 ATCTGGGGTGCAAGAGGAGTTGG - Intergenic
1064067557 10:12195709-12195731 CTTTGGGGAGGAGAAGAAGAAGG - Intronic
1064111935 10:12547109-12547131 TTGAAGGGAGGAAGAGGAGATGG + Intronic
1064195971 10:13244367-13244389 TTTTGGGGAGGGAGAGGATAAGG + Intergenic
1064389316 10:14927790-14927812 CTCTGGGTAGGTTGATGAGATGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065021039 10:21501567-21501589 GGGTGGGGAGGAAGAGGAGCAGG + Intergenic
1065025196 10:21534407-21534429 CGCTGAGGAGGAGGAGGAGGCGG + Exonic
1065104553 10:22369206-22369228 TACTGGGCAGGAAGAAGAGAAGG + Intronic
1065382218 10:25101948-25101970 CTGTAGGCAGGAACAGGAGATGG + Intergenic
1065801243 10:29354952-29354974 CTTTGAGGAGGAACAGGGGAGGG - Intergenic
1066990937 10:42512721-42512743 CTGCATGGAGGAAGAGGAGATGG - Intergenic
1067232256 10:44420063-44420085 CTCTGTGGAGGAGGAGAGGAAGG + Intergenic
1067269334 10:44775723-44775745 GCCTTGGGAGGAAGAGGAGTGGG + Intergenic
1067285772 10:44906696-44906718 CTCTGGGGAGCATGAGAAGTCGG - Intergenic
1067448081 10:46365114-46365136 GACTGAGGAGGAAGAGGAGGAGG - Intergenic
1067559977 10:47298440-47298462 TTCTGGGGGGGAAGGGGAGAGGG + Intergenic
1067589299 10:47495647-47495669 GACTGAGGAGGAAGAGGAGGAGG + Intergenic
1067636424 10:48003729-48003751 GACTGAGGAGGAAGAGGAGGAGG + Intergenic
1068228707 10:54140924-54140946 AGTTGGGGAGGCAGAGGAGAGGG - Intronic
1068913407 10:62403300-62403322 GGCTGAGGAGGAAGAGGAGGAGG + Intronic
1069631082 10:69897363-69897385 CCCCAGGGAGGGAGAGGAGAGGG + Intronic
1069701425 10:70429420-70429442 CACTTGGAGGGAAGAGGAGAGGG - Intergenic
1069702043 10:70434063-70434085 CTCTGGGGAGCATGAGCACATGG - Intronic
1069882280 10:71601190-71601212 TTCTAGGGAGGAGTAGGAGAAGG + Intronic
1070354038 10:75621630-75621652 CTGTGGGGAGCAAGAGGGGGAGG + Intronic
1070415868 10:76188704-76188726 CTCTAGGGAGGATGAGTGGATGG + Intronic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1071705693 10:87996002-87996024 CTCTGTGGAGAAATAGTAGATGG - Intergenic
1072288552 10:93940807-93940829 CGCAGGGGAGGAACAGCAGAAGG - Intronic
1072615033 10:97043512-97043534 TTCTGGGGAGGAACGGGGGAGGG + Exonic
1072797190 10:98365102-98365124 CACTGGGGATGAAGAGAAAAAGG + Intergenic
1073033921 10:100549710-100549732 CTCTGGAAGGGAAGAGGAGTTGG + Exonic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073063678 10:100746242-100746264 CCATGGGGAGGCAGAGGAGCGGG - Exonic
1073207969 10:101778688-101778710 CTCTGGGGGAGAGGAGCAGATGG + Intronic
1073347497 10:102794891-102794913 CTCTAGCAAGGAAGAGGTGAAGG - Intronic
1073424085 10:103445849-103445871 CCCTGGGGAGCAAGAGTAGAGGG + Exonic
1074359343 10:112812708-112812730 CATTTGGGAGGAAGAGTAGAAGG - Intronic
1074814921 10:117136348-117136370 CCCTTGGGAGGTGGAGGAGATGG - Intronic
1074817306 10:117152129-117152151 AACTGGGGAGGAAGAAGAGAGGG - Intergenic
1074884366 10:117683236-117683258 CTCTGGGGTGGAGGAGTTGAGGG - Intergenic
1074955416 10:118383931-118383953 TTCTGGAGAGGCAGAGGAGTAGG + Intergenic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075282540 10:121152736-121152758 CGCTGGGGAAGAGGAGGAGAAGG - Intergenic
1075697641 10:124448195-124448217 CTCTAGGGAGGACGAGGACGAGG - Intronic
1075719149 10:124574876-124574898 CCCTGGGGAGAGAGTGGAGAAGG - Intronic
1075850818 10:125585443-125585465 CTTGGGGGAGAAAGGGGAGAAGG - Intronic
1075961053 10:126567988-126568010 CTCTGGGAAAGGAGAGGAAATGG + Intronic
1076676225 10:132149081-132149103 CTATGGGGAGGATCAGGGGAGGG - Intronic
1077015602 11:397802-397824 CTCAGCAGAGGAAGAGCAGAAGG + Intronic
1077028408 11:451914-451936 CCCTCGGGAGGGAGAGGAGATGG + Intronic
1077121098 11:908872-908894 TTCAGGGAAGGAAGAGGAAAGGG + Intronic
1077332869 11:1990968-1990990 CGCTGGGCAGGAGGAGGAGGAGG + Intergenic
1077552414 11:3206555-3206577 CTTTGAGGAGGATGTGGAGAAGG + Intergenic
1077745823 11:4903877-4903899 CTATGGGGAGGAAGAGTAAGTGG + Intronic
1078067087 11:8085651-8085673 ATGAGGGCAGGAAGAGGAGAAGG + Intronic
1078233806 11:9465935-9465957 CACTTGGGAGGCTGAGGAGAAGG - Intronic
1078438887 11:11347870-11347892 CTATGGGGAGGAAGACGAGGTGG + Intronic
1078494819 11:11806536-11806558 GTCAGGGGTGGAAGTGGAGAAGG - Intergenic
1079117687 11:17650974-17650996 ACATGGGGAGGTAGAGGAGAGGG + Intergenic
1079132596 11:17756337-17756359 CTTGGGGGAGGAGTAGGAGAGGG - Intronic
1079307354 11:19334848-19334870 CTCTGAGGAGGTAAATGAGATGG - Intergenic
1079407005 11:20156408-20156430 CCCTGGGAACGAAGAGGAGGAGG - Exonic
1079527685 11:21410395-21410417 CTCTGAGGAGGAAGGCGAGTAGG + Intronic
1079952133 11:26819039-26819061 GTATGGGGAGGAAGAGGTGGTGG + Intergenic
1080044564 11:27795805-27795827 CTCTGAGTATGAAGAGGGGATGG + Intergenic
1080329640 11:31120910-31120932 CCATGGGGATGAAGAGGAGGAGG + Intronic
1080451656 11:32383208-32383230 GTCTGGGAAGAAAGATGAGACGG - Intergenic
1081627032 11:44662320-44662342 CTGAAGGGAGGAAGATGAGAAGG - Intergenic
1081674448 11:44960419-44960441 CCCTGGGGAGGCAGGAGAGAGGG - Intergenic
1081738860 11:45424269-45424291 CTAGGGGGAGGGAGAGGAGAAGG - Intergenic
1081871962 11:46387068-46387090 CTCAGGGAAGCAAGAGGAGGAGG + Intergenic
1082002468 11:47400521-47400543 GTCTGAGAAGGAAGAGGAAAGGG + Intergenic
1082009064 11:47438219-47438241 CCCTGGGGCAGAGGAGGAGAGGG - Intronic
1082782782 11:57300304-57300326 GCCTGGTGTGGAAGAGGAGAAGG - Intronic
1082821215 11:57545929-57545951 CTCAGGGGAGAAGAAGGAGAAGG + Exonic
1083430308 11:62610953-62610975 CTCTGAGGGGGATGAGGAGGAGG + Exonic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083647923 11:64183884-64183906 CTGTGTGGAGGAAGAGGGGAGGG - Intergenic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084165103 11:67371965-67371987 CACCGGGGAGGAAGCAGAGATGG - Intronic
1084197245 11:67530500-67530522 CTAGGGGGAGGAGGAGGAGGTGG - Intergenic
1084276291 11:68052665-68052687 TGCTGGGGAAGAAGAGGAGGAGG + Intergenic
1084418763 11:69049710-69049732 CTCTGGGGTGGCAGAGGGCAAGG - Intronic
1084756196 11:71240392-71240414 CTGTTTGGAGGAACAGGAGAGGG - Intronic
1084857029 11:71995989-71996011 CTGTGAGGAGGAAGAGGAGGGGG + Intronic
1084958925 11:72706038-72706060 CTGTGGGGAGCAAGAGTACACGG - Intronic
1085232613 11:74985716-74985738 CTCATGGGAGGAAGAGCATAAGG - Intergenic
1085263670 11:75223876-75223898 TACTGGGAAGGAAAAGGAGAGGG - Intergenic
1085274550 11:75289930-75289952 CTCTTGGGAAGCAGAGGAAACGG - Intronic
1085362484 11:75903073-75903095 AGGTGGGGAGGAGGAGGAGAAGG - Intronic
1085366689 11:75954037-75954059 CCCTGGGGATAAAGAGGTGAAGG - Intronic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1085527796 11:77174166-77174188 GGCTGGGGAGAAAGAGTAGAAGG - Intronic
1085641796 11:78197346-78197368 CCCTGGGTAGGCAGAGGTGAGGG + Intronic
1085705981 11:78787084-78787106 CTGTGGGGAGGAGCAGAAGAAGG + Intronic
1085709295 11:78814394-78814416 CTCTGGGGAGAGAAAGGAGAAGG + Exonic
1085829934 11:79888822-79888844 CTTTGGGAAAGAAGATGAGAAGG + Intergenic
1085917181 11:80903608-80903630 GTATGGGGAGGAACAGGAGGTGG - Intergenic
1086079372 11:82887646-82887668 CTTGGGGGAGAAAGAGGAGTAGG - Intronic
1086199147 11:84179631-84179653 CTCTGGCAGGGAAGAGGAAAAGG + Intronic
1087053391 11:93908282-93908304 CTCTGGGGAGGGAGAAGATCAGG + Intergenic
1087122779 11:94592114-94592136 GGGTGGGGAGGAAAAGGAGATGG - Intronic
1087932840 11:103998368-103998390 CTCTGGGGAGGGAGAGGGCCTGG + Intronic
1088062653 11:105674923-105674945 CTCTGAGGATTAAGAAGAGAGGG - Intronic
1088183048 11:107133763-107133785 CTATGGGGAGACAGAGGAAAAGG + Intergenic
1088363931 11:109019173-109019195 TCCTTGGGGGGAAGAGGAGAAGG + Intergenic
1088409091 11:109513678-109513700 CTCTGGGGAGACAGTGTAGATGG + Intergenic
1088592404 11:111414947-111414969 CTTTGGGGAGGCTGGGGAGAGGG + Intronic
1088971978 11:114781618-114781640 CATTGGGGAGGAAGGCGAGATGG + Intergenic
1089183513 11:116598951-116598973 CTCTCAGCAGGAAGAGGAGACGG + Intergenic
1089318736 11:117610548-117610570 CGGTGGGGAGGAAGAGGTAATGG + Intronic
1089361947 11:117896655-117896677 TTCTGGGGAGGAAGGTGACAAGG + Intergenic
1089411995 11:118252095-118252117 CTCTGGGAAGGAAGGAGGGAGGG - Intronic
1089518772 11:119050026-119050048 CTCTTTGGAGAAAGAGGAGCTGG - Intronic
1089530715 11:119127082-119127104 CTCTGGGGAGGAGGAGGAAGAGG + Exonic
1089610285 11:119664974-119664996 CTATGAGGAGGAGGAGGAGGAGG - Exonic
1089619041 11:119712081-119712103 GTCTTGGGAAGAAGAGGACAAGG + Intronic
1089704218 11:120265831-120265853 CCCTGGAGTGTAAGAGGAGAGGG - Intronic
1089989965 11:122850047-122850069 CTCTGTGGAGGAAGAGAAATGGG - Exonic
1090031347 11:123209217-123209239 GGCTGGGGAGGAACTGGAGATGG + Intergenic
1090098159 11:123764476-123764498 ATCTGGGCAGGAGGAGGGGAAGG + Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090193251 11:124791762-124791784 CACTGGGGAGGAGGAGGATGTGG + Intronic
1090204860 11:124878489-124878511 TGCTGGGGAGGAAGGGGAGGGGG + Intronic
1090415483 11:126537417-126537439 TTGTGGGGAGGAAGCAGAGAAGG + Intronic
1090533333 11:127613886-127613908 TTCTGAGGAGGAGAAGGAGAGGG + Intergenic
1090534769 11:127628586-127628608 CTCTGGGGATGAGGAGGTGATGG + Intergenic
1090750173 11:129739716-129739738 CTCTGGGGAAGAAAACAAGAAGG - Intergenic
1090875343 11:130784108-130784130 CTCAGAGGAGGAAGAAAAGAGGG - Intergenic
1090951267 11:131475486-131475508 CCCTGAGGAGGAGGAGGAGGAGG + Intronic
1090976839 11:131686507-131686529 GGCTGAGGAGGAAGAGGAGGAGG + Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1202815852 11_KI270721v1_random:46144-46166 CGCTGGGCAGGAGGAGGAGGAGG + Intergenic
1091621316 12:2091513-2091535 CTCTTTGCAGGTAGAGGAGAGGG - Intronic
1091622075 12:2096736-2096758 GGCTGGGGAGGAAGAGAAAATGG - Intronic
1092118892 12:6029926-6029948 CTCTGGGGAGGGGGAGGTGGTGG - Intronic
1092234434 12:6797375-6797397 GTCAGGGGAGAAAGAGCAGAGGG - Intronic
1092796096 12:12111336-12111358 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
1092888846 12:12950177-12950199 CACTCAGGAGGAAGAGGAGCTGG + Exonic
1093227946 12:16507905-16507927 CAATAGGAAGGAAGAGGAGATGG + Intronic
1093464918 12:19439661-19439683 CGGTGGGGAGGAGGAGGAGGAGG + Exonic
1093508411 12:19896833-19896855 CTCTGGGGAGGACGAGGAGGAGG - Intergenic
1093823933 12:23658544-23658566 TTCTGGGAAGGCAGAGGAGAGGG + Intronic
1094056427 12:26273773-26273795 ATTTGGGGAAGAAGAGGAAATGG - Intronic
1094556648 12:31506982-31507004 CTCTGGAGAGGGAAAGGAGTTGG - Intronic
1095343332 12:41118753-41118775 CACTGGGGAAGAATAGAAGAGGG + Intergenic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1095412712 12:41941722-41941744 CTCTTGTGTTGAAGAGGAGAGGG - Intergenic
1095517646 12:43024233-43024255 CTTTGGGGAGGGTCAGGAGAGGG + Intergenic
1096199920 12:49674155-49674177 CTCTGGAGAGGAGGATGGGAGGG - Intronic
1096408175 12:51358778-51358800 GTCTGGGGAGTCACAGGAGATGG - Intronic
1096521887 12:52189146-52189168 CTCTGGGTAAAGAGAGGAGAGGG - Intronic
1096607174 12:52775156-52775178 CTCTGGGCTGGAATAGGAGGGGG + Intronic
1096648248 12:53049669-53049691 CGCTGGGGAGGGAGTGGAGCTGG - Intronic
1096670984 12:53198081-53198103 CTGTGGCGAGGAAGAGGGGAGGG - Intronic
1096884023 12:54698918-54698940 CTCCGTGGAGGAGGAGGAGCGGG - Intergenic
1096956356 12:55529963-55529985 CCCTGTGGAGGATGAGAAGATGG - Intergenic
1096987725 12:55772480-55772502 CTCTGGGGTTGAAGAGGAGTGGG - Intronic
