ID: 1166372828

View in Genome Browser
Species Human (GRCh38)
Location 19:42311775-42311797
Sequence GCCTGCCCTTGAGCGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166372821_1166372828 16 Left 1166372821 19:42311736-42311758 CCCTAGGCCATGCTGGGACCTAG No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data
1166372822_1166372828 15 Left 1166372822 19:42311737-42311759 CCTAGGCCATGCTGGGACCTAGA No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data
1166372826_1166372828 -2 Left 1166372826 19:42311754-42311776 CCTAGAGTAAGCCACATCTGGGC No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data
1166372823_1166372828 9 Left 1166372823 19:42311743-42311765 CCATGCTGGGACCTAGAGTAAGC No data
Right 1166372828 19:42311775-42311797 GCCTGCCCTTGAGCGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166372828 Original CRISPR GCCTGCCCTTGAGCGCCTCC TGG Intergenic