ID: 1166377398

View in Genome Browser
Species Human (GRCh38)
Location 19:42335251-42335273
Sequence TGCCCTGGCCATAGGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166377398_1166377411 25 Left 1166377398 19:42335251-42335273 CCCGGCAGCCTATGGCCAGGGCA 0: 1
1: 0
2: 1
3: 35
4: 331
Right 1166377411 19:42335299-42335321 CAGGACCTCAACAATGCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 180
1166377398_1166377403 6 Left 1166377398 19:42335251-42335273 CCCGGCAGCCTATGGCCAGGGCA 0: 1
1: 0
2: 1
3: 35
4: 331
Right 1166377403 19:42335280-42335302 TATCCACCCCTCCACAGGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 218
1166377398_1166377402 1 Left 1166377398 19:42335251-42335273 CCCGGCAGCCTATGGCCAGGGCA 0: 1
1: 0
2: 1
3: 35
4: 331
Right 1166377402 19:42335275-42335297 GAGACTATCCACCCCTCCACAGG 0: 1
1: 0
2: 1
3: 2
4: 79
1166377398_1166377410 24 Left 1166377398 19:42335251-42335273 CCCGGCAGCCTATGGCCAGGGCA 0: 1
1: 0
2: 1
3: 35
4: 331
Right 1166377410 19:42335298-42335320 CCAGGACCTCAACAATGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166377398 Original CRISPR TGCCCTGGCCATAGGCTGCC GGG (reversed) Intronic
900138181 1:1127644-1127666 TGCCCTGGGCCTAGGTGGCCAGG + Intergenic
900147762 1:1165878-1165900 TGCCCTGGCCCCAGCCTGTCAGG - Intergenic
900329665 1:2127744-2127766 CACCCTGGCCAGGGGCTGCCAGG - Intronic
900461801 1:2805314-2805336 TGCCCTGCCTGCAGGCTGCCAGG - Intergenic
900599668 1:3497607-3497629 TGCCCTTGGCACAGGCTGCAGGG + Intronic
900793951 1:4696414-4696436 AGCCCTGTCCCTGGGCTGCCTGG + Intronic
901056729 1:6451782-6451804 TTCCCTGGCCCTAGGCCACCGGG + Intronic
901527717 1:9834593-9834615 GTCCCTGACCGTAGGCTGCCAGG + Intergenic
902143129 1:14373610-14373632 TGACTGGGCCATGGGCTGCCTGG - Intergenic
902477641 1:16696723-16696745 TTCCCTGGCCCTAGGCCACCAGG - Intergenic
903369271 1:22824842-22824864 TGCCCTGGCCACAGGTGCCCTGG - Intronic
904417397 1:30371742-30371764 TGGCCTGGCCATCGTGTGCCAGG - Intergenic
905790454 1:40786493-40786515 TGCCCTGGCCCTGGGCTCCCGGG - Intronic
905912058 1:41662071-41662093 TGCCCGGTCCCTGGGCTGCCAGG + Intronic
906567644 1:46812335-46812357 TGCCCTCACCCTAGGCTACCAGG - Intronic
906578921 1:46918087-46918109 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
906594415 1:47062449-47062471 AGCCCTGGTCACTGGCTGCCTGG + Intergenic
907332364 1:53679519-53679541 TGCCCAAACCACAGGCTGCCTGG + Intronic
907486408 1:54781212-54781234 TGCCCAGGCCGGAGGCTCCCTGG - Exonic
907633311 1:56106665-56106687 AGCCCTGCTCACAGGCTGCCTGG + Intergenic
908745392 1:67371462-67371484 TGCCCTGCCGATAGGTAGCCAGG - Intronic
913489810 1:119368406-119368428 TGTCCTGCCCATGGGCTCCCAGG + Intergenic
915645327 1:157267888-157267910 TACCCTAGACATGGGCTGCCTGG - Intergenic
916331718 1:163625031-163625053 AGCCCTGCCCACTGGCTGCCTGG - Intergenic
918159049 1:181880251-181880273 AGCCCTGCTCATTGGCTGCCTGG + Intergenic
922336101 1:224619086-224619108 TGCCTTGGCCAGAGGGTGTCAGG + Intronic
924208871 1:241744135-241744157 TTCCATGGCCAGGGGCTGCCTGG + Intronic
924295149 1:242579291-242579313 TGCCCTGGCCTTGTTCTGCCAGG + Intergenic
1063123899 10:3123820-3123842 TGCCATGGCCAGAGCCTGCCAGG + Intronic
1064148159 10:12841699-12841721 TGCTCTGGCCTGAGGCGGCCGGG - Intergenic
1064568995 10:16672975-16672997 GGCCCTGGAAACAGGCTGCCTGG - Intronic
1065894623 10:30152344-30152366 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1066101074 10:32119274-32119296 TGCTCTGGGCAAAGGTTGCCAGG + Intergenic