1097154941 12:57006015-57006037 CACTGGGCAGCCAGAGGAGAGGG + Intronic
1097296009 12:57963763-57963785 TTGTGGGGAAGAAGAGGAGGAGG + Intergenic
1097649191 12:62274988-62275010 TTCTGAGGATGAAGAGGCGAGGG + Intronic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1097800826 12:63912060-63912082 CACTGGGGAAGAAGAGAAGGGGG + Intronic
1097878943 12:64669793-64669815 CACTGAGGAGGAAAAGGAGCTGG + Intronic
1098148990 12:67526901-67526923 CTGCAGTGAGGAAGAGGAGAGGG + Intergenic
1098457837 12:70695586-70695608 ATCTGGGCAGGAAATGGAGAAGG + Intronic
1098845183 12:75525902-75525924 CCCAGGGGAGGTAGAGGGGATGG + Intergenic
1098913375 12:76233093-76233115 ATTTTGGGAGGAAGAGGAGAAGG - Intergenic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1100058826 12:90546567-90546589 CTGGGGTGAGCAAGAGGAGAAGG - Intergenic
1100201245 12:92299913-92299935 GGAGGGGGAGGAAGAGGAGAAGG + Intergenic
1100460594 12:94795600-94795622 TGCTGAGGAGGAAGAGGGGAGGG - Intergenic
1100529621 12:95451558-95451580 GGATGGGGAGGTAGAGGAGAGGG + Intergenic
1101007955 12:100419895-100419917 TTCTGGGGAGAAACAGGAGTGGG + Exonic
1101128532 12:101664664-101664686 CTGGAGGGAGGAAGAGGAGAGGG + Intronic
1101283409 12:103283574-103283596 CTCTGGAGAGGAAAATGAGCTGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101464551 12:104934865-104934887 CGGTGGGGAGGAAGAGGAATGGG + Intronic
1102074289 12:110047833-110047855 CTCTGGGAAAGAAGAGGGGTGGG + Intronic
1102300027 12:111765105-111765127 CTCTGGGGGGGAAGCTGAGGCGG - Intronic
1102350020 12:112185066-112185088 TCCTGGGGAGGACGAGGAGGAGG + Exonic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102443213 12:112979293-112979315 CTCTGGGGAGGAAGGGGGACTGG + Intronic
1102637292 12:114335595-114335617 GGCTGGGAAGGAAGAGGAGGGGG + Intergenic
1102657204 12:114492050-114492072 CTTTGGAGAGGAAGGGGAGTGGG + Intergenic
1102680725 12:114688600-114688622 CTTTGGGGAGGAGGAAGGGATGG - Intergenic
1102908266 12:116694017-116694039 CTCTGGAACGGAAGAGGAGAGGG + Intergenic
1102914163 12:116740383-116740405 CTCTGGAGACGAAGAGGAGGGGG + Exonic
1103191407 12:119005116-119005138 CTCTGGGGGAAAGGAGGAGAAGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103516887 12:121513987-121514009 GTGTGGGGAGGAGCAGGAGATGG - Intronic
1103564872 12:121810540-121810562 CTGGGAGGAGGAGGAGGAGATGG - Exonic
1103566323 12:121817611-121817633 CACCGAGGAGGAAGAGGAGGCGG + Exonic
1103780747 12:123397277-123397299 CCCTGAGGGGGAAGAGCAGAGGG - Intronic
1103884129 12:124188277-124188299 CTCCTGGGAGGAAGAGGAGGAGG - Intronic
1104083582 12:125455219-125455241 CTAGGGGGAGAGAGAGGAGAGGG + Intronic
1104425299 12:128671904-128671926 CCCATGGGAGGAAGAGGAAAAGG + Intronic
1104637434 12:130447069-130447091 CTCGGAGGAGGAGGAGGAGGAGG + Intronic
1104714210 12:131005838-131005860 CTCTGGGGAGAAGGAAGTGAAGG - Intronic
1104761710 12:131300805-131300827 CCCTGGGAAGGAGGAGGAGGAGG - Intergenic
1104818063 12:131659980-131660002 CCCTGGGAAGGAGGAGGAGGAGG + Intergenic
1104836733 12:131796457-131796479 CTCTGGGAAGCAAGGGGACAGGG + Intronic
1104951959 12:132445190-132445212 CCCTGGGGTGGAGGAGAAGATGG - Intergenic
1105389054 13:19958720-19958742 CGCTGGTGAGGAGGAGGAGGCGG - Exonic
1105604717 13:21917376-21917398 CTCTGGGGAGGGAGAGAGGCTGG + Intergenic
1106014595 13:25856747-25856769 GGCTGGGGAGGAAGGGGAGAAGG - Intronic
1106153531 13:27130083-27130105 CTCTGGGGATGCTGAGGAGTAGG - Intronic
1106414930 13:29538549-29538571 CACTAGGGAGGAGGAGGAGCAGG + Intronic
1106568236 13:30905560-30905582 TACTGGGGAGGCAGGGGAGAAGG + Intergenic
1106758525 13:32845719-32845741 CTGTGGGGAATCAGAGGAGATGG - Intergenic
1106795139 13:33197745-33197767 CTCCTGGGAGGAACAGGAAAAGG - Intronic
1106923459 13:34588917-34588939 GCCTTGGGAGGAGGAGGAGAAGG - Intergenic
1107028776 13:35830036-35830058 CTGTGGGGTAGAGGAGGAGAAGG + Intronic
1107800874 13:44107032-44107054 CTGAGGGGTGGCAGAGGAGAGGG - Intergenic
1107939188 13:45369404-45369426 CTTTAGGGAGGAAGAGTAGAAGG - Intergenic
1107978686 13:45714036-45714058 CTCCGGGGAGGAGGAGGCCAAGG + Exonic
1108401846 13:50053008-50053030 CTCTGGAGTGGAAGAGGTGGAGG - Intergenic
1108640523 13:52378750-52378772 CCCTGGGGCTGAAGAGGAGATGG + Exonic
1108993162 13:56689861-56689883 CAGTGGGGAGGATGTGGAGATGG + Intergenic
1109047003 13:57425661-57425683 CTCTGGACAGGAATGGGAGATGG - Intergenic
1109166084 13:59037272-59037294 CTCTGGGGACTCAGAGGAAAGGG + Intergenic
1109327395 13:60884942-60884964 TCCTGGGGAGGAAAAGGAAAAGG - Intergenic
1109537171 13:63737619-63737641 GTCTGGGGGGGAAGAGGGGCTGG + Intergenic
1110355402 13:74561464-74561486 CTCCAGGGAGGAAAAGGAGCAGG - Intergenic
1110540176 13:76699126-76699148 CTCTGGGGAGGAAGAGAGAATGG - Intergenic
1110596563 13:77326677-77326699 CGCCGGGGAGGAAGAGAAGGTGG + Exonic
1110965536 13:81690241-81690263 AGGTGGGGAGGAAGAGGAGGAGG + Intergenic
1111021350 13:82456547-82456569 GGCTGAGGAAGAAGAGGAGAAGG - Intergenic
1111622854 13:90746726-90746748 CAAAGAGGAGGAAGAGGAGAAGG - Intergenic
1112012007 13:95300941-95300963 CTCGGGGGAGGAGGAGCAGGAGG - Intronic
1112111788 13:96308587-96308609 CTCTGGAAAGGTAGAGGTGAAGG + Intronic
1112267871 13:97942006-97942028 TGCTGGGGAGGAAGAGAAAACGG + Intergenic
1112331797 13:98482734-98482756 CAGGAGGGAGGAAGAGGAGAGGG - Intronic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113163940 13:107416441-107416463 CTTTGAGTAGGATGAGGAGAAGG - Intronic
1113601367 13:111571222-111571244 TGCTGGGGAGGCAGAGGAAATGG + Intergenic
1113653643 13:112055469-112055491 CTGTGGGGAGGAGGCAGAGAGGG + Intergenic
1114317981 14:21524930-21524952 CCCTGAAGAGGAAGAGGAGGAGG + Exonic
1114465961 14:22922948-22922970 TGCTGGGGATGAAGAGGTGAAGG - Intronic
1114629075 14:24147701-24147723 GCCGGGGGAGGAAGAGGAGCGGG + Exonic
1114990173 14:28276815-28276837 CTCTAGGTGGGAAGAGGGGAGGG + Intergenic
1115306152 14:31935899-31935921 CTCTGGAGAGGAGGAAGAGAGGG - Intergenic
1116336013 14:43657474-43657496 CTCTGGGGAGTCAGGGGAAATGG + Intergenic
1116883004 14:50190961-50190983 CTCTGGTGGGGAAGAGAAGAGGG - Intronic
1116974862 14:51104969-51104991 CTCAGGAGAGAAAGAGAAGATGG - Intergenic
1117294831 14:54369913-54369935 CTCCTGAGAGGAAGAGGGGAGGG - Intergenic
1117639633 14:57784831-57784853 GGCTGAGGAGGAAGAGGACAAGG - Intronic
1117867464 14:60165000-60165022 GGTTGGGGAGGAAGAGGCGAGGG - Intronic
1118225022 14:63890553-63890575 CTCTGGAGAGAATGAGGGGAGGG + Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118770365 14:68938885-68938907 CTCTGGCCAAGAGGAGGAGATGG + Intronic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119615492 14:76096195-76096217 CTCTGGCCAGGCAGAGGAAAGGG - Intergenic
1119653536 14:76400320-76400342 ATCTGGGGAGAAAGAGCACAGGG + Intronic
1119686594 14:76637518-76637540 CTCTGTGAAAGATGAGGAGAGGG - Intergenic
1119773305 14:77234821-77234843 CTCGGGGGAGGAGGACCAGACGG - Intronic
1120705861 14:87744808-87744830 TAATGGGGAGGAAGTGGAGAGGG - Intergenic
1121145602 14:91579477-91579499 CTCTCGGCAGGAAGGGGAGTTGG - Intergenic
1121190689 14:92026727-92026749 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
1121251961 14:92506093-92506115 CTTGGGGATGGAAGAGGAGATGG + Intergenic
1121310131 14:92931401-92931423 CCCTGGGGAGGAAGAGGAGGAGG + Exonic
1121407857 14:93729716-93729738 CTGCGGGGAGGAAGAAGAGGAGG + Intronic
1121650301 14:95553224-95553246 GTCTGGGGAGGAAGAGAGCAAGG - Intergenic
1121689468 14:95865871-95865893 CACTGGGGAGAGAGAGGAAAAGG + Intergenic
1121700093 14:95946178-95946200 GCCTGGGAAGGATGAGGAGAGGG + Intergenic
1121979750 14:98444223-98444245 CTCTGGGCAGGAAGTGGGGGTGG + Intergenic
1122346044 14:101061007-101061029 CTCTGGGAAGCAAGGGGTGAAGG + Intergenic
1122451075 14:101808087-101808109 CTCAGAGGAGGAGGAGGAGGAGG + Intronic
1122550824 14:102548848-102548870 CTCTGGGGAGGATTAAGAGTGGG + Intergenic
1122598516 14:102909380-102909402 CTCTGGGGAGGAAGGGGTGGTGG - Exonic
1122783442 14:104153410-104153432 CTGTGGTGAGGCCGAGGAGAGGG + Intronic
1122983197 14:105200704-105200726 CTCTGGGGAGGGGATGGAGAAGG - Intergenic
1123068722 14:105630707-105630729 CTCTGGAGAGAGAGAGGAGCTGG + Intergenic
1123466338 15:20518871-20518893 CTCGGGGAAGGAACAGGAGAGGG + Intergenic
1123651776 15:22482167-22482189 CTCGGGGAAGGAACAGGAGAGGG - Intergenic
1123742195 15:23291026-23291048 CTCGGGGAAGGAACAGGAGAGGG - Intergenic
1123761129 15:23433459-23433481 CTCGGGGAAGGAACAGGAGAGGG + Intergenic
1124218789 15:27831897-27831919 CTATGGGGATAAAGAGGAGAAGG - Intronic
1124270803 15:28278690-28278712 CTCTGGGGAGCAAGACGATCAGG + Intronic
1124277065 15:28334849-28334871 CTCGGGGAAGGAACAGGAGAGGG + Intergenic
1124305635 15:28576757-28576779 CTCGGGGAAGGAACAGGAGAGGG - Intergenic
1124997827 15:34741001-34741023 CTTTTGGGAGGAAGAGTGGAGGG - Intergenic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125513187 15:40303650-40303672 CTCTGGGCAGGAGGACGGGAAGG - Intronic
1125618131 15:41034333-41034355 CCCTGGGGAGTAAGAGAAGAAGG + Intronic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1125913849 15:43466942-43466964 CTTTGGGTAGGAAGAGGAAGAGG + Intronic
1126174915 15:45727364-45727386 AACAGGGGAGGAAGAGTAGAGGG - Intergenic
1126371926 15:47956427-47956449 CTTGAGGGAGGAAGAGCAGAGGG - Intergenic
1126461680 15:48921299-48921321 GGCTGGGGAGGAAGAGGAAATGG + Intronic
1127007667 15:54588637-54588659 AACTTGGGAGGAAGAGGGGAAGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127598810 15:60514421-60514443 CTCTGAGGATGAGGAGGAGGAGG + Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1128185463 15:65640400-65640422 CTCTGGGGAAGAGAAGCAGAAGG - Intronic
1128339146 15:66808361-66808383 CTCAGAGGAGGAAGAGGAGGAGG + Intergenic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128700947 15:69803859-69803881 CTTTGGGGAGGAAGTGCAGGAGG + Intergenic
1128735960 15:70054202-70054224 CTCTGGGAAGAAAGTGGAGCTGG - Intronic
1128977715 15:72165626-72165648 CTATGGTGAGGAAGAGGGGAGGG - Intronic
1129008391 15:72394338-72394360 CTCTGGGGAGGAAGATGGCTAGG - Intergenic
1129183015 15:73888737-73888759 CTCTGATGAGGAGGAGGAGGAGG - Intronic
1129265567 15:74391552-74391574 CTTTGGGGAGCAGGATGAGAGGG - Intergenic
1129312011 15:74719438-74719460 CTGTAGGGAGGAAGAAGAGGAGG - Intergenic
1129331505 15:74830213-74830235 CACAGAGGAGGAGGAGGAGAAGG + Exonic
1129536369 15:76316418-76316440 CTCTGTGCAGGAAGAGTGGATGG + Intergenic
1129631713 15:77267328-77267350 GTATAGGGAGGATGAGGAGAAGG - Intronic
1129706230 15:77796054-77796076 CTGTGGGGAGAAAGAAGAGGTGG + Intronic
1129848448 15:78778678-78778700 CTCTAGCCAGGCAGAGGAGATGG + Intronic
1129898272 15:79124636-79124658 GGCTGGGGAGCAAGAGGAAAAGG - Intergenic
1130070593 15:80643883-80643905 CTTAGAGGAGGAAGAGGAGATGG - Intergenic
1130257690 15:82333410-82333432 CCCTGGGGAGGAAGAGCAGGAGG - Intergenic
1130303729 15:82699348-82699370 CTGTGGGGAGAAAGAGGTCAAGG + Intronic
1130307840 15:82726724-82726746 CTCCAGGAAGGAAGAGGACACGG + Intergenic
1130357671 15:83148928-83148950 CTCTGGGTAGGAAGAGGGACTGG + Intronic
1130597248 15:85256553-85256575 CCCTGGGGAGGAAGAGCGGGAGG + Intergenic
1130682057 15:86005618-86005640 CCCAGGGGAGGAGGAGGAGGAGG + Intergenic
1130912800 15:88282615-88282637 CACTGGGGAGGGGGAGGGGAGGG - Intergenic
