ID: 1166372826

View in Genome Browser
Species Human (GRCh38)
Location 19:42311754-42311776
Sequence GCCCAGATGTGGCTTACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166372826_1166372832 12 Left 1166372826 19:42311754-42311776 CCTAGAGTAAGCCACATCTGGGC No data
Right 1166372832 19:42311789-42311811 GCCTCCTGGTCTGTGAACACAGG No data
1166372826_1166372828 -2 Left 1166372826 19:42311754-42311776 CCTAGAGTAAGCCACATCTGGGC No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data
1166372826_1166372836 30 Left 1166372826 19:42311754-42311776 CCTAGAGTAAGCCACATCTGGGC No data
Right 1166372836 19:42311807-42311829 ACAGGGAACAGTGTATGTGCAGG No data
1166372826_1166372834 13 Left 1166372826 19:42311754-42311776 CCTAGAGTAAGCCACATCTGGGC No data
Right 1166372834 19:42311790-42311812 CCTCCTGGTCTGTGAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166372826 Original CRISPR GCCCAGATGTGGCTTACTCT AGG (reversed) Intergenic