ID: 1166381342

View in Genome Browser
Species Human (GRCh38)
Location 19:42356831-42356853
Sequence AGGAGCGGGGCGATGGGCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381342_1166381358 29 Left 1166381342 19:42356831-42356853 CCCAGGCCCATCGCCCCGCTCCT 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381342_1166381351 5 Left 1166381342 19:42356831-42356853 CCCAGGCCCATCGCCCCGCTCCT 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55
1166381342_1166381353 11 Left 1166381342 19:42356831-42356853 CCCAGGCCCATCGCCCCGCTCCT 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1166381342_1166381359 30 Left 1166381342 19:42356831-42356853 CCCAGGCCCATCGCCCCGCTCCT 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381342_1166381357 28 Left 1166381342 19:42356831-42356853 CCCAGGCCCATCGCCCCGCTCCT 0: 1
1: 0
2: 0
3: 16
4: 226
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381342 Original CRISPR AGGAGCGGGGCGATGGGCCT GGG (reversed) Exonic
900819009 1:4871952-4871974 AGGTAGGAGGCGATGGGCCTGGG - Intergenic
902076477 1:13790772-13790794 AGGATCGGGCCTAGGGGCCTGGG - Intronic
902246835 1:15126414-15126436 AAAAGAGGGGCGATGGTCCTGGG - Intergenic
903153295 1:21428258-21428280 GGGCGCGGGGCGCGGGGCCTGGG - Intergenic
903759383 1:25687194-25687216 AGGAGCGGGGGCATGGGGCATGG + Intronic
903925492 1:26827882-26827904 AGCAGGGGGGCCAGGGGCCTGGG - Intronic
904699806 1:32351573-32351595 AGGGGCGGGGCGAGGGCCCGGGG - Intronic
905394523 1:37658324-37658346 AGGAGCTGGGAGCTGAGCCTGGG - Intergenic
905932984 1:41802817-41802839 AAGAGCAGGGGGATGGGACTGGG - Intronic
908592039 1:65645922-65645944 AGGAGCCTGGCGAGGAGCCTGGG + Intergenic
908800336 1:67873478-67873500 AGGACCAGAGAGATGGGCCTGGG + Intergenic
911311507 1:96297707-96297729 AGGAGTTGGGAGATGAGCCTTGG - Intergenic
914048309 1:144108449-144108471 AGGAGCATGGGGATGGTCCTGGG + Intergenic
914130875 1:144856999-144857021 AGGAGCATGGGGATGGTCCTGGG - Intergenic
920528311 1:206684846-206684868 AGGGGCGGGGGGCGGGGCCTGGG - Intergenic
1063378835 10:5571631-5571653 AGGGGCCTGGCGCTGGGCCTGGG - Intergenic
1064935113 10:20670803-20670825 AGGAGCTGGGAGAGAGGCCTGGG + Intergenic
1071564744 10:86665892-86665914 TGGAGAGGGGCCATGGGGCTGGG - Exonic
1074780400 10:116798166-116798188 AGGGGCGGGGCGGTGGGGCGGGG + Intergenic
1075616278 10:123892513-123892535 AGCCGCAGGGCCATGGGCCTGGG - Intronic
1076638899 10:131900965-131900987 TCGAGCGGGGCGACGGGCATTGG + Exonic
1076687579 10:132204985-132205007 AGGAGGGGGGCGAGTGCCCTGGG - Exonic
1076853975 10:133106273-133106295 TGGAGGGGAGTGATGGGCCTGGG - Intronic
