ID: 1166381343

View in Genome Browser
Species Human (GRCh38)
Location 19:42356832-42356854
Sequence AAGGAGCGGGGCGATGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381343_1166381357 27 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381343_1166381360 30 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381343_1166381358 28 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381343_1166381359 29 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381343_1166381351 4 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55
1166381343_1166381353 10 Left 1166381343 19:42356832-42356854 CCAGGCCCATCGCCCCGCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 232
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381343 Original CRISPR AAGGAGCGGGGCGATGGGCC TGG (reversed) Exonic
900658845 1:3772953-3772975 AAGGAGCCGGGCAAGGAGCCGGG - Intronic
900932490 1:5746035-5746057 AAGGAGGAGGGCGCTGGTCCAGG + Intergenic
902076478 1:13790773-13790795 AAGGATCGGGCCTAGGGGCCTGG - Intronic
902804838 1:18854540-18854562 CAGGACCGGGTCGATGGCCCAGG + Exonic
902979515 1:20113005-20113027 AGGGAGAGGGGCCTTGGGCCTGG + Exonic
904699807 1:32351574-32351596 GAGGGGCGGGGCGAGGGCCCGGG - Intronic
905803258 1:40859322-40859344 AAGCAGCGGGGCGGTGGGGTGGG + Intergenic
905911654 1:41659137-41659159 AAGGAGCTGGGCTAGGGACCAGG - Intronic
906256513 1:44354940-44354962 AAGGGGAGGGGCGGGGGGCCAGG + Exonic
906318757 1:44804089-44804111 AAGGAGTGGGCAGAGGGGCCTGG + Intronic
906652854 1:47525350-47525372 AAGGAGTGGGGAGAAGGGGCAGG + Intergenic
906960807 1:50418651-50418673 AAGCAGTAGGGCGAGGGGCCTGG - Exonic
908249264 1:62252321-62252343 CAGGAGCAGTGCTATGGGCCAGG - Intronic
909369008 1:74862199-74862221 AAGCAGTGGGGCCCTGGGCCTGG + Intergenic
910909010 1:92214382-92214404 AAGGAGGGGGCCAATGGGCCTGG + Intergenic
910963383 1:92784816-92784838 AAGGTGAGGGGCGCTGCGCCAGG - Intronic
912381287 1:109249568-109249590 AGGGAGCGCGGGGCTGGGCCCGG + Intergenic
914195588 1:145446517-145446539 AGAGAGCGGGGGCATGGGCCAGG + Intergenic
915885642 1:159718223-159718245 GAGCAGCGGGGCCCTGGGCCTGG - Intergenic
918668250 1:187178749-187178771 AAGCAGCAGGGCCCTGGGCCTGG + Intergenic
922199860 1:223393020-223393042 AAGGGGTGGGGAGAAGGGCCGGG - Intergenic
924457462 1:244230121-244230143 AAGGAACAGGGGGATGGGGCAGG + Intergenic
1063944035 10:11159718-11159740 AAAGAACCTGGCGATGGGCCTGG - Intronic
1067937696 10:50624892-50624914 AAGGGGCGCGGCTACGGGCCCGG + Intronic
1069836824 10:71314538-71314560 AGGGTGCGGGGCGTTGGGGCGGG - Intergenic
1074685861 10:115961987-115962009 AAGGAGAGGGGCAAGGGGGCAGG - Intergenic
1074780399 10:116798165-116798187 GAGGGGCGGGGCGGTGGGGCGGG + Intergenic
1075616279 10:123892514-123892536 AAGCCGCAGGGCCATGGGCCTGG - Intronic
1075634731 10:124022781-124022803 AAGGAGCAGGGCGAGGGGGTTGG - Intronic
1075800713 10:125151911-125151933 ACGGAGCGGGGGGAGGGGGCAGG + Intronic
1076687580 10:132204986-132205008 AAGGAGGGGGGCGAGTGCCCTGG - Exonic
1076801993 10:132835198-132835220 GAGGGGCGGGGCGCTAGGCCAGG - Intronic
1076853976 10:133106274-133106296 ATGGAGGGGAGTGATGGGCCTGG - Intronic
1077049361 11:559919-559941 AAGGAGCTGTGGGCTGGGCCTGG - Intronic
1077231748 11:1460852-1460874 AAGGAAAGGGGCGTTGGGGCCGG + Exonic
1077242019 11:1515637-1515659 AGGGAGCCGGGCGCTGGGCAGGG - Intergenic
1080551575 11:33376928-33376950 GAGGAGCGGGGCGGCGGGACGGG + Intergenic
1083464165 11:62834222-62834244 AAGGAGCAGGGAGAAGGGTCAGG - Intronic