1066375808 10:34856977-34856999 TGCCCTGGACATAGCCAGTCAGG + Intergenic
1066388357 10:34959490-34959512 TGAACTGGCCACAGGCAGCCGGG - Intergenic
1067046826 10:42989829-42989851 TGTCCTGGCCATTGGCAGCCAGG - Intergenic
1067414337 10:46092183-46092205 TGCCCTGGCAGTAGGCTGTGAGG - Intergenic
1067581550 10:47449698-47449720 TGCCCTGGCAGTAGGCTGTGGGG + Intergenic
1067748950 10:48957459-48957481 GGCGCTGGCCCCAGGCTGCCAGG + Intronic
1067940520 10:50651159-50651181 TGGCATGGTCTTAGGCTGCCAGG - Intergenic
1069129611 10:64682339-64682361 AGCCCTGGTCACAGGCTGCCTGG - Intergenic
1069641756 10:69960857-69960879 TGCCCTGGCCAGAGCCTGAAGGG - Intronic
1070722486 10:78766201-78766223 TGCCCTCGGCAGAGGCTGCTGGG - Intergenic
1072012429 10:91314389-91314411 TGCCCTGGTCCTGGCCTGCCAGG - Intergenic
1072381800 10:94879807-94879829 AGCCCTGGTCACAGGCTACCTGG - Intergenic
1073322046 10:102621382-102621404 TGCTCTGGCTGTGGGCTGCCAGG - Intronic
1073459449 10:103658279-103658301 TGCCTTGCCCACAGGGTGCCAGG - Intronic
1074986311 10:118662815-118662837 AGCCCTGCTCATTGGCTGCCTGG - Intergenic
1075330477 10:121570330-121570352 TGACCTGGCCCCAGGCTGCGCGG + Intronic
1076285944 10:129296612-129296634 TGCCCTAGCCTGAGGCTGGCTGG + Intergenic
1077138967 11:1015166-1015188 TCCCCAGGCCATGGGATGCCTGG - Intronic
1077226971 11:1442812-1442834 AGCCCTGGCCCTGGCCTGCCTGG + Intronic
1078519645 11:12052833-12052855 TGCTCTGCCCATTGGCTTCCAGG + Intergenic
1081091170 11:38867646-38867668 AGCCCTGGCCACCGGCTACCTGG - Intergenic
1083314860 11:61808424-61808446 TGCCTGGGCAATAGGCTGCTTGG + Intronic
1083684937 11:64370254-64370276 CGCCCTGGCCAGAGGCCCCCTGG - Exonic
1083750489 11:64758296-64758318 TCCCGTAGCCATAGGCGGCCAGG + Exonic
1083831458 11:65236437-65236459 AGCGCTGGGCAAAGGCTGCCTGG + Intergenic
1084022104 11:66423883-66423905 TGCCCAGGACATAAGCTGCCTGG - Exonic
1084517400 11:69644276-69644298 TGGAGTGGCCACAGGCTGCCTGG - Intronic
1085296825 11:75436101-75436123 TGCCCTGGCCATATTCTGTATGG + Intronic
1086719406 11:90101498-90101520 TGCCCGGACCACAGGCTCCCCGG + Intergenic
1087804291 11:102539113-102539135 AGCCCTGGTCACCGGCTGCCTGG + Intergenic
1087817602 11:102676435-102676457 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1087866184 11:103229115-103229137 AGCCCTGGTCACTGGCTGCCTGG - Intronic
1088746013 11:112805747-112805769 TGCCCTGGCCAGTGGCTGCCGGG - Intergenic
1089113877 11:116078443-116078465 TGCCCTGGATATCGGCTGCAAGG + Intergenic
1089591749 11:119546367-119546389 AGCCCTTGCCCCAGGCTGCCAGG + Intergenic
1089662222 11:119993089-119993111 TGCCCTGGCCTTGGCCTCCCAGG + Intergenic
1090307226 11:125702066-125702088 AGACCTGCCCAGAGGCTGCCTGG + Intergenic
1090934697 11:131331006-131331028 AGCCCTTGCCATAGGCTGAGTGG + Intergenic
1091141472 11:133238980-133239002 CTCCCTGGCCCTAGGCAGCCTGG + Intronic
1092002545 12:5044213-5044235 TGGCCTGGCCGCAGCCTGCCCGG - Exonic
1092212146 12:6653280-6653302 TGCACTTGCCATAGGCTTCCTGG + Exonic
1093291123 12:17322933-17322955 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1095870808 12:47026020-47026042 TGCCCTGAAGATAGGCTGCTGGG - Intergenic
1096241440 12:49962164-49962186 TGGCCTGGCCATAGGCACGCTGG + Exonic
1097978726 12:65715307-65715329 TGCCCTAGCCACAGCCTCCCAGG + Intergenic
1099041946 12:77667360-77667382 AGCCCTGGTCACAGGCTGCCTGG + Intergenic