1077024638 11:433737-433759 AGGGGCAGGGCCATGGGGCTGGG - Intronic
1077088237 11:765390-765412 AGGAGGGGGGCGGGGGGCATGGG - Intergenic
1077236214 11:1483202-1483224 GGGAGCAGGGCGCAGGGCCTCGG - Intronic
1077321807 11:1946214-1946236 AGAAGCGGGGCCATGGGTCCTGG - Intergenic
1077498541 11:2898358-2898380 AGGAGAGGGGCCAAGGGCCAAGG - Intronic
1077557125 11:3231152-3231174 AGGAGAGGGACCATGGCCCTTGG - Intronic
1078250683 11:9614182-9614204 AGGAGCGGCGCGTGGGGCCCCGG - Intergenic
1079329374 11:19521091-19521113 CGGGGCGTGGTGATGGGCCTTGG + Intronic
1079505046 11:21143926-21143948 AGGAGCTGGGAGATGGACCATGG + Intronic
1083779924 11:64912451-64912473 AGGAGCTGGGTGGTGGGCCTAGG - Intronic
1084266932 11:68010011-68010033 AGGAGTGGGGCAGTGGGCCCTGG - Intronic
1084412481 11:69012758-69012780 AGGAGCTGGACGGTGGGGCTGGG + Intronic
1084907416 11:72358791-72358813 AGGAGGGGTGGGATGGGGCTTGG - Intronic
1085446984 11:76607554-76607576 AGGAAGGGGGTGATGGGCCTGGG - Intergenic
1085478601 11:76804171-76804193 AGGAGTGGGGGAATGGGGCTGGG - Intergenic
1088742197 11:112776326-112776348 AGGAGTGGGGCCATGAGCATGGG - Intergenic
1088896961 11:114085771-114085793 TGGAATGGGGCGATGGGCATGGG + Intronic
1089629462 11:119775036-119775058 AGGGGTGGGGCGATGGCCTTGGG - Intergenic
1090619599 11:128549275-128549297 AGGAGAGGGGCGAGGGGCGAGGG - Intronic
1091207735 11:133832977-133832999 AGGAGCTGGGAGAGGAGCCTGGG + Intergenic
1202804824 11_KI270721v1_random:1527-1549 AGAAGCGGGGCCATGGGTCCTGG - Intergenic
1092112019 12:5970683-5970705 AGGAGAAAGGCAATGGGCCTGGG + Intronic
1093080329 12:14803250-14803272 AGGAGCGGGGCAAAGGGGCTGGG + Intronic
1096533962 12:52258894-52258916 GGGACCGGGGCTATGGGACTGGG - Intronic
1096620586 12:52862227-52862249 AGGAGCTGGGAGAGGGCCCTGGG - Intergenic
1101479569 12:105084301-105084323 AGGGCCGGGGCGGTGGGGCTGGG - Intronic
1103308873 12:119989155-119989177 AGGGGCGGGGCGAGGGGACGCGG + Intergenic
1104049580 12:125186548-125186570 GGGCGCGGGGCGCTGAGCCTCGG + Intergenic
1104050047 12:125188735-125188757 AGGGACGGGGCGATGGCACTGGG - Intronic
1104931035 12:132339608-132339630 TGGAGCGGGGAAATGGCCCTGGG + Intergenic
1104964241 12:132501825-132501847 AGGAGAGGAGCCACGGGCCTGGG - Intronic
1107951392 13:45465231-45465253 CGGGCCGGGGCGATGGGGCTGGG + Intronic
1113785364 13:112999602-112999624 AGGAGGTGGGCCTTGGGCCTCGG + Intronic
1113974842 13:114219867-114219889 AGGAAGGAGGCGATGGGCCCAGG + Intergenic
1114181237 14:20369628-20369650 AGGAGCCGGGAGATGGCCCAGGG - Intronic
1116526259 14:45909783-45909805 GGGAGTGGGGAGATGGGCCGAGG - Intergenic