1084197165 11:67530049-67530071 ATGGAGGTGGGGGATGGGCCGGG + Intergenic
1084269488 11:68021406-68021428 GAGGAGCGGGGCCGTGGGCTGGG + Intronic
1085446985 11:76607555-76607577 AAGGAAGGGGGTGATGGGCCTGG - Intergenic
1086438050 11:86800709-86800731 GAGGAGCGGGACAAAGGGCCGGG + Intronic
1087571116 11:99928646-99928668 AAGCAGCAGGGCCCTGGGCCTGG + Intronic
1089329325 11:117678791-117678813 GAGGAGCAGGGCGTAGGGCCAGG + Intronic
1089629463 11:119775037-119775059 AAGGGGTGGGGCGATGGCCTTGG - Intergenic
1089759207 11:120710721-120710743 GAGGAGCAGGGCGATGTGCAAGG - Intronic
1090619600 11:128549276-128549298 CAGGAGAGGGGCGAGGGGCGAGG - Intronic
1090834201 11:130442098-130442120 AGGGAGGGGAGCGATGGGACAGG - Intergenic
1090859549 11:130640652-130640674 AAGGTCTGGGGCTATGGGCCTGG + Intergenic
1093080328 12:14803249-14803271 GAGGAGCGGGGCAAAGGGGCTGG + Intronic
1093149717 12:15606441-15606463 AAGGAGGTGTGCGATGAGCCAGG - Intergenic
1099445229 12:82743981-82744003 AAGGAGGGGGGTGCTGGGCATGG + Intronic
1103343246 12:120232496-120232518 AAGGAGCTGTGAGTTGGGCCTGG - Intronic
1104964242 12:132501826-132501848 AAGGAGAGGAGCCACGGGCCTGG - Intronic
1106533638 13:30618280-30618302 AAGGAGCGTGGAGATGGGCAGGG + Intronic
1107898577 13:44989769-44989791 AGGGAGTGGGTAGATGGGCCTGG - Intronic
1108623219 13:52204089-52204111 AAGGGGCAGGGCCCTGGGCCCGG + Intergenic
1110056968 13:70985700-70985722 AAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1112826624 13:103398919-103398941 AAGCAGCAGGGCCTTGGGCCTGG + Intergenic
1113655795 13:112067284-112067306 CGGGAGCGGTGCGCTGGGCCCGG - Intergenic
1114181238 14:20369629-20369651 GAGGAGCCGGGAGATGGCCCAGG - Intronic
1117488972 14:56227191-56227213 GGGGAGCGGGGCACTGGGCCAGG + Intronic
1119378754 14:74215436-74215458 AAGGTGCTGGGCGATGGGGAGGG - Intergenic
1119479736 14:74951878-74951900 AAGGGGCTGGGTGAGGGGCCGGG + Intronic
1121471136 14:94155408-94155430 GAGAAGCGGGGCCCTGGGCCTGG - Intronic
1122593197 14:102870460-102870482 AAGGGGCCGGGCGACGGGCCGGG - Intronic
1124035333 15:26049017-26049039 AAGGTGCGGGGCTAAAGGCCTGG - Intergenic
1124663141 15:31567726-31567748 AGGTAGCGGGGCCCTGGGCCTGG - Intronic
1128321991 15:66701078-66701100 AAGGGGCGGGGCGCCGCGCCGGG + Intergenic
1130762179 15:86832120-86832142 AAGCAGCAGGGCACTGGGCCAGG + Intronic
1132303836 15:100794145-100794167 AAGCAGCTGGGCCCTGGGCCTGG + Intergenic
1132426787 15:101724485-101724507 GAGGGGCGGGGCGATGGGGCGGG + Exonic
1132426809 15:101724551-101724573 CAGGGGCGGGGCGCTGGGCGGGG + Exonic
1132468386 16:88486-88508 AAGACGCCGGGCCATGGGCCTGG - Intronic
1132532204 16:458015-458037 TAGGATTGGGGCGATGGCCCCGG + Intronic
1132686669 16:1165077-1165099 AAGGAGGGGGCTGATGGGGCAGG + Intronic
1132716247 16:1291541-1291563 CAGGAGCTGGGCGAGGGGGCTGG - Intergenic
1133021178 16:2967602-2967624 ACGGTGCGGGGCGCTGGGGCAGG + Exonic
1133562504 16:6963072-6963094 AAGGAGAGGGAAGGTGGGCCTGG - Intronic
1139485302 16:67252872-67252894 AGGGAGAGGGGTGATGGGTCTGG - Intronic
1139908155 16:70380776-70380798 AAGGAGGCTGGCTATGGGCCCGG - Exonic
1141813803 16:86395531-86395553 AAGGAGCAGGGAGATGAGACAGG + Intergenic
1143949721 17:10623026-10623048 AAGGAGCGGGGAGAAGAGACAGG + Intergenic
1144506309 17:15834208-15834230 AAGGAGCTGGGGGATGTGCAGGG + Intergenic
1145106737 17:20124101-20124123 AAGGAGGAGGGCCATGAGCCAGG + Intronic
1145118307 17:20232347-20232369 AAGGAGCTGGGGGATGTGCAGGG + Exonic
1145170485 17:20652141-20652163 AAGGAGCTGGGGGATGTGCAGGG + Intergenic