1100731750 12:97478858-97478880 TGCCCTGGTCCTAGGATGGCAGG - Intergenic
1100847444 12:98674639-98674661 TACCCTGGCTCTAGACTGCCTGG + Intronic
1100918511 12:99455528-99455550 AGTCCTGCTCATAGGCTGCCTGG + Intronic
1101693773 12:107105729-107105751 TGCCATGCCCCTAGTCTGCCAGG + Intergenic
1102347419 12:112168881-112168903 AGGCCTGCCCATAGGATGCCAGG + Intronic
1102519889 12:113471659-113471681 TGGCCTGGCGCTGGGCTGCCCGG + Exonic
1102643025 12:114383215-114383237 TTCCCTGGCCATAGACTGTGTGG - Intronic
1102793602 12:115669607-115669629 TGCCCTGGCCATGAGCCCCCTGG + Intergenic
1104035655 12:125095539-125095561 TTCCCTGGCCTCAGGCTTCCTGG + Intronic
1104610856 12:130226525-130226547 TGCCCTGGCTAAAGTCTGCAGGG + Intergenic
1106107876 13:26749991-26750013 TGCTCTAGACTTAGGCTGCCTGG - Intergenic
1106371306 13:29136492-29136514 TCCCCTGCCCAGAGGCTGCAGGG - Intronic
1107132504 13:36911595-36911617 TTTCCCGGCCAAAGGCTGCCTGG + Intronic
1107636274 13:42395561-42395583 TGCCCTGGCCCTGAGCTGACAGG - Intergenic
1110376023 13:74794534-74794556 AGCCCTGGTCACCGGCTGCCTGG - Intergenic
1112565054 13:100545473-100545495 AGCCCAGGCCACTGGCTGCCTGG - Intronic
1114514096 14:23286219-23286241 TGGGCTGGCCATTGGCTGCGTGG + Intronic
1115938183 14:38578512-38578534 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1117336207 14:54759267-54759289 TGCCCTGGCCCAAGGCCTCCAGG + Intronic
1118001389 14:61526796-61526818 TGCCATGGCCTTGGGCCGCCTGG - Intronic
1118822749 14:69355695-69355717 TGCCCTGCCCATAGGCTTTCGGG - Exonic
1118920082 14:70142056-70142078 TGCACTGGCCATTAGGTGCCAGG - Intronic
1119705639 14:76781183-76781205 TGGCCTGGCCAGAGGCACCCTGG + Exonic
1120450957 14:84666119-84666141 AGCCCTGCTCACAGGCTGCCTGG - Intergenic
1120842309 14:89096841-89096863 TGCCTTGGGTATAGACTGCCAGG + Intergenic
1121025566 14:90613708-90613730 TGCCGGGCCCTTAGGCTGCCAGG + Intronic
1121529070 14:94640041-94640063 TGCTCTTGCCATTGGCTGCCCGG - Intergenic
1121848479 14:97196650-97196672 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1122807962 14:104270225-104270247 TCCCCTGGCCGTGGGGTGCCGGG - Intergenic
1122875475 14:104662350-104662372 TCCCCTGGCCGTGGGGTGCCGGG + Intergenic
1123627633 15:22238651-22238673 TGCCCGGGGCACAGGCTGCCCGG + Intergenic
1125247066 15:37652907-37652929 AGCCCTGGTCACTGGCTGCCTGG + Intergenic
1125381434 15:39091550-39091572 TGAGCTGAACATAGGCTGCCAGG - Intergenic
1126068927 15:44848746-44848768 TGCACTTGCCACAGACTGCCAGG + Intergenic
1126089895 15:45042028-45042050 TGCACTTGCCACAGACTGCCAGG - Intronic
1126184868 15:45821922-45821944 AGCCCTGGTCACAGGCTGCCTGG - Intergenic
1127694636 15:61433256-61433278 AGCCCTGCTCATTGGCTGCCTGG - Intergenic
1127774287 15:62253386-62253408 TGCCCAGGCCTTGGGCTGCTAGG + Intergenic
1128699612 15:69794745-69794767 TGCCCTGGCCACACACTTCCTGG + Intergenic
1129151528 15:73691584-73691606 TGCCCAGGCCCTAGGCTGGGAGG + Intronic
1130298874 15:82665510-82665532 TGCCAAGGCCACAGGCTACCAGG - Exonic
1130938946 15:88491935-88491957 TGCCCTGGTCATAGGCTGTGGGG + Intergenic
1131089835 15:89615352-89615374 TGCCCTGTCCAGAGGCTGCTGGG + Intronic
1131172021 15:90185252-90185274 TGCCATGGCAACAGGCTCCCCGG - Intronic
1132009619 15:98265049-98265071 GACCCTGGCCATGGGCTTCCTGG + Intergenic
1133825290 16:9272958-9272980 GGACCAGGCCACAGGCTGCCTGG - Intergenic
1134485677 16:14656506-14656528 GGCCCTGGCACTAGCCTGCCTGG + Intronic
1135561437 16:23479756-23479778 TGCCCTCACCCAAGGCTGCCAGG + Exonic
