ID: 1166380307

View in Genome Browser
Species Human (GRCh38)
Location 19:42352201-42352223
Sequence GTCCCCCTGTAGGCACCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166380307_1166380313 -2 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380313 19:42352222-42352244 ACTTCTCAGGGCCCCTCGGTGGG 0: 1
1: 0
2: 2
3: 4
4: 85
1166380307_1166380323 22 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380323 19:42352246-42352268 GTAACTGCTCCCTGTGGGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 203
1166380307_1166380324 23 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380324 19:42352247-42352269 TAACTGCTCCCTGTGGGTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 207
1166380307_1166380326 27 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380326 19:42352251-42352273 TGCTCCCTGTGGGTGGGGGAGGG 0: 1
1: 1
2: 9
3: 114
4: 804
1166380307_1166380322 21 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380322 19:42352245-42352267 GGTAACTGCTCCCTGTGGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 158
1166380307_1166380320 17 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380320 19:42352241-42352263 TGGGGGTAACTGCTCCCTGTGGG 0: 1
1: 0
2: 0
3: 15
4: 112
1166380307_1166380325 26 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380325 19:42352250-42352272 CTGCTCCCTGTGGGTGGGGGAGG 0: 1
1: 0
2: 8
3: 84
4: 773
1166380307_1166380321 20 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380321 19:42352244-42352266 GGGTAACTGCTCCCTGTGGGTGG 0: 1
1: 0
2: 1
3: 11
4: 133
1166380307_1166380319 16 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380319 19:42352240-42352262 GTGGGGGTAACTGCTCCCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 177
1166380307_1166380311 -6 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380311 19:42352218-42352240 GGGGACTTCTCAGGGCCCCTCGG 0: 1
1: 0
2: 0
3: 23
4: 225
1166380307_1166380314 -1 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380314 19:42352223-42352245 CTTCTCAGGGCCCCTCGGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 161
1166380307_1166380315 0 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380315 19:42352224-42352246 TTCTCAGGGCCCCTCGGTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 151
1166380307_1166380312 -3 Left 1166380307 19:42352201-42352223 CCTGCAGGTGCCTACAGGGGGAC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1166380312 19:42352221-42352243 GACTTCTCAGGGCCCCTCGGTGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166380307 Original CRISPR GTCCCCCTGTAGGCACCTGC AGG (reversed) Exonic
900332396 1:2142490-2142512 TTGCCCCAGTCGGCACCTGCTGG - Intronic
902082865 1:13833227-13833249 ATCCCTGTGAAGGCACCTGCAGG + Intergenic
902172178 1:14620998-14621020 CTCCCCATGTAGGAACTTGCTGG + Intronic
902609837 1:17590511-17590533 GTCCCCATAGAGGCAACTGCTGG - Intronic
903512030 1:23883360-23883382 GCCTCCCTGGACGCACCTGCAGG - Intronic
905168470 1:36097194-36097216 GGCTCCCTGATGGCACCTGCTGG - Exonic
918641941 1:186852120-186852142 GTCCCTGTGTAGGCACATGTGGG - Intronic
920256784 1:204660887-204660909 GTCCCTCTGTAGACAGCTACTGG - Intronic
922721615 1:227902836-227902858 GTCCCACTGTGGGCACCAGTGGG + Intergenic
1062983752 10:1747366-1747388 GGCCCCATGTGGGCACCTGGAGG - Intergenic
1067055166 10:43045794-43045816 GCCACCCTGCAGGCATCTGCTGG - Intergenic
