ID: 1166372823

View in Genome Browser
Species Human (GRCh38)
Location 19:42311743-42311765
Sequence GCTTACTCTAGGTCCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166372823_1166372828 9 Left 1166372823 19:42311743-42311765 CCATGCTGGGACCTAGAGTAAGC No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data
1166372823_1166372834 24 Left 1166372823 19:42311743-42311765 CCATGCTGGGACCTAGAGTAAGC No data
Right 1166372834 19:42311790-42311812 CCTCCTGGTCTGTGAACACAGGG No data
1166372823_1166372832 23 Left 1166372823 19:42311743-42311765 CCATGCTGGGACCTAGAGTAAGC No data
Right 1166372832 19:42311789-42311811 GCCTCCTGGTCTGTGAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166372823 Original CRISPR GCTTACTCTAGGTCCCAGCA TGG (reversed) Intergenic