1135883277 16:26279827-26279849 AGCCCTGGCCACCAGCTGCCTGG - Intergenic
1137677716 16:50311920-50311942 TCCCCTGGCCAGAGGCTCCAAGG + Intronic
1137829345 16:51528640-51528662 TGCCCTGGCCTTATCCTGGCAGG + Intergenic
1139337885 16:66245751-66245773 TGCCATGGCCAGAGGTTCCCGGG + Intergenic
1141146519 16:81534117-81534139 CAGCCTGGCCACAGGCTGCCCGG - Intronic
1141174076 16:81707930-81707952 GGCCCCGGCCAAGGGCTGCCGGG - Intronic
1141627292 16:85268029-85268051 GGCACTGCCCAGAGGCTGCCAGG + Intergenic
1141976324 16:87518706-87518728 TGACCGGGGCACAGGCTGCCCGG - Intergenic
1143216491 17:5229039-5229061 TGCGCTGGCCATTGGCTACTGGG + Intronic
1143514844 17:7414435-7414457 TGACGTTGCCATAGGCAGCCAGG - Exonic
1144785971 17:17831789-17831811 TGCCCTGGCTATAGTGTCCCTGG - Intronic
1146328813 17:31910463-31910485 TGCCCTGGCTATTCCCTGCCTGG + Intergenic
1146692668 17:34887516-34887538 TGCCCTGTCCAGGGGCTGCAAGG + Intergenic
1147155569 17:38543044-38543066 TGGCCTGGTCAGAGGCTGCAGGG - Intronic
1148072007 17:44914024-44914046 TGACCTGTCTATAGGCAGCCAGG + Exonic
1148496658 17:48056981-48057003 TGACCTGGGCCTTGGCTGCCTGG - Intronic
1149013919 17:51886477-51886499 TGCACTGGCAATAAGCTCCCAGG + Intronic
1149647672 17:58252109-58252131 TGCCCTGGGGAGAGGTTGCCAGG + Intronic
1150594448 17:66591750-66591772 AGCTCTGGACATAGGCTTCCAGG - Intronic
1151031146 17:70741329-70741351 TGACCTGACAATAGGCTACCAGG - Intergenic
1151078760 17:71304518-71304540 AGCCCTGGTCACTGGCTGCCTGG + Intergenic
1151539638 17:74758459-74758481 TGCGCTGCCCATCGGCTGCATGG + Intronic
1151655266 17:75492875-75492897 TGCCCTGGCAATACCCTGCCAGG - Intronic
1151815489 17:76469553-76469575 TGCCCTGACCACAGGCACCCAGG + Intronic
1151958910 17:77394755-77394777 TGCTCTGACCACAGGCTGCCTGG - Intronic
1152582567 17:81173046-81173068 TCCCCTGGCCACGGGCTGTCTGG - Intergenic
1152665897 17:81569330-81569352 TGCACAGGCCGGAGGCTGCCCGG - Intronic
1152756729 17:82090171-82090193 TGCCTAGGCCCAAGGCTGCCAGG + Intronic
1153772128 18:8424752-8424774 AGCCCTGGCCACACGCTGCTTGG + Intergenic
1154089970 18:11349230-11349252 AGCCCAGGTCATCGGCTGCCTGG + Intergenic
1156607162 18:38680023-38680045 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1157092326 18:44650717-44650739 AGATCTGGCCATAGGCTGCCAGG - Intergenic
1158499600 18:57988257-57988279 TGGCCTGGCCATTGCCTGCTTGG + Intergenic
1159103272 18:63978419-63978441 TGCCCTGGCCATGGTCTTCATGG + Exonic
1159838413 18:73369192-73369214 TGCCCTGGTCATTTGCTGCCTGG + Intergenic
1161579177 19:5071337-5071359 GGGCCTGGTCAAAGGCTGCCAGG + Intronic
1162095239 19:8306311-8306333 TGCCCTGGGTTTAGGCGGCCAGG - Intronic
1162860899 19:13505535-13505557 TGCCCTGGCCAGAAGCGCCCAGG + Intronic
1163835868 19:19573554-19573576 TGCCATGGACATTCGCTGCCTGG - Intronic
1165427309 19:35753277-35753299 TGCCCTGGCACCAGGCTGCTGGG - Intronic
1166377398 19:42335251-42335273 TGCCCTGGCCATAGGCTGCCGGG - Intronic
1167977535 19:53242411-53242433 TGCTCTGTCCACAGGCTGCAAGG + Intronic
1202639640 1_KI270706v1_random:70134-70156 TGACCTAGCCATAGGAAGCCTGG - Intergenic
1202711658 1_KI270714v1_random:22549-22571 TTCCCTGGCCCTAGGCCACCAGG - Intergenic
925158066 2:1662330-1662352 TGCCCTGTGCAGAGGCTGCTGGG - Intronic
925294991 2:2770263-2770285 GGCTCTGGGCACAGGCTGCCCGG + Intergenic
925575339 2:5354573-5354595 TGCCTTTGCGATTGGCTGCCTGG + Intergenic
926159012 2:10475008-10475030 TGCGCTGGCCTTCGGCTGACTGG + Intergenic