1117488973 14:56227192-56227214 GGGAGCGGGGCACTGGGCCAGGG + Intronic
1119159954 14:72444372-72444394 AGGTGAGGGGGGATGGGGCTTGG + Intronic
1122546416 14:102524984-102525006 AGACGCGGGGCGAGTGGCCTGGG + Intergenic
1124914491 15:33956263-33956285 AGGAGCGGGGAGATGGAAATGGG - Intronic
1125195296 15:37039048-37039070 AGGAGCCAGGCAGTGGGCCTTGG + Intronic
1125664284 15:41417548-41417570 GGGACCGGGCCGTTGGGCCTCGG + Intronic
1125718885 15:41835712-41835734 AGGAGTGGAGGGATGGCCCTGGG + Intronic
1125761118 15:42096109-42096131 TGGAGTGGGGCGCTGGGGCTGGG - Intergenic
1127916348 15:63458850-63458872 AGGAGCAGGGTGAGGGGCCCAGG - Intergenic
1128119811 15:65137257-65137279 AGCAGCGGGACCCTGGGCCTGGG + Intergenic
1128512518 15:68322115-68322137 AGGAGCGGGACGGTGAGTCTGGG + Intronic
1131522590 15:93127458-93127480 AGGACTGGGGCAGTGGGCCTGGG + Intergenic
1132426788 15:101724486-101724508 AGGGGCGGGGCGATGGGGCGGGG + Exonic
1132981373 16:2740109-2740131 AGGAGAGGGGTGAGGGGCCAAGG - Intergenic
1133121521 16:3611532-3611554 AGGAGCCGGGCTGTGGGGCTGGG - Intronic
1133767776 16:8849748-8849770 AGGAGGGGCTCGAGGGGCCTGGG - Intergenic
1137618227 16:49858925-49858947 GGGAGGGGGACGATTGGCCTCGG + Intergenic
1141907231 16:87035044-87035066 AGGAACAGGACGATGGGCATGGG + Intergenic
1142743962 17:1945910-1945932 AGGAGCCAGGCCCTGGGCCTAGG - Intronic
1143627714 17:8120841-8120863 GGGAGCGGGGCTAAGGGACTTGG - Exonic
1146628724 17:34454758-34454780 ATGAGCTGGACGATGGTCCTTGG + Intergenic
1146922644 17:36723507-36723529 AGGAGCAGGGCCCTTGGCCTTGG + Intergenic
1147166494 17:38596246-38596268 AGGGGCAGGGCCATGGGCCATGG + Intronic
1148496170 17:48054666-48054688 AGGAGCGGGAGGATAGGCCCAGG + Intronic
1151227012 17:72655245-72655267 AGCAGCGGGGCGAGGGAACTTGG - Intronic
1151662369 17:75525627-75525649 GGGGGCGGGGCGCTGGGCCCCGG + Intronic
1152133078 17:78488897-78488919 AGGAGCTGGGAGAGAGGCCTGGG + Intronic
1152183443 17:78840038-78840060 TGGAGCGCGGCGCTGGGCCCCGG - Intronic
1152228278 17:79102616-79102638 AGGAGCAGGGAGAGGGGCCCTGG - Intronic
1152426829 17:80222598-80222620 GGGAGCTGGTGGATGGGCCTCGG + Intronic
1152620838 17:81364080-81364102 AGGAGCTGGGGGAGAGGCCTGGG - Intergenic
1154327978 18:13405867-13405889 AGGAGCGGGCCCAGGAGCCTGGG - Intronic
1154382966 18:13869177-13869199 GGGAGGGGGGCGACTGGCCTCGG - Intergenic
1156313879 18:35950006-35950028 AGGATCCAGGCGATGGGCCTGGG - Intergenic
1157433814 18:47652005-47652027 AGGAGCGAGGAGAGAGGCCTGGG - Intergenic
1157723677 18:49945769-49945791 AGGAGAGGAGAGCTGGGCCTGGG + Intronic
1160269700 18:77373058-77373080 GGGAGCGGGGCCATGAGCGTGGG - Intergenic