1069870576 10:71530347-71530369 GCCCCACTGTGGGCACCGGCAGG - Intronic
1070932962 10:80273735-80273757 CTCACCCTGGAGGCACCTGGTGG - Exonic
1072546922 10:96447167-96447189 GTCCCCGTCTAGGCTCCTTCTGG - Intronic
1073118807 10:101108684-101108706 CATCCCCTGTTGGCACCTGCTGG - Intronic
1074281453 10:112055443-112055465 GGCCCTTTGTAGGCACCTGATGG - Intergenic
1074852207 10:117448021-117448043 GTCTCCCTGTGGGCACCTGAGGG + Intergenic
1074880454 10:117653087-117653109 GTACCCCTGAAGACACATGCTGG + Intergenic
1076994119 11:290006-290028 GTCCGGCTGGAGGCCCCTGCAGG + Exonic
1077034891 11:489826-489848 GTCCGCCTGGAGGACCCTGCGGG + Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1083804968 11:65067970-65067992 GTGCCCATGCAGGCACATGCAGG - Intronic
1084668757 11:70592811-70592833 GTCCCTCTGCATGCACCTTCAGG + Intronic
1085283124 11:75343741-75343763 GGCCTCCTCTGGGCACCTGCAGG - Intronic
1088522198 11:110712192-110712214 GTCCCCCTAGAGTCTCCTGCTGG + Exonic
1088587321 11:111370538-111370560 CTCACTCTGTTGGCACCTGCAGG - Intronic
1090808143 11:130215659-130215681 GCCCCTCTGCAGGCACCTCCTGG - Intergenic
1090953182 11:131492065-131492087 GTCACTCTGCTGGCACCTGCTGG + Intronic
1091783892 12:3230845-3230867 GCCCCCCTGGAGACCCCTGCAGG + Intronic
1101940110 12:109093554-109093576 GGCCCCCTGGTGCCACCTGCTGG + Intronic
1102469506 12:113151820-113151842 GTGCCCCATTAGCCACCTGCTGG - Intronic
1102542886 12:113635072-113635094 GGGGCCCTGTAGGCACCTGCTGG + Intergenic
1103939342 12:124493329-124493351 GTTCCCCTCTGGGCAGCTGCAGG + Intronic
1104961273 12:132489736-132489758 GCCCCTCCGTGGGCACCTGCGGG - Exonic
1106081946 13:26507604-26507626 ATCCCCTTGTAGGGCCCTGCTGG - Intergenic
1112200256 13:97267851-97267873 GTCCACCTGGAGTTACCTGCAGG - Intronic
1112330781 13:98475630-98475652 GTCGCCCTGTGGTCAGCTGCAGG - Intronic
1113054812 13:106256748-106256770 GGCCCCCTGTAGAGACCTACAGG - Intergenic
1118318104 14:64737789-64737811 GTCCTCCTGCAGGCAGCTGCGGG - Intronic
1122121209 14:99554424-99554446 GTCCCTCTGCAGGCTCCTGCAGG + Intronic
1124646827 15:31442818-31442840 GTCCCCCTGCAGGCACAGGGTGG - Intergenic
1125928271 15:43581373-43581395 GCCCCACTGTATACACCTGCAGG + Exonic
1125941437 15:43681208-43681230 GCCCCACTGTATACACCTGCAGG + Intergenic
1126229070 15:46304507-46304529 CTCCCCCTGTTGGCAGCTCCAGG - Intergenic
1127735018 15:61831780-61831802 GGCACCCTGTAAGCATCTGCTGG - Intergenic
1128269606 15:66297103-66297125 GTCAACCTGAAGGCACCTGCTGG - Intronic
1129137116 15:73564342-73564364 GTCTCAGTGTAGGCATCTGCAGG + Intronic
1129325543 15:74798556-74798578 GGCCCCCTCCAGCCACCTGCTGG - Intronic
1130776368 15:86988149-86988171 GTCCCAATGTAGTCACATGCAGG - Intronic
1131449555 15:92528039-92528061 GACACCCTGTAGGCCCCTCCTGG + Intergenic
1132627301 16:897590-897612 GTGCCCCTGTGAGCAGCTGCAGG + Intronic
1135741630 16:24980351-24980373 GCCACCCTGTAGGCATCTCCAGG - Intronic
1137776466 16:51058695-51058717 TTCCCACTGTCAGCACCTGCAGG - Intergenic
1138193731 16:55036793-55036815 GTGGCCCTGTAGGCTCCTGAAGG + Intergenic
1139446278 16:67000631-67000653 GGACTCCTGCAGGCACCTGCGGG - Exonic
1140971711 16:80019867-80019889 GACCCCCTGTAGACCCTTGCTGG + Intergenic
1141206485 16:81936931-81936953 GTCCCCGTGGAGGCACATGTAGG + Intronic
1141665170 16:85462196-85462218 GTCCCCCTGCAGTCTCCTCCTGG + Intergenic
1142643590 17:1298827-1298849 CTCCCCCGGCAGGCACCTGTGGG + Exonic
1144019142 17:11224411-11224433 GTGCTCCTGTGGGCAACTGCAGG + Intergenic