926314177 2:11697367-11697389 TGCACTGGCCACAGGCCACCAGG - Intronic
927026539 2:19074010-19074032 TGCCTTGGCCAAAGGCTCCTAGG + Intergenic
927071553 2:19536169-19536191 AGCCCTGGTCACTGGCTGCCCGG + Intergenic
928472688 2:31589879-31589901 AGCCCTGCTCAAAGGCTGCCTGG + Intergenic
928783117 2:34848773-34848795 AGCCCTGGCCATCAGCTGCCTGG - Intergenic
929439821 2:41956557-41956579 CGCCCTGGCCTGAGGCTACCAGG + Intergenic
929967282 2:46544531-46544553 AACCCTGGCCAGAGGCTGCAGGG - Intronic
930030801 2:47056975-47056997 TGCCCTGGCCAGGGGATGCTGGG + Intronic
931463785 2:62469834-62469856 TCTCCTGGCCATTGGCTGCCTGG + Intergenic
932468126 2:71936517-71936539 TGGCCTGGCCTTCGGCTCCCAGG + Intergenic
932490100 2:72114871-72114893 TGCCCTGGAGCAAGGCTGCCTGG + Intergenic
933416947 2:81998376-81998398 GGCCCTGGCCAATGGTTGCCTGG - Intergenic
933780143 2:85795586-85795608 TGCCCTGGCGAGTGGCTGCAGGG + Intergenic
935237172 2:101149360-101149382 AGAGCTGGCCATAGGATGCCTGG - Intronic
936259657 2:110947895-110947917 GGCCCTGGCCATGGGCATCCGGG - Intronic
936536831 2:113318755-113318777 TTCACTGGCCACAGGTTGCCTGG + Intergenic
937991126 2:127663169-127663191 TGCCCTGGCCACTCGCAGCCTGG + Intronic
938080516 2:128367618-128367640 TGCCCTGCACAGGGGCTGCCCGG + Intergenic
938100704 2:128496221-128496243 TGGCAGGGCCATAGGATGCCTGG + Intergenic
938564286 2:132503976-132503998 AGCCCTGGTCATCAGCTGCCTGG - Intronic
938674179 2:133614221-133614243 AGCCCTGGTCACCGGCTGCCAGG + Intergenic
939149433 2:138455912-138455934 AGCCCTGCTCACAGGCTGCCTGG + Intergenic
940340095 2:152571109-152571131 TGCCCCTGCCAGAGGCTGCCAGG - Intronic
941738391 2:169005581-169005603 AGCCCTGGTCACTGGCTGCCTGG - Intronic
943204497 2:184875877-184875899 TGAATTGCCCATAGGCTGCCAGG - Intronic
944802295 2:203248197-203248219 TGCCCTGTCCCCTGGCTGCCTGG - Intronic
945377335 2:209094371-209094393 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
945644936 2:212479335-212479357 TGCCCTGGTCATAGCCTGGGTGG - Intronic
946357714 2:219198995-219199017 TCCCCAGGCCAGAGGCTGCAGGG - Intronic
946935586 2:224717082-224717104 TTGCCTGGGCAAAGGCTGCCAGG + Intergenic
948118520 2:235511542-235511564 TGCCCTGAGCTCAGGCTGCCAGG - Intronic
948551260 2:238774420-238774442 TGGCCTGGCCAGATGCTGCAGGG + Intergenic
948564658 2:238876219-238876241 TGCCCTCTGCAGAGGCTGCCTGG - Intronic
948794867 2:240397364-240397386 TGCCCTGGCCCTGGCCAGCCTGG - Intergenic
948927917 2:241111194-241111216 TGCCCTGGCCTCAGGCCACCAGG + Intronic
1169149227 20:3276266-3276288 TGCCATGGGCATGGGCTGTCTGG - Intronic
1169379815 20:5096632-5096654 TGGCCTGGGCAGAGGGTGCCAGG + Intronic
1169972119 20:11279299-11279321 TGCCCTTTGCAGAGGCTGCCAGG + Intergenic
1170727647 20:18943858-18943880 AGCCCTGGCCACTGGCTGCCTGG - Intergenic
1171038720 20:21739825-21739847 AGCCCTGCTCATTGGCTGCCTGG - Intergenic
1172099766 20:32478086-32478108 GGCTCTGGGCACAGGCTGCCTGG - Intronic
1172502346 20:35436398-35436420 TGCTCTGGTCCTAGGCTGGCAGG - Intronic
1172838174 20:37886353-37886375 TGCCCTGGCCCGTGGCAGCCTGG - Intergenic
1172851483 20:37969356-37969378 GGCCCTGGTCACCGGCTGCCTGG - Intergenic
1173961451 20:47075495-47075517 TGCACTGGCCATACACAGCCAGG + Intronic
1174552021 20:51368955-51368977 AGCCCTGCCCATGGGATGCCTGG - Intergenic
1175165911 20:57044405-57044427 TGTCCTGGGCTTAGGCAGCCAGG + Intergenic
1175460530 20:59148983-59149005 AGCCCTGGCCAGAGGCTGTGAGG + Intergenic