1160835259 19:1121993-1122015 AGGAGCGGAGGGGTGGGGCTGGG - Intronic
1160874252 19:1289953-1289975 GAGAGCCGGGCGGTGGGCCTGGG + Intronic
1160960510 19:1718742-1718764 AGGGGCGGGGGGATGGGCAGGGG - Intergenic
1161153424 19:2721020-2721042 AGGGGCGGCGGGGTGGGCCTCGG + Intronic
1161760570 19:6168132-6168154 AGGAGAAGGGAGATGGGGCTAGG - Intronic
1162392039 19:10395679-10395701 GGGAGCGTGGGCATGGGCCTTGG + Intronic
1162800164 19:13105617-13105639 AGGGGTGGGGCGTTGGGGCTGGG + Intronic
1163516413 19:17766664-17766686 CAGAGCGGGGCGAAGGTCCTGGG - Exonic
1163655607 19:18543369-18543391 ATGGGCGGGGCGAGGGGCCGCGG - Intronic
1163783111 19:19260925-19260947 AGCTGCAGGGCGACGGGCCTGGG - Exonic
1165488683 19:36110916-36110938 AGGCAAGGGGAGATGGGCCTGGG - Intergenic
1165762485 19:38329800-38329822 AAGAGGGAGACGATGGGCCTGGG + Intergenic
1166359846 19:42248555-42248577 AGGTGCGTGGGGAGGGGCCTGGG - Exonic
1166381342 19:42356831-42356853 AGGAGCGGGGCGATGGGCCTGGG - Exonic
1166781290 19:45344975-45344997 AGGAGAGGGCCGAGGGGCCAGGG - Intronic
1167330678 19:48853986-48854008 AGGTGCGGGGCCCTGGGCCAAGG - Exonic
1167435179 19:49474924-49474946 AGGAGCGGGGAGATGGACAGAGG + Intronic
1202687761 1_KI270712v1_random:61344-61366 AGGAGCATGGGGATGGTCCTGGG + Intergenic
927053769 2:19352228-19352250 AGGAGAGGGCCGCTGGGCCTAGG + Exonic
927474573 2:23402497-23402519 AGGATGGGGGCGCTGGGACTCGG - Intronic
927698355 2:25252284-25252306 GGGAAGGGGGCGATGGGGCTGGG + Intronic
927882528 2:26698723-26698745 AGGAGCGGGGAGATGGGGGGTGG - Intronic
928101031 2:28437472-28437494 AAGAGCTGGGCGCTGGCCCTCGG - Intergenic
928441643 2:31297040-31297062 AGGAGGGGTTGGATGGGCCTCGG + Intergenic
928797491 2:35040162-35040184 AGCAGTGGGGCCCTGGGCCTGGG - Intergenic
929899136 2:45986420-45986442 AGGCGAGCGGGGATGGGCCTTGG + Intronic
932718032 2:74117015-74117037 GGGAGCGGGGAGATGGGCAAGGG + Intergenic
933958593 2:87394241-87394263 AGGAGCATGGGGATGGTCCTGGG - Intergenic
934242722 2:90286247-90286269 AGGAGCATGGGGATGGTCCTGGG - Intergenic
934270453 2:91530436-91530458 AGGAGCATGGGGATGGTCCTGGG + Intergenic
936151105 2:110022869-110022891 AGGTGCGGGGCGCTGGGCAGTGG + Intergenic
936193572 2:110348500-110348522 AGGTGCGGGGCGCTGGGCAGTGG - Intergenic
937389221 2:121468778-121468800 AGGAGCATGGCGTTGGGCTTAGG - Intronic
937889446 2:126926203-126926225 AGCAGTGGGGCCCTGGGCCTGGG - Intergenic
938073086 2:128318585-128318607 GGGCGCGGGGCGCGGGGCCTGGG + Intergenic
941492281 2:166157351-166157373 GGGAGCGGGGCGAGGGGCATGGG - Intergenic
943844964 2:192634401-192634423 AGGATGGGGGGGATTGGCCTTGG - Intergenic