1130985717 15:88843289-88843311 CTCTGGGGATGCAGAGCAGGGGG + Intronic
1131094265 15:89645927-89645949 TTCAGAGGAGGAAGAGGAGGAGG - Exonic
1131318215 15:91360472-91360494 ATTGGAGGAGGAAGAGGAGAAGG - Intergenic
1131454570 15:92573046-92573068 GACTTGGGAGGCAGAGGAGATGG - Intergenic
1131700462 15:94929928-94929950 ATTGGGGGAGGAAGAGGAGAAGG + Intergenic
1131990479 15:98088601-98088623 CCCTGGGGAGGAATGGGAGAGGG - Intergenic
1132028064 15:98419631-98419653 GAAGGGGGAGGAAGAGGAGAGGG + Intergenic
1132060287 15:98687050-98687072 GTTTTGGGAGGAGGAGGAGAAGG + Intronic
1132099665 15:99014696-99014718 CCCTGGGGAGGAATGGGAGAGGG + Intergenic
1132310814 15:100856439-100856461 CTCTGGGTTGGAAGAGGGGGTGG + Intergenic
1132397560 15:101485746-101485768 CTCTGGGAAAGAAGAGGAGGAGG - Intronic
1132482113 16:171961-171983 CTCTGGGTAGGGAAAGGACAGGG - Intergenic
1132582207 16:690084-690106 CTCTAGGGAGGAACAAAAGAGGG + Exonic
1132643567 16:988727-988749 CTCTGTGGAGGATGAGGACGTGG - Intergenic
1132744955 16:1432689-1432711 TTCGGAGGAGGAAGAGGAGGAGG + Intergenic
1132871555 16:2117754-2117776 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1133272897 16:4619330-4619352 CTAGTGGGAGGGAGAGGAGAAGG + Intronic
1133555274 16:6900769-6900791 TGCTGTGAAGGAAGAGGAGAGGG - Intronic
1133978455 16:10617016-10617038 CTCTGGGGAGGGGGAGCCGATGG + Intergenic
1134264786 16:12683709-12683731 CACTGAGGATGGAGAGGAGATGG - Intronic
1134390477 16:13815443-13815465 TTTTTGGGAGGAAGAGGACAGGG + Intergenic
1134520974 16:14919141-14919163 CCCTGGGGAGGAAGGGGAGTGGG - Intronic
1134550598 16:15136832-15136854 CCCTGGGGAGGAAGGGGAGTGGG + Intronic
1134588700 16:15434710-15434732 CTATGGGGCGGTGGAGGAGACGG + Exonic
1134608120 16:15587025-15587047 CTCTGGGGAGGACCATGCGACGG - Exonic
1134708650 16:16317792-16317814 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134715863 16:16357825-16357847 CCCTGGGGAGGAAGGGGAGTGGG - Intergenic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1134835335 16:17356365-17356387 CTCTGAGGAGGAAAAGGATTCGG - Intronic
1134950954 16:18350853-18350875 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1134958893 16:18394334-18394356 CCCTGGGGAGGAAGGGGAGTGGG + Intergenic
1135629038 16:24021603-24021625 CTCTGGGGAGGCTGAGGAGCAGG + Intronic
1135752885 16:25070922-25070944 CTCAGGGCAGGGAGAAGAGAGGG - Intergenic
1135833741 16:25803956-25803978 CTCTGGAGGTGAGGAGGAGAGGG - Intronic
1135891781 16:26363829-26363851 CACTTGGGAGGAAGAGAGGAAGG - Intergenic
1136081289 16:27854171-27854193 CGCAGGGGAGGAAGAGGAGGAGG + Intronic
1136233384 16:28900739-28900761 CTTTGGGGAGAACGAGGAGGTGG + Exonic
1136366358 16:29810985-29811007 AGCTGGGGTGGAAGAGGGGAGGG - Exonic
1136456309 16:30381742-30381764 GACTGGTGAGGAAGAGGAAAGGG - Exonic
1136498882 16:30659830-30659852 CCGCGGGGAGGAAGAGGAGGAGG + Exonic
1136845489 16:33573020-33573042 CTCTCCGCAGGAAGAGGAGCAGG - Intergenic
1137372680 16:47923063-47923085 CTCTGGAAAGGAAGAGGGGCTGG + Intergenic
1137800739 16:51259833-51259855 CAATGGTGAGGTAGAGGAGATGG + Intergenic
1137935167 16:52628166-52628188 CTCTGGGGACTCAGAGGGGAAGG + Intergenic
1137949851 16:52773357-52773379 CTATGGGGAGAAATAGGAGGGGG + Intergenic
1138139147 16:54552167-54552189 CTCTGGGGAGGGAAACAAGATGG - Intergenic
1138311492 16:56027322-56027344 CTGGTGGCAGGAAGAGGAGACGG - Intergenic
1138352019 16:56351121-56351143 CTCTGGGGAGGCTGAGGACAGGG - Intronic
1138449605 16:57085613-57085635 CTTTGGGGAGGAAGGGGGCAGGG - Intergenic
1139251710 16:65502778-65502800 CCCTGGGGAGGGACAGGAGATGG - Intergenic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139686133 16:68605147-68605169 GTCTGGGGTGGAGGAGGAGAGGG - Intergenic
1140972159 16:80023858-80023880 TTCCAGGGAGGGAGAGGAGAAGG - Intergenic
1140991222 16:80213492-80213514 CTCTGGGGTGGAAAAGATGAAGG + Intergenic
1141079339 16:81036397-81036419 CTCTGGGGGGGAGGAGGAGCTGG + Intronic
1141148277 16:81547156-81547178 ATCTGGGGCAGAGGAGGAGAGGG + Intronic
1141292153 16:82728334-82728356 CGCTGGGGAGGAAAAGTGGATGG - Intronic
1141355408 16:83340852-83340874 CACTGTGGAGGCAGATGAGAGGG - Intronic
1141509666 16:84504439-84504461 GTCGGGGGAGGGAGAGGTGAAGG - Intronic
1141526375 16:84614489-84614511 CGTGGGGGAGGAAGGGGAGAAGG + Intronic
1141660428 16:85438354-85438376 CTCTGGGGAGGGACAGGAGGCGG + Intergenic
1141669710 16:85485399-85485421 CACAGGGGAGGAAGAGGAGGAGG - Intergenic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1141757157 16:85998800-85998822 CTTAGGGGAGAAAGAGGAGGAGG - Intergenic
1142347523 16:89563468-89563490 CTCCTGGGAGGCAGAGGTGAGGG + Exonic
1203107197 16_KI270728v1_random:1421673-1421695 CTCTCCGCAGGAAGAGGAGCAGG - Intergenic
1142566346 17:842579-842601 CTCCTGGAAGGAGGAGGAGACGG - Intronic
1142701004 17:1660826-1660848 CCCTGGGGAGCAAGAGAAGCAGG + Exonic
1142711995 17:1728412-1728434 CTCCGAGGAGGAAGAGGAGGAGG + Exonic
1142824568 17:2500617-2500639 CTATGGGAAGGAAGAGGAGCAGG - Intronic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1142986137 17:3696273-3696295 GTCAGGGGAGGAGGAGGAGGAGG - Exonic
1142993220 17:3745866-3745888 ATGTGGGGAAGCAGAGGAGACGG - Exonic
1143181365 17:4986383-4986405 ATCTGGGAAGGATGAGGAAAGGG + Intronic
1143225652 17:5300377-5300399 GTCTTGGGAGGAAGAGCACATGG + Intronic
1143290737 17:5826011-5826033 CTCTGGTGGGGTTGAGGAGAGGG + Intronic
1143406873 17:6683632-6683654 CTCAGGGGAGGCAAAAGAGAGGG - Intergenic
1143548476 17:7614496-7614518 CTCTGGGGGGGATGTGGAGCCGG - Exonic
1143590609 17:7884515-7884537 CTCTTGGGAGGAAAGAGAGAAGG + Intronic
1143590914 17:7885408-7885430 TTCGGGGGAGGAGGAGGAGGAGG + Intronic
1143624925 17:8104220-8104242 GTGTGGGGAGGAAGGGTAGAGGG + Intronic
1143626041 17:8110591-8110613 CTCTGGGGTGGAAGTGGGCAGGG - Intronic
1143915156 17:10286244-10286266 TTCAGGGGAGGAAGAAGACAGGG + Intergenic
1144021884 17:11245191-11245213 CTCCGTGGAGGAGGAAGAGATGG + Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144674419 17:17152827-17152849 CACCTGGGAGGAAGAGGTGAGGG + Intronic
1144738615 17:17568836-17568858 CTGGGAGGAGGAAGAGGAGGAGG - Intronic
1145282353 17:21477261-21477283 CTCTGCTGAGGAACAGCAGAAGG - Intergenic
1145910431 17:28539053-28539075 CACTGGGGAGGCTGAGGAGCAGG + Intronic
1146403369 17:32517899-32517921 CTCAGAGGAGGATGTGGAGATGG + Intronic
1146449031 17:32957259-32957281 CTCTGAGGAGGGAGAGGAACAGG - Intergenic
1146755448 17:35428311-35428333 CTTTTGGGGGGAAGAGGATATGG + Intronic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147607851 17:41784598-41784620 CTCTGGGGAGCAACAGGAGCAGG - Intronic
1147634502 17:41955196-41955218 CACTGGAGAGCAAGGGGAGAAGG - Exonic
1147856137 17:43481589-43481611 TTATGGGGAGGAAGAGTAGGAGG + Intergenic
1147978485 17:44261042-44261064 CACTGGGGAGGGAAAGGAGTGGG + Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148132989 17:45273619-45273641 CCCCGGGGAGGAAGAGGAACAGG + Intronic
1148150426 17:45393762-45393784 CTGTGGGAGGGAAGATGAGAGGG + Intergenic
1148446906 17:47743388-47743410 ACCTTGGGAGGAAGATGAGATGG + Intronic
1148638719 17:49169027-49169049 GTCTGGGGAGAAAGGGGAAAGGG - Intronic
1148848865 17:50544663-50544685 GGCTGAGGAGGAAGAGGAAAGGG - Intronic
1148871060 17:50659007-50659029 ACCTGGGGAGGAGGAGGAGAAGG + Intronic
1148878762 17:50708789-50708811 CCCTGGGGAGGAAGGGAGGAAGG + Intergenic
1148953952 17:51337936-51337958 CTTGAGGGAGGGAGAGGAGAAGG + Intergenic
1149192312 17:54077688-54077710 CTCTAAGGATGTAGAGGAGACGG - Intergenic
1149414320 17:56443111-56443133 CTCAGTGGAGTAAAAGGAGAGGG + Intronic
1149447396 17:56724279-56724301 CACTGGGAAGGAGGAGGAGGTGG - Intergenic
1149568753 17:57657401-57657423 GGCTGGGGAGTAAGAGAAGAGGG + Intronic
1149604775 17:57916879-57916901 CTCTGAGCAGGAGGAGGAGGGGG + Intronic
1149649721 17:58269205-58269227 ATTTGAGAAGGAAGAGGAGAGGG + Intergenic
1149866932 17:60156359-60156381 TTCTGTGGAGGAGGAGGAGGAGG + Intronic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150225397 17:63522073-63522095 TCCTGGAGAGGAAGGGGAGAAGG - Intergenic
1150247764 17:63689135-63689157 CTGTGGGGCAGAAGAGGACATGG - Intronic
1150295038 17:64002924-64002946 CTCTGGGGAGGGAGGGGGCAAGG + Exonic
1150299074 17:64033619-64033641 CTATGAAGAGTAAGAGGAGATGG + Intergenic
1150478569 17:65492122-65492144 ATTTGGAGAGGAAGAGGAGAGGG + Intergenic
1150597629 17:66620370-66620392 CTCTGGGTAGGCAGAAGAAAAGG + Intronic
1150747373 17:67826147-67826169 CTCCGAGGAGGAGGAGGAGGAGG + Exonic
1150809296 17:68344174-68344196 CTCAAGGAAGGAAGAAGAGAAGG + Intronic
1150815937 17:68391943-68391965 CCCTGGAGAGGAGAAGGAGATGG + Intronic
1151107081 17:71627806-71627828 CTCTAGAGAGAAAGAGGAGAAGG + Intergenic
1151290340 17:73145296-73145318 CTCTGGGGAGCAGTAGAAGAGGG - Intergenic
1151404105 17:73875807-73875829 CACTGGGGAGCCACAGGAGAGGG - Intergenic
1151587648 17:75020292-75020314 CACTGTGGAGGAAAGGGAGAAGG - Exonic
1151669312 17:75563310-75563332 TGCTATGGAGGAAGAGGAGAGGG - Exonic
1152033228 17:77856531-77856553 CTCTGGGGAGGAGGGGCAGCTGG - Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152519514 17:80846986-80847008 CTCTTGGGAAGGACAGGAGATGG + Intronic
1152525809 17:80887653-80887675 CTCTGGGGTGGGAGAGAGGAGGG + Intronic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1153038356 18:786316-786338 CTCTAGGGAGGAAGAAAAAAGGG - Intronic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153292123 18:3511811-3511833 CTCTGGGGATGAAAAGGAATGGG - Intronic
1153416683 18:4853517-4853539 GTCTGAGGAGGAAGAGAACAAGG + Intergenic
1153524010 18:5977978-5978000 CTCTGGGGATGAATGGGAAATGG - Intronic
1153567867 18:6438048-6438070 CTCAGAGGAGGACGAAGAGAGGG + Intergenic
1153707540 18:7761747-7761769 CACTAGGGAGGAAAAGGGGAAGG - Intronic
1153899569 18:9604746-9604768 TGTTGGGGAGGGAGAGGAGAAGG - Intronic
1154126778 18:11698729-11698751 TCCTGGGGATGAAGAGAAGAGGG + Intronic
1154157552 18:11955839-11955861 GCCTGGGGAGGGAGAGGGGAAGG + Intergenic
1154193882 18:12252236-12252258 GTCTGTGGTGGAAGCGGAGATGG - Intergenic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1154445312 18:14431131-14431153 CTCTGGGGGTGAGGAGGAGCTGG - Intergenic
1155534405 18:26802028-26802050 GTGTGGGGAGGAGGTGGAGATGG + Intergenic
1156193574 18:34747500-34747522 CTTTGGGGACTCAGAGGAGAAGG - Intronic
1156295367 18:35784527-35784549 CTCTTGGCAGGAAGGGGAAAGGG + Intergenic
1156370002 18:36464750-36464772 GTCCTGGGAGGAGGAGGAGAGGG + Intronic
1156398595 18:36720795-36720817 ATGAGGGGAGGAAGAGGAGGAGG - Intronic
1156543192 18:37937480-37937502 CTCCGGGGAGATAGAGCAGAGGG - Intergenic
1156558953 18:38099642-38099664 ATGTGGAGAGGAAGAGGAAAAGG + Intergenic
1156887734 18:42155224-42155246 CCCTGGAGAGGGAGTGGAGAGGG - Intergenic
1157286173 18:46378899-46378921 CACTGGGGAGGAAGAGTGGAAGG - Intronic
1157374642 18:47151376-47151398 CAGTGGGGAGGAAAAGCAGATGG - Intronic
1157390192 18:47295375-47295397 CTCTGGGGAGGAAGAAAGGAAGG - Intergenic
1157391445 18:47306892-47306914 CTCTGGGGAGTCGGAGGGGAAGG + Intergenic
1157478525 18:48038164-48038186 CTCTGGGGAGTAACAGGAGCAGG + Intronic
1157568388 18:48696091-48696113 AGCTGGGGAAGAAGTGGAGAGGG - Intronic
1157869988 18:51221167-51221189 CTTTGGGGAGTCAGAGGAAAAGG + Intergenic