1175818623 20:61896553-61896575 TGCCCTGGCCGCTTGCTGCCTGG - Intronic
1175949069 20:62572924-62572946 TGGCCTGGCCATTGGCAGCAGGG + Intergenic
1176141641 20:63547561-63547583 TGCCCTGGCCGTGGGGTGACAGG + Intergenic
1178275986 21:31237299-31237321 TGCCCTGGACAAGGGCAGCCAGG - Intronic
1178851828 21:36218771-36218793 TGCCCTGCCCATCCCCTGCCTGG + Intronic
1179820510 21:43934397-43934419 TCCCCAGGCCGTCGGCTGCCTGG + Intronic
1181061255 22:20283143-20283165 TCCCCAGGACATGGGCTGCCTGG - Intronic
1181711589 22:24695064-24695086 TGCCCTGGACATAGGAACCCAGG + Intergenic
1182091809 22:27601051-27601073 TGCCCTGGCCATGGACAGCAGGG + Intergenic
1182283908 22:29232853-29232875 TGACCTGCCCATGGGCTGCCAGG + Intronic
1182359451 22:29738148-29738170 GGCCCTGGCCAGAGGCTGAGGGG - Intronic
1182753689 22:32661341-32661363 AGCCCTGGCCAAAGTCAGCCCGG + Intronic
1183537895 22:38413688-38413710 TCCCCTCCCCAAAGGCTGCCAGG + Intergenic
1183784606 22:40022130-40022152 GGCCCCGGCCATTAGCTGCCTGG + Intronic
1184038266 22:41928719-41928741 TGCCCTGCCCATCCGCAGCCCGG - Intergenic
1184089251 22:42283715-42283737 TGCCCTGGCCCGAGGCTCCCCGG - Intronic
1184592187 22:45492416-45492438 TGCCCTGGATATAAGCTCCCGGG + Intergenic
1185249209 22:49790924-49790946 TGCCCTTGCCAGAGGCTCCGGGG - Intronic
950112443 3:10428117-10428139 TGCCCAGGCCATACGCAGCAAGG - Intronic
950151170 3:10688676-10688698 TCCGCTGGCCATAGGAGGCCTGG - Intronic
950426769 3:12928531-12928553 TGCCCTGGCCGTCTGCTGTCAGG - Intronic
950554526 3:13687219-13687241 AGCCCTGGGCAGAGGCTGCCAGG - Intergenic
951613687 3:24520175-24520197 TGCTCTGGCCAGAGGCTTCCTGG + Intergenic
951900106 3:27648538-27648560 TTTCCAGGCAATAGGCTGCCTGG - Intergenic
952082828 3:29781744-29781766 AGCCCTGGTCACTGGCTGCCTGG + Intronic
952942135 3:38453624-38453646 TGCAGTGGCCACAGGCTCCCGGG + Intergenic
953691009 3:45119457-45119479 TTCCCAGGCCATCAGCTGCCCGG - Intronic
954408515 3:50358928-50358950 CGCCGTGGACACAGGCTGCCTGG - Exonic
954974108 3:54676622-54676644 TGCCCTTCCCATAGGCTGGCAGG + Intronic
959523371 3:107346172-107346194 TGGCCTGGCCAGGGGCAGCCAGG - Intergenic
961501466 3:127338609-127338631 TCCTCTGTCCACAGGCTGCCAGG + Intergenic
961557857 3:127708848-127708870 GGCCATGGCCATGGGCTGCGTGG + Intronic
961765263 3:129205573-129205595 TGCCCTGCACATACTCTGCCTGG + Intergenic
962685839 3:137846879-137846901 GGCCTTGGCCATTGGATGCCAGG - Intergenic
962741895 3:138368003-138368025 CGCCCAGGCCACAGGCTGCATGG - Intronic
964794016 3:160478598-160478620 AGCCCTGGTCACCGGCTGCCTGG + Intronic
965296690 3:166955877-166955899 AGCCCTGGTCACCGGCTGCCTGG - Intergenic
966229959 3:177640957-177640979 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
966862500 3:184238439-184238461 TGTCCAGCCCATGGGCTGCCAGG + Exonic
968611726 4:1560212-1560234 TGCCATGTCCTAAGGCTGCCGGG - Intergenic
968690369 4:1986969-1986991 AGCCCTGGCCCTGGGATGCCTGG + Intronic
973676086 4:53264179-53264201 AGCCCTGGTCACTGGCTGCCTGG - Intronic
975203059 4:71614597-71614619 AGCCCTGGTCATTTGCTGCCTGG + Intergenic
981167585 4:141580617-141580639 AGCCCTGGTCACTGGCTGCCTGG + Intergenic
984278755 4:177641400-177641422 TGCCCTTGCCAGATGCTGCGAGG + Intergenic
986059242 5:4172569-4172591 GGCCCGGGCCACAGGCTTCCAGG - Intergenic
989431592 5:41361285-41361307 AGCCCTGGGCATTGGCTGCCTGG - Intronic
989562832 5:42871108-42871130 AGCCCTGGGCATCGGCTGCCTGG - Intronic
995571885 5:113489434-113489456 TGCTCTGGAGTTAGGCTGCCCGG - Intergenic