948770278 2:240248243-240248265 AGCAGGGGGTGGATGGGCCTGGG - Intergenic
948874323 2:240819105-240819127 AGGAGCGGGGCGCTGGGCGCCGG - Intronic
948874624 2:240820069-240820091 AGGTGCGGGGCGAGGGGCGCGGG + Intronic
949010368 2:241674909-241674931 AGGGGCTGTGGGATGGGCCTGGG - Intergenic
1169277885 20:4245770-4245792 GGGGCTGGGGCGATGGGCCTGGG + Intronic
1170604186 20:17863629-17863651 AGGGACGGGGAGCTGGGCCTTGG - Intergenic
1172567047 20:35938851-35938873 AGGGGCAGGGCCAGGGGCCTGGG - Exonic
1174110911 20:48197175-48197197 CGCTGCGGGGCGAGGGGCCTGGG - Intergenic
1174170870 20:48617581-48617603 AGGAGCCGCCAGATGGGCCTCGG - Intergenic
1175268699 20:57718726-57718748 CGGGGCGGGGCGCGGGGCCTCGG + Intergenic
1175943382 20:62548031-62548053 AAGAGAGGGGAGAAGGGCCTAGG - Intergenic
1176052106 20:63125317-63125339 AAGAGCGGGCAGGTGGGCCTTGG + Intergenic
1176078611 20:63260548-63260570 TGGAGCAGGGCGCTGGGGCTAGG + Intronic
1176084449 20:63289676-63289698 AGGTGCGGGCAGGTGGGCCTGGG + Intronic
1177645933 21:23899731-23899753 AGGAGTAGGGCCCTGGGCCTGGG + Intergenic
1178314864 21:31559224-31559246 AGGAGCGGGGCGTTCGGAGTTGG + Intronic
1179411010 21:41163275-41163297 AGGACAGTGGCGATGGGCGTGGG - Intergenic
1179445256 21:41426304-41426326 AGGAGCGCGGAGAAGGGCATTGG + Intronic
1179602617 21:42490189-42490211 AGGAGTGGGGAGACGGTCCTGGG - Intronic
1180614492 22:17119060-17119082 AGGAGAGGGGTGCTGGGCCTTGG - Exonic
1180829006 22:18888251-18888273 CAGAGCGGGGAGATGGGCCCTGG + Intergenic
1180971814 22:19819908-19819930 AGGGGCGGGGCGCAGGGCTTGGG - Intronic
1181811390 22:25405539-25405561 AGGAGCGCGGGGAGGGGCCGCGG - Intergenic
1182226124 22:28800280-28800302 AGGAGGTGGGCGAGGGGCCGGGG - Exonic
1182421123 22:30249053-30249075 AGGAGGGGGAGGCTGGGCCTGGG - Intergenic
1182551944 22:31105302-31105324 AGGAGCGGGGTGGTGGGCAGAGG + Intronic
1182910738 22:33982078-33982100 AAGAGGAGGGCGGTGGGCCTGGG + Intergenic
1183354375 22:37350562-37350584 AGGAGCTGGCGGGTGGGCCTAGG - Intergenic
1184151632 22:42643124-42643146 AGGGGAGGGGCAATGGGGCTAGG - Intronic
1184368958 22:44070463-44070485 AGGAGAGGGACGCTGTGCCTGGG + Intronic
1203279097 22_KI270734v1_random:114239-114261 CAGAGCGGGGAGATGGGCCCTGG + Intergenic
950053094 3:10006877-10006899 AGGAGCTGGGCGAGGCGCCCAGG + Intronic
950585304 3:13888075-13888097 AGGAGCTGGAACATGGGCCTTGG + Intergenic
952902857 3:38121297-38121319 AGGAGCTGAGGGCTGGGCCTTGG + Intronic
954211462 3:49099905-49099927 CCGAGCAGGGCGATGGGCCATGG - Intronic
954671882 3:52295443-52295465 AGCAGTGGGGCAGTGGGCCTGGG + Intergenic