1157993606 18:52527860-52527882 CTCTGGGGAGGGAGAGCAACTGG + Intronic
1158224307 18:55184630-55184652 CTTGGGGGAAGAAGAGGAGCTGG + Intergenic
1158269895 18:55701417-55701439 CACTGGGGAGGAGGTGGGGATGG - Intergenic
1158452199 18:57576858-57576880 CTGTCTGGAGGGAGAGGAGATGG - Intronic
1158524075 18:58196916-58196938 TTATGAGGGGGAAGAGGAGATGG + Intronic
1159825387 18:73202341-73202363 CTCTGGGGAGCAAGGGGAGTAGG - Intronic
1159833186 18:73303481-73303503 ATGTGGGGAGGAAGAAGAGGAGG - Intergenic
1159904698 18:74078644-74078666 CTGTGAGGAGAAAGAGGAAAGGG - Intronic
1160015537 18:75137595-75137617 CTCTGAGGGTGAAGAGGTGAAGG - Intergenic
1160412653 18:78685583-78685605 CACTGGGGAGGAAGCAGAGCTGG - Intergenic
1160417168 18:78719549-78719571 TTCTGTGGAAGAGGAGGAGAAGG - Intergenic
1160786134 19:900907-900929 CTCCGGGGAGGAGCAGGAGCGGG - Exonic
1160997247 19:1888484-1888506 CTCTGGGGAGGAGGAAGGGATGG - Intergenic
1161103204 19:2431586-2431608 GAATGGGGAGGAAGAGGAGGAGG - Exonic
1161378283 19:3951063-3951085 CTGTGGGGAGGAGGAGGAAGAGG - Intergenic
1161951231 19:7469231-7469253 CTCTGGAGAGGAAAACCAGAAGG + Intronic
1161965158 19:7543645-7543667 CTCAGGGTAGGAGGAGGAGGAGG + Intronic
1162053057 19:8046711-8046733 GGATGGGGAGGAGGAGGAGAAGG - Intronic
1162125596 19:8498196-8498218 GTGTGGGGAGGAAGCGGAGGTGG - Intronic
1162241983 19:9362672-9362694 CTTTGGTCAGGAAGAGGGGAGGG + Intronic
1162322266 19:9977364-9977386 TTCTGGCGAGGAAGGGGACAAGG - Exonic
1162335220 19:10055968-10055990 ATGTGGGGATGAAGAAGAGATGG - Intergenic
1162469304 19:10862873-10862895 GCCTGGGGAGGAGGAGGAGCTGG + Intronic
1162549833 19:11352154-11352176 CCCTGGGGAGGAGTGGGAGAGGG + Intronic
1162719893 19:12656145-12656167 CTCGGGGGAGGAAGAGGTTTGGG + Intronic
1163262537 19:16199798-16199820 CTCTGGGGAGGCAGTGGCCAGGG - Intronic
1163484515 19:17577936-17577958 CTCTGGAGAGGAGGAGGAGAGGG - Exonic
1163494772 19:17639907-17639929 TTCTGAGGAGGAAGGGGAGGAGG + Exonic
1163586881 19:18169066-18169088 CTCTGTGGGGGCAGACGAGAGGG - Exonic
1164250130 19:23468697-23468719 AAATGAGGAGGAAGAGGAGAAGG - Intergenic
1164397654 19:27879995-27880017 CTCTGGCTAGGAAGAGAAGTGGG - Intergenic
1164588363 19:29491796-29491818 CGCAGGGGAGGAGGTGGAGATGG + Intergenic
1164807166 19:31125930-31125952 CTCCGTGGGAGAAGAGGAGAAGG - Intergenic
1164941031 19:32252470-32252492 CTCTGGGGAGGCTGCGGAGCTGG - Intergenic
1165354490 19:35295365-35295387 CGCTGGAAAGGGAGAGGAGAGGG - Exonic
1165454914 19:35904780-35904802 CACTGATGAGGCAGAGGAGAAGG - Intronic
1165591344 19:36972702-36972724 CTCTGGGGTGGATCAGGAGAGGG - Intronic
1165694054 19:37886800-37886822 TTCTGAGGAGGAGGAGGAAAGGG - Exonic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165790574 19:38489242-38489264 CACTGAGGAAGAAGAGGAGGAGG + Exonic
1165829434 19:38723237-38723259 CTCTGGGGAGGAACAGGACATGG - Intronic
1166201981 19:41243595-41243617 CTCTGGGGGGGAGGGGGAGTAGG - Exonic
1166213189 19:41320320-41320342 GTCTGCAGAGGGAGAGGAGAGGG - Exonic
1166288503 19:41847213-41847235 CACAGAAGAGGAAGAGGAGAGGG + Intronic
1166301571 19:41914407-41914429 CTGAGGGGTGGAGGAGGAGATGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166409365 19:42546622-42546644 CTCTTGGAAGGACGAGCAGAGGG - Intronic
1166841783 19:45701892-45701914 CTCTGCGGAGGAAGGGGATGTGG - Exonic
1167056073 19:47112369-47112391 CCGGGGGGAGGAAGAGGAGGAGG - Intronic
1167106847 19:47435417-47435439 CTCTGGGGACTTAGTGGAGACGG - Intronic
1167114435 19:47480457-47480479 CCCTGGGGAGGCAGAGGGGCGGG - Intronic
1167189054 19:47970682-47970704 CTCATGGTAGGAAGAGGAGAAGG - Intronic
1167384049 19:49153773-49153795 TTCTGAGGAGGAAAAGGAGAAGG - Exonic
1167465942 19:49651187-49651209 ACCTGAGGAGGAAGAGGAGGAGG + Exonic
1167511455 19:49897331-49897353 CTCTGGGTGGCAAGTGGAGAGGG - Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167650024 19:50724000-50724022 CCAGGGGGAGGAAGAGGAGGAGG + Exonic
1167686489 19:50959984-50960006 CGAGGAGGAGGAAGAGGAGAAGG + Intronic
1168198204 19:54791297-54791319 CCTTAGGGAGCAAGAGGAGAGGG + Intronic
1168302036 19:55410618-55410640 CTCTGAGGTGGGAGAGGTGAGGG + Intergenic
925014601 2:512975-512997 ACCTGGAGAGGAACAGGAGAAGG - Intergenic
925098169 2:1224065-1224087 CCCTGTGGAGGAAGGGGTGAGGG + Intronic
925464685 2:4096313-4096335 CTCTGGGGAAGGCGAGGATATGG + Intergenic
925881698 2:8358083-8358105 CTCTAGGAGGGAAGAGGAGTAGG + Intergenic
925918325 2:8623056-8623078 CTCCCAGGAGGAGGAGGAGAAGG - Intergenic
926127172 2:10278741-10278763 GGCCGAGGAGGAAGAGGAGAAGG + Intergenic
926323057 2:11762403-11762425 CTCCAGGGAGGGAGAGGGGAGGG - Intronic
926577849 2:14601810-14601832 GTAAGGGAAGGAAGAGGAGATGG + Intergenic
926795410 2:16615293-16615315 CTTGGGGGAGGCAGAAGAGAAGG - Intronic
927130124 2:20051700-20051722 CTGTGTGGAGGAAGAGGGGTGGG - Exonic
927234544 2:20858532-20858554 CTATGGAGAAGAAGAGGAGGAGG + Intergenic
927292842 2:21421609-21421631 CTTGGGGAAGGATGAGGAGATGG - Intergenic
927518261 2:23684671-23684693 TACTGGGGAGGAGGAGGAGGAGG - Intronic
927521835 2:23703648-23703670 TTCTGGGAAAGAAAAGGAGAGGG + Intronic
927656286 2:24949343-24949365 CTCTGGGGAGGCAGAGTGGCTGG - Intronic
927742744 2:25587066-25587088 CTAAGGGTAGGAACAGGAGAGGG + Intronic
927791316 2:26011929-26011951 CCCTGGAGAGGAGGAGGAAATGG + Intergenic
927856340 2:26530098-26530120 TACTGGGGATGAAGAGGGGAGGG + Intronic
927971009 2:27306460-27306482 TTCCGGGGAGGAAGAGGAGGTGG + Exonic
928270350 2:29849765-29849787 CTCTGAGGAAGAAGAGGAGTGGG + Intronic
928398385 2:30960644-30960666 CTCTGGGTGGTCAGAGGAGAAGG + Intronic
928624701 2:33127811-33127833 ATGTGGGGAAGAAGAGGAAAAGG + Intronic
928724213 2:34152127-34152149 CTCAGGGGTGGAAGAGGTAAAGG - Intergenic
928741636 2:34361242-34361264 TTCAGGGTAGGAGGAGGAGACGG + Intergenic
928904553 2:36356036-36356058 CTCCCGGGAGGAGGAGGAGGAGG + Exonic
929037524 2:37708731-37708753 ATCTGGGGAGGAAGATCAGGAGG + Intronic
929133625 2:38602600-38602622 CCTGGGGGAGGAAGAGGAGGAGG + Exonic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929530414 2:42747479-42747501 CCTTGGGGAGAAAGAGGAGCAGG + Intronic
929666315 2:43836739-43836761 CCCTGGGAAAGAGGAGGAGAAGG + Intronic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930884951 2:56314810-56314832 CTCTCAAGAGGAAAAGGAGAAGG - Intronic
931653032 2:64485697-64485719 CTCGGGGGAGACAGAGGAGGTGG - Intergenic
931806023 2:65805172-65805194 CTGCGGGGAGGAAGTGGGGATGG + Intergenic
932184666 2:69683599-69683621 GTCTTGGTAGGAAGAGGAAAAGG - Intronic
932369892 2:71178251-71178273 ATCTGGACAGGCAGAGGAGAGGG - Intergenic
932424479 2:71620429-71620451 CTCCCTGGAGGAAGAGCAGAGGG + Intronic
932475630 2:72004025-72004047 CTCTGAGGAGGAGGAAGAGCAGG + Intergenic
932657604 2:73624082-73624104 ATTTGGGGAGGAGGAGGAGGAGG - Intergenic
932664278 2:73684366-73684388 GTTTGGGGAGGAGGAGGAGGAGG - Intergenic
933295186 2:80482175-80482197 CTTTTGGGAGGAGGAGGAGGAGG - Intronic
933721602 2:85400801-85400823 CTCTGGGGAGGCAGCCAAGATGG - Intronic
933763068 2:85687406-85687428 AGCTGGGGAGAAAGCGGAGAGGG + Intronic
934035840 2:88087961-88087983 CTTTGGGGAGGAGGAGCAGAAGG + Exonic
934067071 2:88350473-88350495 GTCTGGGGAGGAGGAGGGGTGGG + Intergenic
934525024 2:95046417-95046439 CGCTGGGGGAGATGAGGAGAAGG + Intronic
934655566 2:96115372-96115394 CACTGGGGAGAAGGAGGAGGGGG - Exonic
934736739 2:96693485-96693507 CCCTGGAGGGGTAGAGGAGAAGG - Intergenic
934765550 2:96878247-96878269 CTGTGGGGAGGAAGAGGCCCTGG + Intronic
935262777 2:101369395-101369417 CTCTGGGGAGGAGAAGAAGCGGG + Intronic
935703977 2:105840055-105840077 GGTTGGGGAGGAAGTGGAGATGG + Intronic
935714014 2:105924276-105924298 GTCTGGGAATAAAGAGGAGATGG + Intergenic
935728410 2:106044142-106044164 AGCTGGGGAGGCAGAGGACAAGG + Intergenic
935735841 2:106106032-106106054 CTCTGAGAAGGAAAAGGGGAAGG + Intronic
936501652 2:113071701-113071723 CCCTGGGGAGGCAGGTGAGAAGG - Intronic
936714002 2:115162908-115162930 CCCTGGCGAGGAGGAGGAGGAGG + Intronic
936802647 2:116286431-116286453 AGATGGGGAGGTAGAGGAGAGGG - Intergenic
937158373 2:119737794-119737816 TTCTGGGGAGAAAGAGGTGCTGG + Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937261903 2:120591888-120591910 CACTGGGGAGGAAGAGGGAATGG - Intergenic
937374521 2:121326608-121326630 CTCTTGGGAGGCTGAGGTGAGGG - Intergenic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
937812090 2:126210657-126210679 CTGGGAGGAAGAAGAGGAGAGGG + Intergenic
937901100 2:127019778-127019800 CTCTGGGAGGGAAGAGAAGGAGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
938954046 2:136282367-136282389 CACTGGGGACAAACAGGAGAAGG - Intergenic
939242527 2:139579530-139579552 TTCTGGGGAGGGAGAGCATAAGG + Intergenic
939378960 2:141409489-141409511 CTCTGTGGAAGGAGAGGAGAAGG - Intronic
939566430 2:143791095-143791117 CTCTTGAGAGGAAGAAAAGAAGG + Intergenic
939611842 2:144320533-144320555 CTTTGGGCAGGAAGAGGACAAGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
940022319 2:149168256-149168278 TCCTGGTGAGGAAGAGGAGCTGG + Intronic
940056813 2:149521954-149521976 GTCTGGGGAGGAAGAGTATCAGG - Intergenic
940519569 2:154726998-154727020 CTTTGGGGACTAAGAGGAAAGGG + Intronic
940555451 2:155221155-155221177 GGGTGGGGAGGAAGTGGAGATGG + Intergenic
941360087 2:164540672-164540694 CTCTGGGGAGGGAAAGCAGGAGG - Intronic
941448100 2:165626692-165626714 CACTGGGTACCAAGAGGAGAGGG - Intronic
941993042 2:171575722-171575744 CTCTGGGGAGGGAAGAGAGAAGG + Intergenic
942246536 2:174013337-174013359 CTCTGGGGAAGGGGAGGAGAGGG - Intergenic
942279825 2:174349034-174349056 CTCAGTAGAGGAAGAGGAGGAGG + Exonic
943581260 2:189685869-189685891 TTTTAGTGAGGAAGAGGAGAAGG + Intronic
944320844 2:198339913-198339935 GGCTGGGGAGGAGCAGGAGAGGG + Intronic
944599601 2:201289956-201289978 CTCTGGTGAGGCTGAAGAGAAGG - Intronic
944819384 2:203414453-203414475 TAATGGGGAGGAAGAGGGGAGGG - Intronic
944916907 2:204370247-204370269 CTGTGGGGAGGAGGGGGAGGTGG - Intergenic
945410393 2:209499771-209499793 GGGTGGGGAGGAAAAGGAGAGGG + Intronic
945532211 2:210969816-210969838 CTCTGGGGAAGAAAGAGAGAAGG - Intergenic
945679582 2:212897887-212897909 CTCTGGGGAAGGATAGGAGGAGG + Intergenic
945689809 2:213019700-213019722 CACTGGGTAGGTAGAGCAGAGGG - Intronic
946096046 2:217274789-217274811 GCCTGGGGAGGAAAAAGAGAGGG + Intergenic
946126403 2:217566833-217566855 ATCTGTGGAAGACGAGGAGATGG + Intronic
946231047 2:218291587-218291609 CACAGAGGAGGGAGAGGAGATGG + Intronic
946347816 2:219125424-219125446 CGCAGGGGTGGAGGAGGAGAAGG - Intronic
946409606 2:219509532-219509554 CTCAGGGAAGGAAGGGGAGCAGG - Intergenic
946537803 2:220650359-220650381 CTCTGATGAGAAAGGGGAGAGGG - Intergenic
946596960 2:221316471-221316493 GGCTGGGGAGGGAGAAGAGATGG - Intergenic
946772156 2:223099837-223099859 CTAGGTGGAGGATGAGGAGAAGG + Intronic
947040249 2:225910413-225910435 CTCTGGGGAGAAGCAGGGGAGGG - Intergenic
947057968 2:226128855-226128877 CTCTGAGGAGGAAGAGGCATTGG - Intergenic
947119375 2:226799662-226799684 CTCCGAGGAGGAGGAGGAGGAGG - Exonic
947407826 2:229799242-229799264 CTATGGGGAGGTAAAGGGGAGGG - Intronic
947641968 2:231711946-231711968 AGGTGGGGAGGAAGAGGAGGAGG + Exonic
947702091 2:232242984-232243006 CCCTGGGGAAGCAGAGGAGGTGG + Intronic