996875411 5:128235363-128235385 AGCCCTGGTAATTGGCTGCCTGG - Intergenic
997305938 5:132836509-132836531 TGACCTGGACTAAGGCTGCCAGG - Intergenic
997533237 5:134595670-134595692 TGCCCTTGCCATCTGCTGCCAGG + Intergenic
997791824 5:136768967-136768989 TGCCCTGTCCCTTGGCTGCTAGG - Intergenic
997885959 5:137630177-137630199 AGCCCTGGCCTCAGGCTCCCAGG - Intronic
999302654 5:150500707-150500729 TGACCTGGCCACAGGCTGAGGGG + Intronic
999709149 5:154300955-154300977 TGGCCTGGCCAGAGGCCTCCAGG + Intronic
1002330317 5:178436332-178436354 TGACCTGGACACCGGCTGCCTGG - Intronic
1003058122 6:2841435-2841457 CGGCCTGGCCCTGGGCTGCCTGG + Intronic
1003072995 6:2959203-2959225 TGCCCTGGCCATGGTCTACATGG - Exonic
1004888493 6:20074652-20074674 AGCCCTGGTCATCGGATGCCTGG + Intergenic
1011225163 6:85097112-85097134 AGCCCTGACCACTGGCTGCCTGG + Intergenic
1015852567 6:137589159-137589181 TGCCCTAGCCATTTGCTGCAGGG + Intergenic
1016647185 6:146424013-146424035 TGCTCAGCCCACAGGCTGCCAGG + Intronic
1016882409 6:148923774-148923796 TGCCCTGGACAAAGGCCCCCAGG - Intronic
1019180734 6:170186162-170186184 TGCCATGGTCTCAGGCTGCCGGG + Intergenic
1019331577 7:463112-463134 TGGCCTGGCCCGGGGCTGCCTGG - Intergenic
1019491256 7:1314633-1314655 AGCCCTGGCCTTGCGCTGCCTGG + Intergenic
1019665935 7:2252387-2252409 GGCCCTGGCCCTGTGCTGCCCGG - Exonic
1022042731 7:26595813-26595835 TGCCCAGGACATAGGCAGGCAGG + Intergenic
1022473262 7:30694568-30694590 TGTCCTGGGCCCAGGCTGCCAGG + Intronic
1022517442 7:30984834-30984856 TGACTTGGCCACAGGATGCCTGG + Intronic
1022525881 7:31037009-31037031 TGACCTGGCCACAGGCTGACAGG - Intergenic
1024688718 7:51776320-51776342 TGCCCGGCTCAGAGGCTGCCTGG + Intergenic
1027195472 7:76027165-76027187 GGTCCTGGGCAAAGGCTGCCAGG + Intronic
1028822527 7:95229375-95229397 AGCCCTGGTCATAAGCTGCCTGG + Intronic
1029112202 7:98218105-98218127 GGGCCTGGCCACCGGCTGCCGGG - Intronic
1030533429 7:110737287-110737309 AGCCCTGGTCACTGGCTGCCTGG + Intronic
1031344372 7:120647261-120647283 TGCACTAGCAACAGGCTGCCTGG + Intronic
1032018041 7:128392243-128392265 TGCCCTGTCCATTGGGTGGCTGG - Intergenic
1032390398 7:131552123-131552145 AGCCCTGGCTTTAGGCTCCCTGG - Intronic
1033026785 7:137782205-137782227 AGCCCTGGTCACTGGCTGCCTGG + Intronic
1034337994 7:150335699-150335721 GGGCCTGGCCAAAGTCTGCCAGG + Intronic
1035083575 7:156237180-156237202 TGCCCGGGCACCAGGCTGCCAGG + Intergenic
1035291859 7:157844352-157844374 TGCCCAGGCCTTCAGCTGCCTGG - Intronic
1035588490 8:795200-795222 TGCCCTGGCTAGAGGCTTGCAGG - Intergenic
1039914948 8:41852810-41852832 TGCCCTGGCCATCAAGTGCCTGG + Intronic
1040277291 8:46020582-46020604 GGCCCTGCCTAGAGGCTGCCAGG + Intergenic
1041023985 8:53665746-53665768 TGACCTCGCCATAGGCTTGCAGG + Intergenic
1041373895 8:57193235-57193257 ACCCCTGGCCAGATGCTGCCGGG + Intergenic
1041662441 8:60413094-60413116 TGCCCCTGCCCTGGGCTGCCTGG - Intergenic
1041719331 8:60962028-60962050 TACCTTTGCCATAGGCTGCTGGG + Intergenic
1042645575 8:70982568-70982590 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1043556798 8:81439477-81439499 AGCCCTGGTCACAGGCTTCCTGG - Intergenic
1043876471 8:85491887-85491909 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1043987770 8:86714754-86714776 AGCCCTGGTCACTGGCTGCCTGG + Intronic
1045254231 8:100506243-100506265 TGCCCTGGCAATGGTCTGCAAGG + Intergenic
1048044656 8:130761743-130761765 TGCTCTGGCCAACTGCTGCCAGG + Intergenic