958964678 3:100546094-100546116 AGGAGGGGGGCTATGAGCCAAGG + Intronic
959508246 3:107178310-107178332 AGCAGCTGGGCCCTGGGCCTGGG + Intergenic
961333604 3:126157263-126157285 AGGAGCGGTGGGCTGGGTCTAGG + Intronic
961479669 3:127171781-127171803 AGGATTGGGGCTATGAGCCTTGG - Intergenic
961521366 3:127469040-127469062 AGGAGCAGAGTGAGGGGCCTGGG + Intergenic
962863690 3:139428568-139428590 TGGAGTTGGGCCATGGGCCTGGG - Intergenic
964622630 3:158732342-158732364 AGCAGCGGGGCGGTGGGGCGCGG + Exonic
967527710 3:190514015-190514037 CGGAGCGGCGCGATTGGCCACGG - Intergenic
968647166 4:1746747-1746769 GGGAGGGGCGCGATGGTCCTGGG - Intergenic
968652741 4:1766680-1766702 AGGAGGTGGGGGAGGGGCCTCGG - Intergenic
968916722 4:3499909-3499931 AGGTGCGGGGCGAGGGGCGCAGG + Intronic
969977358 4:11117227-11117249 AGGTGCGGGGTGAGGGGTCTGGG - Intergenic
971728830 4:30349728-30349750 AGGAGCTGCATGATGGGCCTTGG + Intergenic
982313752 4:154010782-154010804 AGAAACGGGACGGTGGGCCTAGG + Intergenic
986440405 5:7776498-7776520 AGGAGCAGGTCTAGGGGCCTGGG - Intronic
986538296 5:8815692-8815714 AGCAGCAGGGCCCTGGGCCTGGG - Intergenic
993492293 5:88567194-88567216 AGGAGAGTGGAAATGGGCCTAGG - Intergenic
993967214 5:94372617-94372639 AGGAGGGGGGCCCTGGGCCCAGG + Intronic
996480941 5:123974080-123974102 AGGAGCAGGGCCCTGGGTCTGGG + Intergenic
997673734 5:135696869-135696891 AGGAGCAGGGAGATGGGGCTGGG + Intergenic
998157919 5:139796603-139796625 AGGAGCGGGCTGCTGGGGCTGGG + Intronic
998394843 5:141811872-141811894 AGGAGCCGGGCTGTGGGCCGAGG - Intergenic
1002197234 5:177508202-177508224 AGCAGGGGGGCGATTGGGCTGGG - Intronic
1006285727 6:33092502-33092524 GGGAGCAGGAGGATGGGCCTGGG - Intergenic
1006288348 6:33115294-33115316 GGGCTGGGGGCGATGGGCCTGGG + Intergenic
1011099738 6:83708564-83708586 GGGGCCCGGGCGATGGGCCTCGG - Intronic
1016616531 6:146055002-146055024 AGGAATGGGGCGATTTGCCTTGG + Intronic
1018922908 6:168188241-168188263 AGGAGCTGGGTGTTGTGCCTGGG + Intergenic
1019432451 7:1005555-1005577 GGCAGCGGGGCAGTGGGCCTGGG + Intronic
1019524063 7:1472845-1472867 CGGGGCGGGGCGATGTGCCGGGG + Intronic
1019563179 7:1667806-1667828 TGGAGCGCGGCGTTGGGCCCCGG + Intergenic
1019829350 7:3311168-3311190 AATTGCAGGGCGATGGGCCTGGG + Intronic
1022511691 7:30938798-30938820 TGGAGCTGGTGGATGGGCCTTGG - Intronic
1023993845 7:45146660-45146682 GGGAGCAGGGCCGTGGGCCTGGG + Intergenic
1029616568 7:101662404-101662426 AGTAGCAGGGCAAAGGGCCTTGG + Intergenic
1029996665 7:105013745-105013767 AGGAACGGGGAGACGGGACTGGG + Intergenic
1033627758 7:143127766-143127788 AGGGGCGGGGGGAGGGGTCTAGG - Intergenic