1144663255 17:17085198-17085220 CTCCCTGTGTAGGCACCTCCCGG + Intronic
1147217263 17:38908176-38908198 GGCCCCCTGCTGGCACCTTCGGG + Intronic
1148796385 17:50199317-50199339 CTCCCCCTGCAGGGACCCGCAGG - Exonic
1149560231 17:57603324-57603346 GTCCCCAAGTCGGGACCTGCTGG + Intronic
1151747189 17:76017973-76017995 GACCCTCTGTGGGCACCTGGTGG - Intronic
1152205039 17:78970091-78970113 GTCCCCAGGGAGGCACCTGCTGG - Intergenic
1152331732 17:79677548-79677570 GTCCCACTGAAGACACCTGCCGG - Intergenic
1152466976 17:80471934-80471956 GTACCCCTGTACTCACCAGCTGG - Intronic
1152934947 17:83131126-83131148 GTGGCCCTGTAGGGTCCTGCTGG + Intergenic
1154323451 18:13372594-13372616 GTCACCCTGGAGGAACCTCCAGG - Intronic
1155003359 18:21706804-21706826 GCCCCACTGTGGGCTCCTGCGGG + Intronic
1155210818 18:23599724-23599746 GTCAGGCTGTAGGCACCTGTGGG + Exonic
1155976842 18:32140234-32140256 CTCCACCTGCAGGCCCCTGCGGG + Intronic
1160310490 18:77785643-77785665 CTCCCCCTGGAGACCCCTGCAGG + Intergenic
1161297765 19:3528242-3528264 GTCTCCCTGTAGGGACTAGCAGG - Intronic
1161328020 19:3672766-3672788 CAGCCCCTGTGGGCACCTGCAGG + Intronic
1163752044 19:19083896-19083918 ATGCCCCTGCAGGCACCTCCTGG + Intronic
1163752064 19:19083956-19083978 GTGCCCCTGCAGGCACCTTCAGG + Intronic
1163752081 19:19084016-19084038 ATGCCCCTGCAGGCACCTCCAGG + Intronic
1163752099 19:19084076-19084098 GTGCCCCTGCAGGCACCTCCAGG + Intronic
1163799925 19:19358371-19358393 CTGTCCCTGTAGTCACCTGCCGG + Exonic
1165153973 19:33776686-33776708 GTCCCCCTGTGGGCCCCTCCGGG + Intergenic
1165450410 19:35879062-35879084 CTCTCCCTGCAGGCACCAGCTGG + Exonic
1165520599 19:36311228-36311250 GCCCTCCTGTGGGCACCTCCAGG - Intergenic
1165623472 19:37267356-37267378 GCCCTCCTGTGGGCACCTCCAGG + Intergenic
1166380307 19:42352201-42352223 GTCCCCCTGTAGGCACCTGCAGG - Exonic
1168078618 19:53993487-53993509 GACTCCCTGTAGGCACATTCTGG - Intronic
924959008 2:17248-17270 GAGCACCTGCAGGCACCTGCAGG - Intergenic
925359617 2:3268240-3268262 TTCCCTCTGAAGGCACCTGTGGG + Intronic
926615632 2:14994414-14994436 TTCAGGCTGTAGGCACCTGCTGG - Intergenic
932502433 2:72195194-72195216 GTCTTCCTCTAGGCACCAGCTGG - Intronic
933157037 2:78987967-78987989 GGCCTCCTGTAGGCACCAGGGGG - Intergenic
934717465 2:96552014-96552036 GTGCCCCTGTAGGCCTCTGGGGG - Exonic
935396855 2:102619179-102619201 GTCCCCTTGGAGGAGCCTGCGGG + Intergenic
939226929 2:139376568-139376590 GTGCCCATCTAGCCACCTGCTGG - Intergenic
1168748211 20:263234-263256 GATCCCTTTTAGGCACCTGCTGG - Intergenic
1170605877 20:17874794-17874816 GTCCTCCTTTAGCCAACTGCAGG - Intergenic
1170606139 20:17876279-17876301 TTCCCCCTGCAGGCATCTGAGGG - Intergenic
1172762838 20:37334041-37334063 GTCCCTCTGGGGGCACCTGCTGG - Intergenic
1174103284 20:48143746-48143768 GCCCCTCTTTGGGCACCTGCCGG + Intergenic
1175084563 20:56447620-56447642 GTCCACCTGGAGGGACTTGCAGG - Intronic
1176123085 20:63462795-63462817 GTCCCCCTCTAGGCTCCGTCGGG - Intronic
1178588926 21:33893013-33893035 GTCCCCCAGGAGGAAGCTGCAGG - Exonic
1178676947 21:34639095-34639117 GTGACCCTGTTGGAACCTGCTGG + Intergenic
1179558036 21:42193184-42193206 GCCCCCCTGGAGCCTCCTGCGGG - Intergenic
1181463752 22:23099860-23099882 GCCCCACTGGAGGCACCTGAGGG + Intronic
1181551249 22:23640086-23640108 GTCCCACTGTTGGAACCTGAAGG + Intergenic
1181797023 22:25318570-25318592 GTCCCACTGTTGGAACCTGAAGG - Intergenic