1048531163 8:135251668-135251690 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1049040633 8:140110115-140110137 TCCCCTGACCCTAGACTGCCAGG + Intronic
1049107149 8:140621248-140621270 TGCTGCGGCCAGAGGCTGCCAGG - Intronic
1049169377 8:141149575-141149597 CGCCTTGGCCCTAAGCTGCCGGG - Intronic
1049234523 8:141505871-141505893 TGCCCTGGCCCTGAGATGCCAGG - Intergenic
1050400415 9:5247856-5247878 AGCCCTGGTCACCGGCTGCCTGG + Intergenic
1051777111 9:20646957-20646979 TGCCGTGGCTATTGTCTGCCCGG - Intergenic
1053352838 9:37424738-37424760 GGCCCTGGCCTCAGGCTGCCCGG - Intronic
1054785671 9:69207817-69207839 ATCCCTGGGCACAGGCTGCCAGG - Intronic
1054892268 9:70263725-70263747 TACCCTGGCCTCAGGCTCCCTGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1056796163 9:89660257-89660279 TGCCCTGACCCAAGGCTGCATGG + Intergenic
1056804620 9:89718893-89718915 TGCCCTGCCCACTGGCTTCCTGG + Intergenic
1057024599 9:91725467-91725489 TGCCCCGGACATACCCTGCCAGG + Intronic
1057220783 9:93256734-93256756 TGCCCTGGCTCCAGGCTGGCTGG + Intronic
1057282591 9:93723454-93723476 TGCCCTGACCCCAGGCTTCCTGG - Intergenic
1058687669 9:107491900-107491922 GGCTCTGGCCAAGGGCTGCCAGG + Intergenic
1059424294 9:114211090-114211112 TGCCCTGGCCACCTGCTGCCTGG + Intronic
1060397261 9:123325011-123325033 TGCCCTGGCCCTGGGAGGCCTGG + Intergenic
1060627411 9:125126281-125126303 GGCCCTCCCCATGGGCTGCCTGG + Intronic
1061064456 9:128268676-128268698 TGCCCAGGCCTTGGGCTGCTAGG + Intronic
1061421023 9:130472874-130472896 TGCAGAGGCCATAGGCTGCTTGG - Intronic
1061859567 9:133460899-133460921 GACCCTGACCTTAGGCTGCCAGG + Intronic
1062033996 9:134374641-134374663 TGGCCAGGCCAGCGGCTGCCTGG + Intronic
1062158684 9:135067989-135068011 TGCCCTGCCCTGAGGCTGCTTGG - Intergenic
1062713532 9:137990066-137990088 AGCCCTGGGCACTGGCTGCCTGG + Intronic
1185702716 X:2243193-2243215 TGCTCTGGGCGTAGGCTGCGTGG + Exonic
1185747486 X:2584274-2584296 TGCCCGGGACAGACGCTGCCTGG + Intergenic
1189278380 X:39803822-39803844 TGCCCTGCCCACAGCCTGCAGGG - Intergenic
1190158060 X:48009461-48009483 GGCCCAGGCCATGGGCAGCCAGG + Intronic
1190173831 X:48132345-48132367 GGCCCAGGCCATGGGCAGCCAGG + Intronic
1192196812 X:69034097-69034119 TGCCATGGCAATGGCCTGCCAGG - Intergenic
1192609581 X:72554436-72554458 AGCCCTGGTCACTGGCTGCCTGG + Intronic
1192748496 X:73963812-73963834 TCCCCTGGCGTTAGGCTGCTTGG + Intergenic
1193817582 X:86122364-86122386 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1194380889 X:93190643-93190665 AGTCCTGGCCACTGGCTGCCTGG + Intergenic
1194470285 X:94285510-94285532 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1194601245 X:95924086-95924108 AGCCCTGCTCATTGGCTGCCTGG + Intergenic
1195680913 X:107545871-107545893 GCCCCTGGCCATAATCTGCCTGG + Intronic
1196414275 X:115454446-115454468 GTCCCTGGACACAGGCTGCCTGG - Intergenic
1197034695 X:121859561-121859583 AGCCCTGGCCACTGGCTGCCTGG - Intergenic
1197081801 X:122426674-122426696 AGCCCTGGCCACTGGCTGACTGG - Intergenic
1197364259 X:125544757-125544779 TGCCCTGCCCACCAGCTGCCTGG + Intergenic
1197393371 X:125895816-125895838 AGCCCTGGTCACTGGCTGCCTGG - Intergenic
1199014998 X:142804647-142804669 GGCCCTGGTCACTGGCTGCCTGG - Intergenic
1200083528 X:153591547-153591569 GGCCCTGGCCCTGGGCTGCCTGG - Intronic
1201273006 Y:12273625-12273647 TCACCTGGCCTTAGGCAGCCTGG - Intergenic
1201730033 Y:17192969-17192991 TGCCCTGGCCCCAGGCCTCCTGG - Intergenic