1034306424 7:150048290-150048312 AGGAGCTGCGCGAGGGGCCTGGG - Intergenic
1034800422 7:154052352-154052374 AGGAGCTGCGCGAGGGGCCTGGG + Intronic
1035127165 7:156616835-156616857 AGGAGCGGGGCGCGGGGCGCGGG - Intergenic
1035265121 7:157685929-157685951 CGGCGCGGGGAGGTGGGCCTGGG - Intronic
1035319160 7:158017386-158017408 AGGAGCAGGGAGAAGGGTCTAGG + Intronic
1036620955 8:10424415-10424437 AGGATCGGGGAGAAGGGCCTGGG + Intronic
1036620985 8:10424503-10424525 AGGATCGGGGAGAAGGGCCTGGG + Intronic
1036661335 8:10711028-10711050 AGGAGCTGCGCACTGGGCCTAGG + Intronic
1036784880 8:11679589-11679611 AGGAGCTGGGCGCGCGGCCTGGG + Intronic
1038319378 8:26513746-26513768 AGGAGAGGGGCACTGGGGCTGGG + Intronic
1041404603 8:57483916-57483938 AGGAGCGGGGAGCTGAGCATTGG + Intergenic
1041674679 8:60526338-60526360 AGGAAGGGGGCCATGGGCCAAGG - Intronic
1045459076 8:102411715-102411737 AGAAGCGGGGCCAGGGGCCCCGG - Intronic
1047492395 8:125385824-125385846 TGGAGCGGGGCGGGGGGCCCTGG + Intergenic
1049419564 8:142510806-142510828 AGGTGCGGGGCGGCGGGCCGGGG + Intronic
1059208300 9:112486916-112486938 AGGAGCGGGGCGGGGGGCGGGGG - Intronic
1060336695 9:122730417-122730439 AGGAGTGGGGAGTTGAGCCTTGG + Intergenic
1061496971 9:130980690-130980712 AGGAGCAGGTGGATGGGCCCGGG - Intergenic
1062082051 9:134629456-134629478 AGCTGCGGGGGAATGGGCCTGGG - Intergenic
1062265909 9:135686391-135686413 AGGAGCTGGGCTAGGGGCCTGGG - Intergenic
1062360058 9:136183387-136183409 AGGAGCGGGGAGAGAGGCGTGGG - Intergenic
1062513882 9:136922614-136922636 AGGATGGGGAGGATGGGCCTGGG + Intronic
1062513897 9:136922653-136922675 AGGATGGGGAGGATGGGCCTGGG + Intronic
1062513970 9:136922850-136922872 AGGATGGGGAGGATGGGCCTGGG + Intronic
1062513998 9:136922934-136922956 AGGATGGGGAGGATGGGCCTGGG + Intronic
1062579965 9:137225113-137225135 AGGGGCGGGGCCATGGGGCGGGG - Exonic
1185872327 X:3674338-3674360 AGGAGAGGAGCAAGGGGCCTTGG + Intronic
1186200137 X:7148232-7148254 CGGAGCCGGGCGAGGGGCCGCGG - Intergenic
1188201376 X:27295830-27295852 AGGGGCGGGGCGATGGAGTTTGG + Intergenic
1190146476 X:47895888-47895910 AGGAGAGGGGCCATGGACATTGG + Exonic
1191094573 X:56661022-56661044 AGGAGAGAGGCGAAGGCCCTTGG - Intergenic
1198026473 X:132712478-132712500 AGGAGCCAGGCAAAGGGCCTGGG + Intronic
1200055572 X:153458248-153458270 AGGACAGGGGCGATGGCACTGGG + Intronic
1200157026 X:153982282-153982304 AGGGGCGGCGCGATGGGGCTGGG + Exonic
1200162769 X:154017926-154017948 TGGAGCCGGGCGCGGGGCCTAGG - Intronic
1200234660 X:154462453-154462475 AGGAGCAGGGCCAGGCGCCTGGG - Intronic
1200791579 Y:7304343-7304365 AGGAGAGGAGCAAGGGGCCTTGG - Intergenic