1184792682 22:46709511-46709533 GTCTCCCTGTCAGCACCTGGGGG + Intronic
1184873668 22:47258564-47258586 CTCCCCTTGTATCCACCTGCAGG + Intergenic
952652166 3:35739466-35739488 ATCCTCCTGTAGGAAGCTGCTGG - Exonic
954332255 3:49897318-49897340 GTCTGTCTGTAGGCACCAGCCGG - Exonic
956718548 3:72099011-72099033 GCCCCCCTGTTGGCTCCTTCAGG - Intergenic
963432760 3:145230647-145230669 GTCCCACAATAGGCATCTGCAGG + Intergenic
964475079 3:157090749-157090771 GTTCCCCAGTGGGCACCTCCAGG - Intergenic
966082879 3:176026333-176026355 GTTCCCATGTAGGAACATGCAGG - Intergenic
968334416 3:197900930-197900952 GTACCCCTGTGGACCCCTGCTGG - Intronic
968545093 4:1194317-1194339 GTCCCTCTATCGGGACCTGCGGG - Intronic
968746729 4:2364283-2364305 GTCCACCCACAGGCACCTGCAGG - Intronic
982242888 4:153318126-153318148 GTCCTCATGCAGGCACCTGGTGG + Intronic
985652711 5:1114364-1114386 AGCACCCTGTAAGCACCTGCGGG + Intergenic
985702032 5:1379248-1379270 GGCCCCCTGTGGGCACCTGGCGG + Intergenic
985933681 5:3078700-3078722 ATCCCCCTGAAGGTACCTCCTGG - Intergenic
986013453 5:3737685-3737707 GTTTCCCTTTAGGCACCAGCAGG + Intergenic
986402276 5:7394217-7394239 GTCCCCCTGAAGCCTCCTGTAGG - Intergenic
995351960 5:111187979-111188001 CTCTCCCCATAGGCACCTGCTGG + Intergenic
997529426 5:134572790-134572812 GTCCCACAGGAAGCACCTGCAGG - Intronic
997666010 5:135629996-135630018 GTCCATCTGTGTGCACCTGCTGG + Intergenic
997999630 5:138614639-138614661 AGCCCTCTGTAGGCACCTGTAGG - Intronic
999325439 5:150640805-150640827 TTCCCCCTGGATGCTCCTGCCGG - Intronic
1002181969 5:177435355-177435377 ATCCCCCGGTAGCCACCTGCAGG - Intronic
1003265138 6:4559135-4559157 GTCCCTCTGTTGGCATCTACAGG - Intergenic
1017816097 6:158017760-158017782 CTCCTCCTGCAGGAACCTGCAGG + Intronic
1019931151 7:4224125-4224147 GATCACCTGGAGGCACCTGCAGG - Intronic
1020139317 7:5604035-5604057 GTTCTCCTGTGGGCAGCTGCTGG + Intronic
1033638533 7:143237636-143237658 GTTCCCTGGTAGGCACATGCAGG + Intergenic
1034163297 7:149007743-149007765 GTCCCTCTGTAGCCCCCAGCTGG + Intronic
1035781178 8:2229369-2229391 GGCCTCCTGCAGGCACCTGCAGG + Intergenic
1036687695 8:10922952-10922974 CTCATCCTGTAGGCACCAGCTGG + Intronic
1049557783 8:143291604-143291626 GACCCCGGGTACGCACCTGCAGG - Exonic
1049745481 8:144261388-144261410 CTGACCCTGTAGGCACCCGCAGG + Intronic
1049769599 8:144373803-144373825 TTCCCCGGGCAGGCACCTGCCGG - Intronic
1049800910 8:144517190-144517212 GTGCCCCTGTTGTCTCCTGCAGG - Exonic
1049805461 8:144536778-144536800 GTGCCCCTGTAGCCTCCTGCTGG + Intronic
1053006280 9:34606942-34606964 TTCCTCCTGTAGGCCCCAGCTGG + Intergenic
1053527203 9:38842180-38842202 CTCCCCCTGAAGGCTCCAGCGGG - Intergenic
1054199426 9:62066611-62066633 CTCCCCCTGAAGGCTCCAGCGGG - Intergenic
1054638929 9:67521746-67521768 CTCCCCCTGAAGGCTCCAGCGGG + Intergenic
1054701540 9:68418134-68418156 GTCTTCCTATAGTCACCTGCTGG + Intronic
1057131298 9:92656191-92656213 GCCCTCCTGAAGGCTCCTGCTGG - Intronic
1060757264 9:126222966-126222988 GTCCCCCTCCAGGGCCCTGCCGG - Intergenic
1061964451 9:134005121-134005143 GTGCCCCAGGAGGGACCTGCTGG + Intergenic
1186000337 X:5002205-5002227 GTCCCCCTGGAAGCAGATGCTGG + Intergenic
1190012435 X:46796772-46796794 GGCCCCCTGCTGCCACCTGCTGG + Intergenic
1190222378 X:48520685-48520707 ATCCCCCTCTAGGCCCCAGCAGG - Exonic
1200008919 X:153107155-153107177 GTGCCCTTGTGGGCACCTCCTGG - Intergenic
1200030681 X:153292767-153292789 GTGCCCTTGTGGGCACCTCCTGG + Intergenic