947885442 2:233566148-233566170 CACTGGGGAGGGAGGGGGGAAGG + Intronic
948161362 2:235827594-235827616 CCCTTGGAAGGAAGGGGAGAGGG + Intronic
948179182 2:235966286-235966308 CTCTGGGGATGGAGAAGAGGGGG + Intronic
948207691 2:236171271-236171293 ATCTAGGGGGGAAGAGGGGAGGG - Intergenic
948458013 2:238116269-238116291 GAATGGGGAGGAAGAGGGGAGGG - Intronic
948680904 2:239634079-239634101 CACTGGGGAGGCAAGGGAGATGG + Intergenic
948680925 2:239634139-239634161 CACTGGGGAGGCAAGGGAGATGG + Intergenic
949003072 2:241628436-241628458 TTTTGGGGAGGAGCAGGAGATGG - Intronic
1168898681 20:1341744-1341766 AGCTGGGGAGCAAGAGGAGAAGG - Intronic
1168919251 20:1517192-1517214 CTCTGGTGAGGAGGACGGGAAGG + Intergenic
1168942705 20:1727035-1727057 CTCTGGTTAGTAAGAGGAAAAGG - Intergenic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1169193502 20:3671778-3671800 CCCTGGGGAGGAAGTAGAGGGGG + Exonic
1169214398 20:3785139-3785161 ATTGGGGGAGGAAGAGGAGGTGG - Exonic
1169266920 20:4172517-4172539 CTCTGGGGCGAGGGAGGAGAGGG + Intronic
1169346935 20:4836081-4836103 GTCTGGGGAGGAAGAGGTTAAGG - Intergenic
1169379016 20:5090460-5090482 CAATGGGCAGGAAGAGGACAGGG + Intronic
1170150086 20:13220147-13220169 CGCTGGGGAGGAGGAAGGGAGGG + Intergenic
1170270576 20:14523183-14523205 TTCTGGGGGAGAAGAGTAGAAGG - Intronic
1170764558 20:19279146-19279168 CACTGTGGAAGTAGAGGAGAGGG + Intronic
1170894036 20:20398361-20398383 GTCTGGGGATGCACAGGAGAGGG - Intronic
1170914619 20:20610647-20610669 CTGTGGAAAGGAAGAGGAAAAGG - Intronic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171193315 20:23177739-23177761 CTATAGTAAGGAAGAGGAGAGGG - Intergenic
1171972327 20:31572202-31572224 CTGTGTTGAGGAAGAGGAGGGGG + Intronic
1172033223 20:31995769-31995791 CTGTAGGGAGGAGGAGGGGATGG - Intronic
1172102777 20:32495541-32495563 TTCTGGGGAGGAAGTTGAGTGGG - Intronic
1172231212 20:33337510-33337532 GACGGGGGAGGAAGAGGAGGAGG + Intergenic
1172285692 20:33738841-33738863 TTCTGAGGAGCAGGAGGAGATGG + Intronic
1172437965 20:34943479-34943501 TGCTGTGGAGGAGGAGGAGAAGG - Intronic
1172444518 20:34986053-34986075 CTCTGGGGAGGTGTGGGAGATGG + Intronic
1172591592 20:36121841-36121863 CTTTGGGCAGGAAGTGGGGAAGG + Intronic
1172773489 20:37394688-37394710 CTCAGGGGAGGGACAGGAGAGGG - Intronic
1172841303 20:37904058-37904080 GTGTGGAGAGGAAGAGGACAAGG - Intronic
1173041379 20:39466915-39466937 CTTAGGGTTGGAAGAGGAGAAGG - Intergenic
1173290288 20:41708914-41708936 CTCCTCAGAGGAAGAGGAGACGG + Intergenic
1173643276 20:44618161-44618183 CCCTGGGGAGCAAGACGAGCTGG - Intronic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1173808190 20:45939702-45939724 CTCTGGGGAAGGCAAGGAGATGG + Intronic
1173823044 20:46030885-46030907 CACTGGGGAGGTGGATGAGAGGG - Intronic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1173934837 20:46852194-46852216 CTCTGGGCTGGGAGAGGACATGG + Intergenic
1173985319 20:47256959-47256981 CTCTGTGAAATAAGAGGAGATGG + Intronic
1174069151 20:47887832-47887854 CTCTGGGGAGGAGGCGCAGCTGG + Intergenic
1174519679 20:51119824-51119846 CTCTGAGGGGTGAGAGGAGATGG + Intergenic
1174540541 20:51285874-51285896 CTTTGAGGAGGAAGGGGAGGAGG - Intergenic
1174577499 20:51546979-51547001 CTCAGGGAAGGATGAGAAGATGG + Intronic
1174708816 20:52684224-52684246 CTCTGGGAACGCAGAGGGGATGG - Intergenic
1174985664 20:55448738-55448760 CTCTGGATAAGAAGAAGAGAGGG - Intergenic
1175013836 20:55766969-55766991 CTCTGGGGCAGAGGAGCAGAGGG - Intergenic
1175238517 20:57529056-57529078 CCCTGGGGATAAGGAGGAGATGG - Intergenic
1175402986 20:58711119-58711141 GCGTGGGGAGGAGGAGGAGAGGG - Intronic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175531194 20:59674999-59675021 GAATGGGGAGGAACAGGAGAAGG - Intronic
1175531585 20:59676786-59676808 CTCTGGTGAGGCAGAGGGCAGGG + Intronic
1175644048 20:60656535-60656557 CTGTGGGCAGGCAGATGAGAGGG + Intergenic
1175784955 20:61706528-61706550 CTCCGGGGAGGAAGAACGGATGG + Intronic
1175801403 20:61802973-61802995 AGCTGGGGAGGCAGAGGAGGCGG + Intronic
1175813621 20:61872347-61872369 CTTTGGGGATGAGGAGGAGTTGG + Intronic
1176051302 20:63120936-63120958 CTCTGGTGGGCAAGGGGAGATGG - Intergenic
1176152028 20:63596335-63596357 CTCCGGAGAGGCAGAAGAGAGGG - Intronic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177074106 21:16550326-16550348 CTCAGGGGTGGGAGAGGCGAGGG + Intergenic
1177439595 21:21104215-21104237 CTACGGTGAGGAGGAGGAGAAGG - Intronic
1178173632 21:30072074-30072096 CACTGAGGAGCAAGAAGAGATGG + Intergenic
1178263443 21:31120797-31120819 CTCTTGGGAGGAGGAGGCGGCGG - Exonic
1178405062 21:32316973-32316995 GCCTGGGGAGGCAGAGGAGATGG - Exonic
1178692402 21:34760761-34760783 CTCAGGGGAGGGTGAGGAGCTGG + Intergenic
1178846685 21:36179970-36179992 ATCTGTGCAGGCAGAGGAGAGGG - Intronic
1179034020 21:37744503-37744525 CTCTTGGGAGGAGGAGAAAAGGG + Intronic
1179160551 21:38893509-38893531 ATGTGGGGAGAAAAAGGAGAAGG - Intergenic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180057172 21:45364998-45365020 CTGTGGGCGGGAAGAGCAGATGG + Intergenic
1180616271 22:17130198-17130220 CTCTGTCTAGGAAGAGGAAATGG - Intronic
1180707062 22:17816609-17816631 CTTTGGTGGGGTAGAGGAGAGGG - Intronic
1180869857 22:19139998-19140020 GGCTGGAGAGGAGGAGGAGAAGG - Exonic
1180988369 22:19918796-19918818 CTCTTGGGTGGAAGAGGAAGAGG - Intronic
1181363835 22:22358428-22358450 CTCTGAGGATGAAGGGGAGGAGG - Intergenic
1182114182 22:27745533-27745555 CCCTGGGGAGGACCAGGATAGGG - Intergenic
1182298784 22:29326727-29326749 CTCAGGGGAGGCAGACGACACGG + Intergenic
1182321343 22:29480110-29480132 CGCAGGGGAGGAGGCGGAGAGGG + Intergenic
1182550304 22:31097302-31097324 GGATGAGGAGGAAGAGGAGAAGG - Exonic
1182558954 22:31143915-31143937 ATCTGGGGAGGAAGCCCAGAAGG + Intergenic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1183034331 22:35129671-35129693 AGCTGGGAAGGGAGAGGAGAAGG + Intergenic
1183081418 22:35458995-35459017 ATCTGGAGAGAAAGAAGAGACGG + Intergenic
1183587422 22:38760935-38760957 GTCTGTGGAGGCAGAGGAGGTGG + Intronic
1183654361 22:39176310-39176332 CGGGGGGGAGGAAGAGGAGCGGG + Intergenic
1183745320 22:39688410-39688432 GTCTGGGGAAGAAGTGGAGCTGG + Exonic
1183851576 22:40593608-40593630 GTCTAGGAAGGAGGAGGAGACGG - Intronic
1183949086 22:41342753-41342775 CTCTGGGGCAGAAAAGGAAAGGG + Intronic
1184448864 22:44571039-44571061 CTTTAGGGAGGAGGGGGAGAGGG + Intergenic
1184694413 22:46131582-46131604 CTCTAGGCAGGCAGAGGGGAGGG + Intergenic
1184996978 22:48214470-48214492 GTCAGGGGAGGAAGAGGAATTGG + Intergenic
1185087837 22:48750151-48750173 CTCAGAGGAGGAGGAGGAGGAGG + Exonic
1185109238 22:48891648-48891670 CTCTGAGGAAGAAGAGCAGTGGG + Intergenic
1185139555 22:49092701-49092723 CTGTGGGCGGGAAGAGGGGAAGG - Intergenic
1185367081 22:50441679-50441701 CCCTGGGGAGAGAGTGGAGAGGG + Intronic
949322950 3:2832064-2832086 CTCAGGGTAGCAAGAGAAGAAGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950281545 3:11711965-11711987 CTCTGGGGAGGAGAAAGAGCTGG - Intronic
950357670 3:12425499-12425521 CTCTGGGCAGGATAAGGGGAGGG - Intronic
951183825 3:19688924-19688946 CTATGGGGAGGAACAGGCGATGG - Intergenic
951537305 3:23751584-23751606 CTCAGGGGAGGGAGATGGGAGGG - Intergenic
951697514 3:25461240-25461262 CGAGGGGGAGGAAGTGGAGATGG - Exonic
952094949 3:29939672-29939694 ATCTGTGCAGGAAGAGAAGAAGG - Intronic
952281122 3:31924279-31924301 CTCTGGAGTGGAAAAGGAAAGGG + Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952447080 3:33391758-33391780 CTCTGTGGAGACAGATGAGAAGG - Intronic
952723156 3:36554627-36554649 AGCTGGTGAGGAAGAGGGGATGG + Intergenic
952754720 3:36856316-36856338 AGGTGGGGAGGAAGAGGAGGAGG - Exonic
952883536 3:37999424-37999446 CTCTGGGAAGGTGGAGGTGAGGG + Exonic
952904278 3:38129387-38129409 CCCTGGGGAGGAGGAAGAGGAGG + Exonic
953118986 3:40020990-40021012 ATCTGTGGAGGTAGAGAAGAGGG - Intronic
953256612 3:41296866-41296888 ACCTGGAGAGGAAGGGGAGAGGG + Intronic
953374280 3:42415691-42415713 TTGTGGGGAGGAAGAAGAGAAGG + Intergenic
953405840 3:42659387-42659409 CTCTGAGGAGGAGGAGGGGGAGG + Exonic
953604356 3:44401144-44401166 CTCTGGTGGGGGAGAGGAGAGGG + Intronic
953863279 3:46563446-46563468 CTCTGAGGGGGAAGAGGCGTGGG - Intronic
954103813 3:48398385-48398407 CTCAGAGGAGGACAAGGAGAAGG - Intronic
954330193 3:49885694-49885716 GTGTAGGGAGGAAGAGGAGGAGG + Intergenic
954353598 3:50066298-50066320 CTATGAGGAGGAAGAAGAGGAGG + Exonic
954576780 3:51680713-51680735 ATCTGGGGAGGAAGAGGAGCAGG + Intronic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954622236 3:52002849-52002871 TGCTGGGGAGGGAAAGGAGAGGG - Intergenic
954707233 3:52487499-52487521 CCAGGGGGAGGAAGAGGAGGAGG + Exonic
954800707 3:53185583-53185605 CTCTGGGGAGGGAGCAGAGGTGG - Exonic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955031915 3:55230282-55230304 CTCTGGGGTCAAAGAGGGGAAGG + Intergenic
956618473 3:71197156-71197178 TTGTGGGGAGGAAGAAGATAGGG - Intronic
956834668 3:73086827-73086849 CCATGAGGAGGAAGGGGAGAGGG + Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959027559 3:101257928-101257950 CTCTGGGAAGGAGGAGAGGATGG - Intronic
959181615 3:102987466-102987488 GTGAGGGGAGAAAGAGGAGATGG + Intergenic
960051769 3:113245966-113245988 CTCTTGGGAGGAAGTGGAGCTGG + Intronic
960386458 3:117026871-117026893 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
960862991 3:122170283-122170305 TTCTGGGGAGGAGGAGCAAATGG - Intergenic
960987684 3:123291352-123291374 CACAGAGGAGAAAGAGGAGATGG - Exonic
961345512 3:126260881-126260903 GTAGGGGGAGGAAGAGGGGAAGG - Intergenic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961518140 3:127451227-127451249 CTCTGGCGTGGAAGAGCTGATGG - Intergenic
961808988 3:129510634-129510656 CCCAGGTGAGGAAGAGGACAGGG - Intronic
962201073 3:133401654-133401676 ATCTGGAGAGAAAGAGGAGGAGG - Intronic
962373930 3:134844644-134844666 CTCAGGGGAGGGTGAGGAGGAGG + Intronic
962746101 3:138398316-138398338 CTCTGGAAAGGAAGAGGGAAGGG + Intronic
962867123 3:139456396-139456418 CACTGGGGAGTAAAATGAGAAGG - Intronic
963046954 3:141109669-141109691 AGATGGGGAGGAAGAGGAGGAGG - Intronic
963212315 3:142706780-142706802 ATCTGGGGAAGAAGAAGGGAGGG + Intronic
963642618 3:147878259-147878281 TTATGGTGAGGAAGAGAAGAAGG + Intergenic
963732045 3:148984451-148984473 CTTTGAGGAAGGAGAGGAGAGGG - Intergenic
963939460 3:151085450-151085472 CTCTGGGGAGGTCGAGGCGGAGG + Intergenic
964358651 3:155871581-155871603 CTCTGAGAAGGAAGCGGGGAGGG - Intronic
964466174 3:156995960-156995982 CTCTGGGCAGTTAGAGGACAAGG - Intronic
964472262 3:157068154-157068176 AACTTGGGAGGAAGAGGAGGAGG + Intergenic
965036310 3:163443219-163443241 CTCTGGGGAAGAAGAGTATCGGG + Intergenic
965840745 3:172902696-172902718 CTCTGGAGAGGAACATGAGAGGG - Intronic
966294374 3:178401969-178401991 CTATGGGAAGGAGAAGGAGAAGG - Intergenic
966421521 3:179739140-179739162 CTCAGGGCAGGAGGAGGTGACGG - Intronic
966715589 3:183010431-183010453 CTGTGTGGTAGAAGAGGAGATGG - Intergenic
966876285 3:184323711-184323733 CTGTTGGGAGGGACAGGAGAGGG - Intronic
967701064 3:192592729-192592751 CTCTGGAGATAAAGAGAAGATGG - Intronic
