ID: 1166372822

View in Genome Browser
Species Human (GRCh38)
Location 19:42311737-42311759
Sequence TCTAGGTCCCAGCATGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166372822_1166372834 30 Left 1166372822 19:42311737-42311759 CCTAGGCCATGCTGGGACCTAGA No data
Right 1166372834 19:42311790-42311812 CCTCCTGGTCTGTGAACACAGGG No data
1166372822_1166372828 15 Left 1166372822 19:42311737-42311759 CCTAGGCCATGCTGGGACCTAGA No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data
1166372822_1166372825 -7 Left 1166372822 19:42311737-42311759 CCTAGGCCATGCTGGGACCTAGA No data
Right 1166372825 19:42311753-42311775 ACCTAGAGTAAGCCACATCTGGG No data
1166372822_1166372832 29 Left 1166372822 19:42311737-42311759 CCTAGGCCATGCTGGGACCTAGA No data
Right 1166372832 19:42311789-42311811 GCCTCCTGGTCTGTGAACACAGG No data
1166372822_1166372824 -8 Left 1166372822 19:42311737-42311759 CCTAGGCCATGCTGGGACCTAGA No data
Right 1166372824 19:42311752-42311774 GACCTAGAGTAAGCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166372822 Original CRISPR TCTAGGTCCCAGCATGGCCT AGG (reversed) Intergenic