967865249 3:194184754-194184776 TTAGGAGGAGGAAGAGGAGAAGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968441551 4:626916-626938 CTCTGAGGAAGAAGGGGAGGGGG + Intronic
968541479 4:1170575-1170597 ATCTGGGGAGGAAGAAGAGGAGG + Exonic
968699542 4:2048026-2048048 CTGTGGGGATGAGGTGGAGAGGG + Intergenic
968908665 4:3465911-3465933 CACCTGGGAGGAAGAAGAGAGGG - Intronic
969059800 4:4425655-4425677 GTCTGGAGAGGAAGGGGAGGTGG + Intronic
969502724 4:7563161-7563183 GAGTGGGGAGGAAAAGGAGAAGG + Intronic
969587629 4:8103679-8103701 CGCTGGCGAGGAAGAGGTTATGG + Intronic
969797489 4:9537300-9537322 CTCTGAGCAGGAAGAAGACAAGG + Intergenic
969858958 4:10020968-10020990 CCCTGGGGAGGGTGAGAAGAGGG + Intronic
970117451 4:12712837-12712859 CACTGGTGAGGATGAGGAGGAGG + Intergenic
970383450 4:15531637-15531659 AGCTGGGGAGGAAGAGGGAAAGG - Intronic
971234703 4:24830300-24830322 CTCAGGGGAGGAAGAAGGAATGG - Intronic
971342748 4:25785665-25785687 AATTAGGGAGGAAGAGGAGAGGG + Intronic
971646323 4:29209256-29209278 CCAGGAGGAGGAAGAGGAGAAGG - Intergenic
972048846 4:34702748-34702770 GTATGGGGAGGAAGAGGTGGTGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973184327 4:47306568-47306590 CTCTGGGGAGGGAGAGGTAGGGG - Intronic
973730724 4:53819866-53819888 TTCTGCGGAGGAAGAGGAAGGGG + Intronic
974069387 4:57110265-57110287 CGAAGAGGAGGAAGAGGAGAGGG + Exonic
974078290 4:57187803-57187825 GCCTGGGGAGCAAGAGGAGGTGG - Intergenic
974170594 4:58261683-58261705 TTCTGGGGAGGAAGACCACAGGG - Intergenic
974854683 4:67446128-67446150 CTATGGCGAGGAGGAGGAGGAGG + Intergenic
975221306 4:71815479-71815501 TTCTGGGGAGCAAGAGAGGAAGG - Intergenic
976770580 4:88647949-88647971 TGGTGGTGAGGAAGAGGAGAGGG - Intronic
977459505 4:97307759-97307781 CTTTGGGGAAGAAGAGGTAAGGG + Intronic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977561782 4:98540296-98540318 CTCTTGGGAAGAAGATGGGATGG + Intronic
978072468 4:104490924-104490946 CCCTGAGGAGGACGAGGAGGAGG + Exonic
979499102 4:121418648-121418670 GTGTCGGGAGGAAGAGGTGATGG + Intergenic
979793277 4:124813173-124813195 GGCAGGGGAGGAAGAGTAGAGGG - Intergenic
979799722 4:124893922-124893944 TTCTGGGGAGAAGGAGTAGATGG + Intergenic
981619352 4:146676415-146676437 CGATGAGGAGGAGGAGGAGAAGG - Intergenic
982253347 4:153429373-153429395 CTCTGAGGAGGAAAAGGGGGAGG - Intergenic
982314529 4:154018779-154018801 CTCAGGGGAGGGAAAGGGGAGGG + Intergenic
982358247 4:154491826-154491848 CGCTGGGGAGGAGGGAGAGAGGG + Intergenic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
982720523 4:158855048-158855070 CTTTGGGGAGAAAGAGGAGTAGG + Intronic
983370849 4:166856155-166856177 CTGAGGGGAGGAGGAGGAGGAGG + Intronic
984459667 4:180017886-180017908 TTCTGGGGAGGCTGAGGAGCTGG - Intergenic
984610120 4:181828233-181828255 GTCAGGGGCGGCAGAGGAGACGG - Intergenic
984888978 4:184474641-184474663 CACTGGGGAGGAAGGGCGGAGGG - Intergenic
985589018 5:755265-755287 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985603698 5:847781-847803 CTGTGGGGAGGAGGAGAAGCAGG + Intronic
985773930 5:1830759-1830781 CACTGGGGAGGAGGAGGGGGAGG - Intergenic
986007794 5:3682841-3682863 CTCTGGGGACTCAGGGGAGAGGG - Intergenic
986047585 5:4054486-4054508 CGTGGAGGAGGAAGAGGAGAAGG - Intergenic
986183914 5:5418822-5418844 CTCTGAGGAGGGATAGGAAAGGG - Intergenic
986494659 5:8330455-8330477 CAATGGCAAGGAAGAGGAGATGG - Intergenic
986567408 5:9128479-9128501 ATCTTGTGAGCAAGAGGAGAAGG + Intronic
987120024 5:14758522-14758544 CGGTGGGGAGCAAGACGAGAAGG - Exonic
987160189 5:15133608-15133630 CCCCAGGGAGGAAGAGGAGTTGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
988548473 5:32178835-32178857 CTCCGTGGGGGAAGAGGAGATGG + Intergenic
989104465 5:37848177-37848199 GTCTGGGGATGAAGAGTGGAGGG - Intergenic
989368419 5:40680701-40680723 TTGTGGGGAGGAAGAGGAATGGG + Intronic
989412923 5:41140932-41140954 CTTTGGTGAGGAGGAGGAGGAGG - Intergenic
989547578 5:42692380-42692402 CTTTTGGGAGTAAGAGCAGAGGG + Intronic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
989961864 5:50425708-50425730 TTCTGGGGGGGCAGGGGAGATGG + Intronic
990494947 5:56338039-56338061 CAAAGGGGAGGAAGAGGAGAAGG - Intergenic
990690201 5:58355106-58355128 AACTGGAGAGGAAGAGGACAGGG - Intergenic
990742091 5:58922667-58922689 GGCTGGGGAGGAAATGGAGAGGG - Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991258904 5:64645723-64645745 GTTTGGGGAGGAGAAGGAGAGGG - Intergenic
991967185 5:72104802-72104824 TTCTTGGGATGAAGAGGGGAAGG + Intergenic
992134905 5:73734429-73734451 CTTTGGGGAGACAGAGGAGCAGG + Intronic
992349821 5:75916992-75917014 CTCTGGGGAGCATTTGGAGACGG - Intergenic
992370405 5:76137870-76137892 CTCTGATGAAGAAGAGGAAAGGG - Intronic
992466527 5:77011726-77011748 GTCTGGGGTGGCTGAGGAGAAGG - Intergenic
992486539 5:77202385-77202407 AGCTGAGGAGGAAGAGGAGGAGG - Intergenic
992488734 5:77220289-77220311 CCCTTGGGAGGAACAGGTGAGGG + Intronic
992528443 5:77632965-77632987 CTCGGGGGAGGTAGACGGGACGG + Intronic
992869984 5:80996073-80996095 CTATAGGGAGGAGGAGGAGGAGG - Intronic
994703408 5:103166914-103166936 CTCAAGGGTGGAAGAGGTGAAGG + Intronic
994729429 5:103474738-103474760 CTCAAGTGAGGAAGAGGAGAGGG - Intergenic
994870799 5:105348262-105348284 CTTTGGTGAGGAAGAGGAGGGGG - Intergenic
995074473 5:107966142-107966164 GTCTGGAGAGGAGGAGGGGAAGG - Intronic
995123143 5:108556359-108556381 CTCAGGGAAAGAAGAGGGGAAGG + Intergenic
995466303 5:112452715-112452737 CAATGAGGAGGAAGAAGAGAAGG - Intergenic
995552390 5:113294246-113294268 CTGTGGGGAGGTCGAGGGGAGGG + Intronic
995715882 5:115081608-115081630 CTCTGGTTAGGAAAAGAAGATGG + Intergenic
995945592 5:117641215-117641237 CCCTGAGGTGGTAGAGGAGATGG + Intergenic
996055118 5:118973969-118973991 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
996329281 5:122311834-122311856 CCCTGGTGAGGAAGCGGCGAGGG + Intronic
997226554 5:132213686-132213708 CTCTGAGATGCAAGAGGAGAGGG + Intronic
997271956 5:132547354-132547376 TTTTGGGGAGGAAGATGACAGGG - Intronic
997371049 5:133360134-133360156 GATTGGGGACGAAGAGGAGAGGG - Intronic
997835309 5:137187262-137187284 CCCTGGGGAGGAGGAGAAGCAGG - Intronic
997856488 5:137377395-137377417 GACTCAGGAGGAAGAGGAGATGG - Intronic
997881347 5:137593790-137593812 CTCTGGGTAGGAGAAGTAGATGG + Intronic
998005940 5:138657086-138657108 CTCCAGGGAGGAGGAGGGGAAGG + Intronic
998160238 5:139809061-139809083 AGGTGGGGAGGAAGTGGAGAAGG - Intronic
998264820 5:140659965-140659987 CTCTGGGAAGGAACAAGGGATGG - Intronic
998354926 5:141527066-141527088 CTCTGGGGAGGGGAAAGAGAGGG + Intronic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998485810 5:142501008-142501030 CTCTGGAGAGTATGAGGAAAGGG - Intergenic
998851972 5:146359743-146359765 CTGTGTGGAGGAAGAGGAATGGG + Intergenic
999273736 5:150314516-150314538 CTGGGGGGAGGAGGAGGAGGAGG - Intronic
999282522 5:150374807-150374829 CTCAGGTGAGGCAGAGGGGAGGG + Exonic
999540529 5:152566849-152566871 ATAGGAGGAGGAAGAGGAGACGG - Intergenic
999728361 5:154455724-154455746 CCCTGGGGAGGAAGGGCAAAGGG + Intronic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000112725 5:158124473-158124495 TTCTGGGGAGTAGGGGGAGAAGG + Intergenic
1000922377 5:167153491-167153513 CTCAGGGGTGGAAGAGGGGGAGG + Intergenic
1001251857 5:170152851-170152873 ATCTGGAGAGGAAGAGAGGAGGG - Intergenic
1001262901 5:170247679-170247701 GTTTGGGAAGGATGAGGAGAAGG + Exonic
1001295824 5:170498118-170498140 TCCTGGGGAGGTAGGGGAGAAGG + Intronic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001763154 5:174223956-174223978 AGCTGGGAAGGAAGAGGAGGCGG - Intronic
1002480225 5:179496225-179496247 GTCTGGGAAGGAGGAGGAGGAGG + Intergenic
1002680045 5:180954604-180954626 CTCAGGAGAGGAAGCAGAGAGGG + Intergenic
1003053193 6:2797913-2797935 AGCAGGGGAGGAGGAGGAGAAGG - Intergenic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003269415 6:4593997-4594019 AGCTGGGGTGGAAGAGAAGAGGG - Intergenic
1003303803 6:4908536-4908558 CTGTGGGGGGCAGGAGGAGAGGG - Intronic
1003487863 6:6595283-6595305 AGGTGGGGAAGAAGAGGAGAAGG + Intronic
1003712896 6:8613560-8613582 CTAAGGGGAGGGAGAGGAGACGG - Intergenic
1003965522 6:11248957-11248979 CTCTGGGGAGAGAGAAGAGAAGG - Intronic
1004116384 6:12771832-12771854 CTCTGGGGAGGGATAGAAGTTGG + Intronic
1004181191 6:13381775-13381797 CTTGGGGGAGGAGGAGGGGAGGG - Intronic
1005152948 6:22773385-22773407 CTAAGGAGAGGAAGAGCAGAGGG - Intergenic
1005509070 6:26495844-26495866 CTCTGGGAAGAATGAAGAGAGGG + Intergenic
1005822538 6:29609388-29609410 CACAGGGGAGGAAGAGGGGAAGG + Intronic
1005852465 6:29831830-29831852 CTCAGGGCAGGAAGAAGAGTAGG - Intergenic
1005865064 6:29931188-29931210 CTCAGGGCAGGAAGAAGAGTAGG - Intergenic
1005939805 6:30552575-30552597 CTCTGGGGAGGAGGAGGAAGAGG - Exonic
1005951368 6:30633798-30633820 GGGTGGGGAGAAAGAGGAGAAGG + Intronic
1005994659 6:30923929-30923951 CTCTGGGGTGGCAGTGGAGCGGG - Intronic
1006134927 6:31889341-31889363 CTCTGGGAAGGGGGAGGAGGAGG + Exonic
1006189446 6:32198654-32198676 CCCTGAGGAGGGAGAGGAGGTGG - Exonic
1006518098 6:34555736-34555758 GTCTGGGGAGCATGAGGAGGGGG + Intronic
1006582820 6:35086636-35086658 CACTGGGCAGGAAGGGGATATGG - Intronic
1006603198 6:35239243-35239265 CTTTAGGGAGGAGGAGGAGCTGG - Intronic
1006670368 6:35726521-35726543 GTGTGTGGAGGAGGAGGAGATGG - Intronic
1006907063 6:37539625-37539647 CTGTGAGGAGGAGGAGGAGGAGG + Intergenic
1007111966 6:39317998-39318020 GTCTGGGGAAGAGGAGCAGAGGG - Intronic
1007169434 6:39852330-39852352 CCCTGGACAGGGAGAGGAGAAGG - Intronic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007663574 6:43501301-43501323 GTCAGGGGAGGAAGAGGGGATGG - Intronic
1007690592 6:43698830-43698852 CCCAGGGGAGGAAGTGGAGCCGG + Intergenic
1007702847 6:43774473-43774495 CTGTGGGGAGGAAGGGGAAGGGG + Intronic
1007806897 6:44457102-44457124 CTTTGGGGAGGCAGAGTGGAAGG + Intergenic
1007809475 6:44476025-44476047 CTCTGGAGGGAAGGAGGAGAAGG - Intergenic
1007834663 6:44665308-44665330 GTCTGGGAAGGAAGGGGAGGAGG - Intergenic
1007965368 6:45999623-45999645 GGCTGAGGAGGAAGAGGAGGAGG - Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008495057 6:52124768-52124790 CTCTGGAGAATAAGAGGTGATGG - Intergenic
1008687727 6:53943651-53943673 CTCACTGGAGGAAGGGGAGAAGG + Intronic
1009020844 6:57946892-57946914 CCCTGGGGAGGAGGAGGCGCCGG + Intergenic
1009369872 6:62885731-62885753 CTCTGGGTAGGAAATGGAGAAGG + Intergenic
1009821184 6:68803291-68803313 CTCTGGAGAGGAAAAGGAACAGG - Intronic
1009860649 6:69326770-69326792 ATGTGTGGAGGAAGAGGAGAAGG + Intronic
1010032858 6:71288698-71288720 CTGTGGGGAGGAGAAGGAGCCGG + Intergenic
1010360021 6:74982314-74982336 CTCTGGTGATGAAGTGGTGATGG + Intergenic
1010590423 6:77706070-77706092 CCTTGGGGAGAAAGAGGAGTGGG - Intronic
1011697642 6:89926987-89927009 ACCTGGGGAGGAAGAGAAGAGGG + Exonic
1013006910 6:106082264-106082286 CTGTGGGAAAGAACAGGAGAAGG - Intergenic
1013305922 6:108847082-108847104 CAGTGAGGAGGAGGAGGAGAAGG - Intergenic
1014647622 6:123994031-123994053 CTCTGGGGAAGAAGCAGTGATGG - Intronic
1014709508 6:124790029-124790051 CACTGGGGAGGCAGAGTTGAAGG - Intronic
1014837929 6:126181697-126181719 CTCTGGGGATGAAGAAGAAGAGG + Intergenic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015593213 6:134842445-134842467 GCCTGGGGAGGAAGAGAGGAGGG - Intergenic
1015669244 6:135669122-135669144 CTGTGGGGAGGAAGTGGGGCAGG - Intergenic
1015957488 6:138613756-138613778 CCCTGGGCAGTAATAGGAGAGGG + Intronic
1015960176 6:138640487-138640509 TTCTGAGGAGGATGAGGAGGAGG - Intronic
1016737333 6:147493663-147493685 CTCAGAGGAGGAAGAGGAGGTGG - Intergenic
1016893940 6:149034409-149034431 CTCTGGGTGGAAAGAGGAGAGGG - Intronic
1016893957 6:149034475-149034497 CTCTGGGTGGAAAGAGGAGAGGG - Intronic
1017049815 6:150379857-150379879 CTTTATAGAGGAAGAGGAGATGG - Intronic
1017244074 6:152202993-152203015 CTCTGGAGAGGAATAGGCCAGGG + Intronic
1017975623 6:159354461-159354483 CTCTGTGCAGGCATAGGAGATGG + Intergenic
1018188420 6:161287827-161287849 CTCAGAGGAGGGAGAAGAGAAGG + Intergenic
1018376176 6:163215752-163215774 AACTGGGTAGGAAGAGGAAAAGG + Intronic
1018733863 6:166673021-166673043 CTCTGGGGAGGGCTGGGAGAGGG - Intronic
1018921027 6:168174490-168174512 CTCAGGGGAGAAAGAGCTGAAGG - Intergenic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019178534 6:170173493-170173515 CTCTGGGGTGGCAGAGGTGGGGG - Intergenic
1019283353 7:211406-211428 GCCTGGGGAGGAAGAGGTGGAGG - Intronic
1019362092 7:610075-610097 ATCTGGGCAGGAACAGGTGAAGG - Intronic
1019562624 7:1666041-1666063 CCCGGAGGAGGAAGAGGAGGAGG + Intergenic
1019725577 7:2600539-2600561 CTTTCGGGAGGACGAGGAGTTGG - Intronic
1019752072 7:2737088-2737110 CACTGGGGAGTGAGAGGAAAAGG + Intronic
1019895598 7:3980060-3980082 CTCTGAGGATGAAGATGACAGGG - Intronic
1020220271 7:6231287-6231309 CTTGGAGGAGGAAGAGGAGTTGG + Intronic
1021092548 7:16500799-16500821 CTATGGGGAGTAAGCGGTGATGG - Intronic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1022413230 7:30155600-30155622 CTCTGCGGATGTAGAGGGGAAGG - Intronic
1022519400 7:30996291-30996313 GTGTAGGGAGGAAGAGGAGGAGG - Intergenic
1023220193 7:37914326-37914348 CTCTGGAGAGGAGAAGTAGAGGG + Intronic
1023348553 7:39296427-39296449 GTGAGGAGAGGAAGAGGAGAAGG - Intronic
1023714966 7:43034650-43034672 CCCAGGGACGGAAGAGGAGATGG + Intergenic
1023821956 7:43985520-43985542 ATTTGGGGAGGAGGGGGAGAGGG - Intergenic
1023960461 7:44922068-44922090 CCCTGGTGAGGAAGGGGAGGAGG - Intergenic
1024002909 7:45202706-45202728 CTCTGGGGAGGAGGAGGCCTGGG - Intergenic
1024005546 7:45222794-45222816 CTCAGGAGAGGAAGGGGAGTAGG - Intergenic
1024172502 7:46804859-46804881 CTCTGAGGAGCAAGTGGAGAGGG - Intergenic
1024208608 7:47184821-47184843 CTCTGGGGTGGGAGAGGAGGAGG + Intergenic
1024374326 7:48620123-48620145 CTCTGAGGAGGAGGAGGAGGAGG + Intronic
1024579047 7:50787258-50787280 CTCTGGAGAGCAGGAGGAGGAGG + Intronic
1025144745 7:56493512-56493534 CTTAGAGAAGGAAGAGGAGAAGG + Intergenic
1025611739 7:63080648-63080670 GTCTGGGGAGCAAGAGATGAGGG + Intergenic
1025776813 7:64568060-64568082 GTCTGGTGGAGAAGAGGAGAGGG - Intergenic
1026013017 7:66651685-66651707 ACCTGGGAAGGAAGAAGAGAAGG - Intronic
1026236555 7:68532197-68532219 GACTGGGGAGGAAGAAGGGAGGG + Intergenic
1026472426 7:70705630-70705652 CTGTGGGGTGGAGGAGGCGAAGG - Intronic
1026840793 7:73668938-73668960 CTCTGGAGAGGATGAGCAGGGGG + Intronic
1026852721 7:73735218-73735240 CTATGGAAAGGAAGAGGAGGTGG - Intergenic
1026964676 7:74431509-74431531 TTCCAGGCAGGAAGAGGAGAGGG + Intergenic
1027691899 7:81358130-81358152 GGCAGGAGAGGAAGAGGAGACGG - Intergenic
1027978104 7:85184971-85184993 CTCGGAGAAGGAAAAGGAGAAGG + Intronic
1028464839 7:91139488-91139510 CTCTTGGGAGGCAGTGGAAAGGG + Intronic
1028480746 7:91301855-91301877 ATATGGGGAGGAAAAGAAGAAGG - Intergenic
1029261419 7:99305303-99305325 TTCTGGGGAGGAAGGTGACAGGG - Intergenic
1029419815 7:100466791-100466813 GGCTGGGGATGATGAGGAGATGG + Exonic
1029420003 7:100467467-100467489 CCCTGGTAAGGAAGAGGACAGGG + Intronic
1029724970 7:102396670-102396692 CTTTGGGGAGGAGGAGGAGAAGG + Intronic
1029750220 7:102538934-102538956 ATTTGGGGAGGAGGGGGAGAGGG - Intronic
1029768171 7:102638042-102638064 ATTTGGGGAGGAGGGGGAGAGGG - Intronic
1030121239 7:106112394-106112416 CTCTGGGGCGGAAACGGAGTGGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030884646 7:114922571-114922593 TTCCGGGGCGGAAGAGGAGGAGG + Exonic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031483553 7:122304552-122304574 TGCTGGGGAGGAGGAGGAGGAGG - Intronic
1032069369 7:128794370-128794392 CTATGAGGAGGAAGAGGAAGAGG + Exonic
1032082352 7:128866020-128866042 GTCTGGGGAGGAATGGGAGGAGG + Intronic
1032234057 7:130104187-130104209 AGCTGAGGAGGAAGAGGAAAAGG + Intronic
1032242910 7:130179327-130179349 CTCTGGGGAAGGGGAGGAGGGGG - Intronic
1032408953 7:131678937-131678959 CAATGGGGAAGAAGGGGAGAGGG + Intergenic
1032548981 7:132766798-132766820 CTCAGGGGAGCAGGAGGAGTGGG + Intergenic
1032558619 7:132864285-132864307 CTCAGGGGAGGGAAAAGAGATGG + Intronic
1032808934 7:135388877-135388899 CACAGGGGAAGAAGAGGTGAAGG - Intronic
1033093024 7:138404329-138404351 AGGTGGGGAGGAAGAGGAGGAGG - Intergenic
1033436895 7:141341348-141341370 GTGTGGGGAGGAAAATGAGAAGG + Intronic
1033606856 7:142933828-142933850 CCCTGGGGAAGAAAAGGAGGAGG + Intergenic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1034184688 7:149166183-149166205 CTCTGGAGTGGAAAAGTAGATGG - Exonic
1034272249 7:149808968-149808990 GTCTGGGTGGGAGGAGGAGAAGG + Intergenic
1034350380 7:150411303-150411325 GGCTGGGGAGGAAGAGGATGAGG + Intronic
1034429154 7:151032238-151032260 CTCTGAGGAGAAGGAGGAGCAGG + Intronic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034683167 7:152946847-152946869 TTATGGGGAGGAACAGGAGGTGG + Intergenic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1035042188 7:155937073-155937095 CCCTGGGAAGGATGAGGGGAAGG - Intergenic
1035065249 7:156099769-156099791 CCCTGGGGAGGGGGATGAGAGGG + Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035474357 7:159131397-159131419 TTCTGGGTAGGTAGAGGAAATGG - Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1035825910 8:2643899-2643921 AAAAGGGGAGGAAGAGGAGAAGG + Intergenic
1036236229 8:7041970-7041992 CTATGAGGAGGAGGAGGAGGAGG - Intergenic
1036472845 8:9066155-9066177 AGGTGGGGAGGAAGAGGAGGAGG - Intronic
1037262867 8:17027411-17027433 CTCCCGAGAGGATGAGGAGAGGG + Exonic
1037281415 8:17246696-17246718 CTATGGCGAGGAGGAGGAGGAGG - Exonic
1037578187 8:20227820-20227842 TTCTGGAGAGAAAGGGGAGATGG - Intergenic
1037613813 8:20499000-20499022 CTCAGGGGTAGAAGAGGTGAAGG - Intergenic
1037816455 8:22115187-22115209 ATCTGGGGAGTGTGAGGAGAGGG - Exonic
1037897807 8:22669824-22669846 CTCTGGGAAGGAACAAGAGCAGG - Intergenic
1038277444 8:26133764-26133786 CAATGTGGAGGACGAGGAGATGG + Intergenic
1038410447 8:27354354-27354376 GGACGGGGAGGAAGAGGAGATGG + Intronic
1038477739 8:27879848-27879870 CCCTGGGTAGGAGGAAGAGAGGG + Intronic
1038776151 8:30532732-30532754 CTCTTTGGAGGGTGAGGAGATGG - Intronic
1039439376 8:37584217-37584239 CACTGGGGAGAAAGAGTGGATGG + Intergenic
1039504480 8:38042095-38042117 CTTGGAGGGGGAAGAGGAGATGG - Intronic
1039567295 8:38560481-38560503 GTTTTGGGGGGAAGAGGAGAGGG - Intergenic
1039743136 8:40400163-40400185 TTCTGGGGAGAAATAAGAGATGG - Intergenic
1039858331 8:41435386-41435408 CTGTCTGGAGGAGGAGGAGAAGG + Intergenic
1039895004 8:41710803-41710825 CACTGGTCAGGAAGAGGAAAGGG + Intronic
1039926924 8:41942849-41942871 CTCAGAGGAGGAAGAAGAGGAGG - Exonic
1040079800 8:43274995-43275017 GGAGGGGGAGGAAGAGGAGACGG - Intergenic
1040877814 8:52171174-52171196 CTCCGGGGAGAAAGAGCAGGGGG + Intronic
1041013440 8:53567412-53567434 CTCTGGAGAGGAAGAGGAAAAGG - Intergenic
1041289209 8:56292973-56292995 TTCAGGGAAGGAAGAGGAGATGG - Intergenic
1041487152 8:58392037-58392059 CTCAGGGGAAGAAGAGGACAAGG - Intergenic
1042020546 8:64369300-64369322 CTCTAGGGAGAAAGGGGAGGGGG + Intergenic
1042130397 8:65582263-65582285 CTCTGTGGAGGAGGAGGAGGAGG + Intergenic
1042472646 8:69208915-69208937 CTCTGGGAAGGCTGAGGAGAAGG - Intergenic
1042494835 8:69444366-69444388 GCCTGGAAAGGAAGAGGAGAGGG + Intergenic
1042785017 8:72537117-72537139 CGCTGAGGAGGAAGAGGGGGAGG + Intergenic
1043890059 8:85644349-85644371 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043891600 8:85656263-85656285 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043892672 8:85663100-85663122 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043892885 8:85714235-85714257 CTCTGGGCAGGCTGATGAGAGGG - Intergenic
1043895572 8:85735689-85735711 CTCTGGGCAGGCTGATGAGAGGG - Intergenic
1043897107 8:85746119-85746141 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043899433 8:85764487-85764509 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043901041 8:85776680-85776702 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043903005 8:85791955-85791977 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043904615 8:85804148-85804170 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043906227 8:85816339-85816361 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043907835 8:85828529-85828551 CTCTGGGCAGGCTGATGAGAGGG + Intergenic
1043949631 8:86293199-86293221 GGCTGAGGAGGAAGAGGAAAAGG + Intronic
1044616906 8:94151797-94151819 CAATGGGGAGGAGGAGGAGCTGG - Intronic
1045156642 8:99482225-99482247 TAATTGGGAGGAAGAGGAGAGGG - Intronic
1045323122 8:101096860-101096882 GGCTGGGGAGGAAGAGCACATGG + Intergenic
1045485197 8:102625777-102625799 CTGTGAGGAGGGAGAGGACAGGG + Intergenic
1046117492 8:109801525-109801547 AGATGGGGAGAAAGAGGAGAGGG - Intergenic
1046155120 8:110278698-110278720 CACTGGTAAGGAACAGGAGATGG + Intergenic
1046417136 8:113932138-113932160 AAATGGGGAGGAGGAGGAGAGGG + Intergenic
1046550459 8:115709384-115709406 CTTTAGGGAGGAAGACCAGAGGG - Intronic
1047100804 8:121674000-121674022 TTTTGAAGAGGAAGAGGAGAAGG - Intergenic
1047293790 8:123553126-123553148 CTCTGGGGAGTAATGGGTGAAGG - Intergenic
1047323393 8:123811655-123811677 GACTGGGGAGGAAGAGGGGAGGG + Intronic
1047534919 8:125710864-125710886 GGCTGAGGAGGAAGAGGAGGAGG + Intergenic
1047721292 8:127642664-127642686 ATGGGAGGAGGAAGAGGAGAAGG - Intergenic
1047741446 8:127810090-127810112 CTCTGGAAAGGGAGAGGAGCAGG + Intergenic
1048005509 8:130416293-130416315 CTCTGGAGAGGAGGAAGAGACGG - Intronic
1048044056 8:130756700-130756722 CCTTGGGGAGGAAGAGGAGATGG + Intergenic
1048319133 8:133385124-133385146 CTGGGGTGAGAAAGAGGAGAAGG - Intergenic
1048607801 8:135987922-135987944 CTGTGATGAGGAGGAGGAGAAGG - Intergenic
1049317155 8:141975417-141975439 CTTTGGGGAGGAGGAGGACAGGG + Intergenic
1049372339 8:142273805-142273827 CTCAGGGGTGCAAGAGGAAAAGG - Intronic
1049426167 8:142538787-142538809 GTCTGGGGAGGGAGAGGTGGTGG - Intronic
1049433611 8:142576356-142576378 CTCTGGGGGTGCAGAGGGGAGGG - Intergenic
1049533188 8:143166665-143166687 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533197 8:143166699-143166721 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533205 8:143166732-143166754 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533214 8:143166766-143166788 ATCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533234 8:143166834-143166856 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533243 8:143166868-143166890 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533252 8:143166902-143166924 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533262 8:143166935-143166957 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533282 8:143167003-143167025 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533311 8:143167105-143167127 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533329 8:143167172-143167194 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533336 8:143167205-143167227 GTCTAGGGAGGAAGTGGAGAAGG + Intergenic
1049533346 8:143167240-143167262 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533357 8:143167274-143167296 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533368 8:143167308-143167330 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533379 8:143167342-143167364 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533390 8:143167376-143167398 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533412 8:143167444-143167466 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533422 8:143167478-143167500 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533430 8:143167512-143167534 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533441 8:143167546-143167568 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533452 8:143167580-143167602 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533462 8:143167614-143167636 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533470 8:143167648-143167670 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533492 8:143167716-143167738 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533502 8:143167750-143167772 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533512 8:143167784-143167806 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533523 8:143167818-143167840 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533533 8:143167852-143167874 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533541 8:143167886-143167908 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533552 8:143167920-143167942 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533563 8:143167954-143167976 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533571 8:143167988-143168010 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533582 8:143168022-143168044 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533604 8:143168090-143168112 ATCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533615 8:143168124-143168146 GTCTGGGGAGGAAGTGGGGAGGG + Intergenic
1049533625 8:143168158-143168180 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533647 8:143168226-143168248 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533655 8:143168260-143168282 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533666 8:143168294-143168316 GTCTAGGGAGGAAGTGGGGAGGG + Intergenic
1049533696 8:143168396-143168418 GTCTAGGGAGGAAGTGGAGAAGG + Intergenic
1049533706 8:143168431-143168453 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533724 8:143168499-143168521 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049533733 8:143168533-143168555 GTCTAGGGAGGAAGTGGAGAGGG + Intergenic
1049553698 8:143272102-143272124 GTCTGGGCAGGAAGAAGTGAGGG + Intronic
1049912960 9:287451-287473 TTCTGGGGAAGATGAGAAGATGG - Intronic
1050148615 9:2596917-2596939 CATTGTGGAGCAAGAGGAGAGGG + Intergenic
1050653307 9:7796674-7796696 GTCTGAGGAGCAAGAGGAGTTGG - Exonic
1050744290 9:8858286-8858308 CTTTTGGGGGGAAGAAGAGAAGG - Intronic
1050882324 9:10718021-10718043 ATCTGGGGATGAAGAGGAATGGG + Intergenic
1051233845 9:14978502-14978524 CACAGGGCAGGAAGAGGGGAGGG - Intergenic
1051478462 9:17534295-17534317 CTCAAGGGAGGAAGATGAGAAGG + Intergenic
1051822669 9:21186093-21186115 ATGTGGGGAGGAAGTGGAGAGGG - Intergenic
1051824564 9:21205669-21205691 ATATGGGGAGCAAGTGGAGAGGG - Intergenic
1051825670 9:21215857-21215879 ATGTGGGGAGCAAGCGGAGAGGG - Intronic
1051826500 9:21226732-21226754 ATGTGGGGAGCAAGTGGAGAGGG - Intronic
1051827670 9:21238495-21238517 ATGTGGGGAGGAAGTGGAGAGGG - Intronic
1051889591 9:21928400-21928422 CTCTGGGGAGGACTGGTAGATGG + Intronic
1052160769 9:25255726-25255748 CTCTGAGGAGGAAGAACTGAGGG + Intergenic
1052401456 9:28005468-28005490 CTGTGGGGAAGAAAAGTAGAGGG - Intronic
1052801297 9:32970581-32970603 CTCTGGGCATGAAGAGGGAACGG + Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053022891 9:34708155-34708177 CTCTGGGGAGGAAGAGGTAGAGG + Intergenic
1053263625 9:36694118-36694140 CTCAGAGGAGGAGGAGGAGGAGG - Intergenic
1053302361 9:36961069-36961091 CCCTGGGGAGAAAGAGGATGTGG - Intronic
1053583887 9:39436187-39436209 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1053753465 9:41279195-41279217 CTGGGGGGAGGAAGAGGAATGGG + Intergenic
1054105468 9:60994931-60994953 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1054258989 9:62843558-62843580 CTGGGGGGAGGAAGAGGAATGGG + Intergenic
1054332790 9:63776482-63776504 CTGGGGGGAGGAAGAGGAATGGG - Intergenic
1054727580 9:68667633-68667655 CTCTGGGTGGGCCGAGGAGATGG - Intergenic
1054791684 9:69262336-69262358 CCATGAGGAGGAGGAGGAGAAGG - Intergenic
1055030524 9:71768595-71768617 CTCGGGGCAGGAGGAGGAGGAGG - Exonic
1055604185 9:77950592-77950614 CTCTAGGGAGGAAATGGGGAAGG + Intronic
1055636331 9:78282598-78282620 CACTGGGGAGGCAAGGGAGAGGG + Intergenic
1056153067 9:83806561-83806583 CTGTGGGGAGGCAGAAGAGTAGG + Intronic
1057139270 9:92716925-92716947 ATCTGGGGAGGGTGAGGAGAGGG - Intronic
1057144731 9:92750113-92750135 CTCTGGGGATTGCGAGGAGATGG - Intronic
1057197356 9:93122382-93122404 CTGGAAGGAGGAAGAGGAGAGGG + Intronic
1057357974 9:94347368-94347390 AAGTGGGGAGGAAGAGGAGGAGG - Intergenic
1057463020 9:95283189-95283211 CCCTGGGGAGGCTGAGGAGGAGG - Intronic
1057649776 9:96910249-96910271 AAGTGGGGAGGAAGAGGAGGAGG + Intronic
1057697051 9:97330659-97330681 GTCAGAGGAGGAAGATGAGAAGG + Exonic
1058647815 9:107146704-107146726 CTCAGGGGAGCAGGAAGAGAGGG + Intergenic
1058707688 9:107650755-107650777 CTCTGGTGGGTAAGAGGAAAAGG + Intergenic
1058721758 9:107770511-107770533 CTCTGAAGAGGAAGAGAAGGAGG - Intergenic
1058811020 9:108639608-108639630 GTCTGGAAAGGGAGAGGAGAGGG - Intergenic
1059158744 9:112013606-112013628 CCCTAGTGAGGAAGAGGAGAGGG + Intergenic
1059172318 9:112137258-112137280 CACAGGGGAGGAGGAGGAGGAGG + Intronic
1059898622 9:118896403-118896425 CTCTGGGCAGAGGGAGGAGATGG + Intergenic
1060206645 9:121686347-121686369 CCCAGGGCAGGAAGAGGAGGGGG - Intronic
1060239154 9:121888089-121888111 GTCTGGTGAGGAAGGGGAGGGGG - Intronic
1060275287 9:122177881-122177903 CTCTGTGGGAGAAGGGGAGAGGG - Intronic
1060513509 9:124251141-124251163 GGCTGGGGAGGAGGTGGAGAGGG - Intergenic
1060513866 9:124253660-124253682 GGCTGGGGAGGAGGTGGAGAGGG + Intergenic
1060696136 9:125710657-125710679 CACTGGGGAGGTAGATGAGGAGG + Intergenic
1060698634 9:125731462-125731484 CCCTGGGGAAGTAGAGGGGATGG - Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060927411 9:127464750-127464772 CTCTTGGGAGGCTGAGGAGGAGG - Intronic
1061196172 9:129108342-129108364 CTTTGGGGTGGCAGAGGTGAGGG + Intronic
1061200663 9:129136679-129136701 CCCTGGGCAGGAAGAAGGGAAGG - Intronic
1061237121 9:129349716-129349738 CTCTAGGGTGGATGAGGAAACGG - Intergenic
1061237500 9:129351397-129351419 ACCTGGGGAGGGGGAGGAGAGGG + Intergenic
1061303241 9:129718332-129718354 CTCTGGTGGGGATGAGGAGCTGG - Intronic
1061764799 9:132875010-132875032 TCCTGGAGAGGAAGAGGAGGAGG + Intronic
1061823173 9:133239782-133239804 CTGTGGGGAGGATGATGAAAGGG - Intergenic
1061959557 9:133981096-133981118 CCCTGGGGAGAAGCAGGAGACGG + Intronic
1061972138 9:134050548-134050570 CGCTGGGGAGACAGAGGACACGG + Exonic
1062264271 9:135679692-135679714 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264315 9:135679815-135679837 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062264329 9:135679850-135679872 CTGTGGGGAGGGGGAGGGGAGGG - Intergenic
1062274868 9:135725939-135725961 GTCTGGGGAGGAAGAGGGGTTGG + Intronic
1062318336 9:135978753-135978775 CCCTGGGGAGGTAGAGAAGCTGG - Intergenic
1062445162 9:136590592-136590614 CTATGGGGAGGCAGAGATGATGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062540684 9:137040437-137040459 CTGTGGGAAGGAGGAGGCGAGGG + Intronic
1062738579 9:138152923-138152945 CTTTGGGGAGGCCGAGGCGAGGG - Intergenic
1203772639 EBV:57459-57481 TGCTGAGGAGGAAGAGGAGAAGG + Intergenic
1186272053 X:7899724-7899746 TTTAGGGGAGGAAGATGAGAGGG + Exonic
1186502923 X:10066420-10066442 GTTTCGGGAGGAAGAGGAGTGGG + Intronic
1186798138 X:13066510-13066532 CTCTGGGGAGCACGCAGAGAGGG - Intergenic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1187248895 X:17579481-17579503 CTTTGGGGATAAAAAGGAGAGGG - Intronic
1187415804 X:19092466-19092488 GTCTGGAGAGGATGAGGAGCAGG + Intronic
1187630041 X:21159098-21159120 CTCTGAGGAGGAGAAGGAGGAGG + Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1189083059 X:37994679-37994701 ATCTGAGGAGGAAGAGGAGGAGG + Intronic
1189150746 X:38703798-38703820 CTTTGGGGAAGAAGAAAAGAAGG + Intergenic
1189269052 X:39737477-39737499 CTGTAGGGAGACAGAGGAGAGGG - Intergenic
1189737788 X:44089119-44089141 TTTGGGGGAGGAAGAGGAGGAGG + Intergenic
1190641022 X:52482768-52482790 CTTTGAGAAGGAAGAGGAAAAGG - Intergenic
1190646650 X:52530097-52530119 CTTTGAGAAGGAAGAGGAAAAGG + Intergenic
1190732301 X:53234164-53234186 GTCTGGGGAGCCACAGGAGAGGG - Exonic
1192156146 X:68748092-68748114 CTCAGGGGAAGAAGAAGAGTTGG + Intergenic
1192180270 X:68911969-68911991 GTCTGGGGAGGAGGAGGATGGGG - Intergenic
1192281089 X:69686594-69686616 CTAGGGGCTGGAAGAGGAGAGGG - Intronic
1192580913 X:72280499-72280521 CTCTGGGGCTGAGGAGGAGGGGG + Intronic
1192601608 X:72470253-72470275 CTCTGGGGTGGAAGTTGAGATGG - Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193527515 X:82611903-82611925 CTCTGGGGAGGAATGGAAGGTGG + Intergenic
1193835957 X:86343924-86343946 GGCTGGGGAGGAAGTGGGGATGG + Intronic
1194733715 X:97486918-97486940 GTCTGGGGAGAAGGAGGAGTGGG - Intronic
1194795510 X:98207373-98207395 CTCAGGGGTGGTGGAGGAGATGG - Intergenic
1195024864 X:100866524-100866546 CTCTGGGGAGTAGGATGGGAGGG + Intronic
1195078372 X:101348635-101348657 CGCCGCGGAGGAAGAGGAGGAGG + Exonic
1195382312 X:104282486-104282508 CTCTGAGGGTGAAGAGGAAAAGG - Intergenic
1195636702 X:107125105-107125127 GGGTGAGGAGGAAGAGGAGAGGG - Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197272130 X:124436420-124436442 CTCAGGGTAGGGAGAGGAGCTGG - Intronic
1197770647 X:130087035-130087057 CATAGGGGAGGAAGAGGAGGGGG + Intronic
1198018279 X:132633503-132633525 TTCGGGGGAGAAAGAGGAGGAGG + Intronic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198270332 X:135051184-135051206 CTCTGGGGATGGGGAGGAAATGG + Exonic
1198532428 X:137559717-137559739 TTCTGGGCAAGAAGAGGAGCTGG + Intergenic
1199571079 X:149267804-149267826 TTCTGGGGAGGAGGAAGGGAGGG + Intergenic
1199582350 X:149372910-149372932 CTATGGGGAGGGGAAGGAGAAGG + Intergenic
1200073225 X:153539053-153539075 TTCTGCGGAGGGAGAGGAGCAGG - Intronic
1200140622 X:153901062-153901084 CTCTGGGGAGGAAAGCGGGAGGG + Intronic
1200234291 X:154460791-154460813 CTGGGTGGAGGAAGAAGAGAAGG - Intronic