1145815716 17:27793685-27793707 AAGGAGCCGGGCCATGCGCGAGG - Intronic
1147586337 17:41655709-41655731 AAGGAGGGAGGTGAGGGGCCTGG + Intergenic
1148110876 17:45144202-45144224 AGGGAGCGGGGAGCGGGGCCCGG + Intergenic
1148356391 17:46978570-46978592 AGAGAGCGGGGCGAGGGTCCGGG + Exonic
1149484306 17:57030078-57030100 AAGAAGTGGGGCTAGGGGCCAGG - Intergenic
1151491023 17:74432415-74432437 GCGGCGCGGGGCGCTGGGCCAGG - Intronic
1151655014 17:75491754-75491776 CAGGAGCGTGGCGACTGGCCTGG + Exonic
1156313880 18:35950007-35950029 CAGGATCCAGGCGATGGGCCTGG - Intergenic
1157004063 18:43560444-43560466 AAGGTGTGGGGGGGTGGGCCTGG - Intergenic
1158101503 18:53834747-53834769 GAGCAGTGGGGCCATGGGCCTGG - Intergenic
1158976688 18:62716419-62716441 AAGGTGCTGGGCCAGGGGCCCGG + Exonic
1160861787 19:1240235-1240257 AAGGAGCGGGGCTGGGGGCCCGG + Intergenic
1160960511 19:1718743-1718765 GAGGGGCGGGGGGATGGGCAGGG - Intergenic
1160972056 19:1773913-1773935 AAGGCTCGGGGTGATGGGGCAGG - Intronic
1161261261 19:3339007-3339029 AAGGAGCAGGGTGACGGTCCTGG - Intergenic
1161316749 19:3620838-3620860 GAGGAGGGGGGCGAGGGGGCGGG - Intronic
1161769203 19:6222275-6222297 GAGGTGCGGGGCGAGGTGCCTGG + Exonic
1162237760 19:9321828-9321850 AAGGAGCGGGGGGTAGGGCAGGG - Intergenic
1162998421 19:14350907-14350929 AAGGAGGGGCACGATGGGCTGGG + Intergenic
1163053745 19:14703638-14703660 AAGGAGCGAGGGGATAGCCCAGG + Intronic
1163832688 19:19554568-19554590 AAGGGGCAGGGAGATGGGGCCGG + Intergenic
1166359847 19:42248556-42248578 AAGGTGCGTGGGGAGGGGCCTGG - Exonic
1166381343 19:42356832-42356854 AAGGAGCGGGGCGATGGGCCTGG - Exonic
1166387578 19:42390719-42390741 AAGAAGAGGGGAGATGGGCCAGG + Intergenic
1166781291 19:45344976-45344998 GAGGAGAGGGCCGAGGGGCCAGG - Intronic
1167735672 19:51293303-51293325 AAAGAGCAAGGCGATGTGCCGGG + Intergenic
1168201122 19:54816858-54816880 TAGAAGTGGAGCGATGGGCCTGG + Intronic
929081571 2:38127472-38127494 AAGCAGCAGGGCCCTGGGCCTGG - Intergenic
931244570 2:60481397-60481419 AAGCAGAGGTGCGAAGGGCCTGG - Intronic
932718031 2:74117014-74117036 GGGGAGCGGGGAGATGGGCAAGG + Intergenic
935067699 2:99665071-99665093 CAGGAGCTGGGAGAAGGGCCGGG + Intronic
936994078 2:118395397-118395419 AAAGAGAGGGGCTATGGCCCAGG + Intergenic
937346001 2:121125736-121125758 AAGGAGGTGGGCTTTGGGCCGGG + Intergenic
937380712 2:121374113-121374135 AAGCAGCAGGGCCCTGGGCCTGG - Intronic
941492282 2:166157352-166157374 TGGGAGCGGGGCGAGGGGCATGG - Intergenic
941978568 2:171431714-171431736 AAGAAGCAGGGCGGGGGGCCAGG + Intronic
942366264 2:175231158-175231180 AAGGAGCTGAGAGATGGGACAGG - Intergenic
946336573 2:219041427-219041449 AGGGAGCGGCGCGAGTGGCCAGG - Intronic
946787539 2:223263472-223263494 AAGGAGCCTGGCGATGGACATGG - Intergenic
948874623 2:240820068-240820090 CAGGTGCGGGGCGAGGGGCGCGG + Intronic
1169000371 20:2163827-2163849 AAGAAGCAGGCAGATGGGCCAGG + Intronic
1169277884 20:4245769-4245791 AGGGGCTGGGGCGATGGGCCTGG + Intronic
1169345140 20:4823290-4823312 AAGGCGCGGGGCGCGGGGCGCGG - Intronic
1171421458 20:25020558-25020580 AGGGAGCAGGGCCATGTGCCCGG + Intronic
1175302507 20:57952891-57952913 AAGGCCCGGGGCTGTGGGCCTGG - Intergenic
1175443843 20:59007369-59007391 AGGGAGCGGGGCGCGGAGCCGGG - Intergenic
1175737811 20:61399511-61399533 AGGGAGCTGGGAGATGAGCCAGG - Intronic
1175871837 20:62212899-62212921 AAGGAGAGGGGGGATGGGTGGGG + Intergenic
1175871858 20:62212946-62212968 AAGGAGAGGGGGGATGGGTGGGG + Intergenic
1176232861 20:64040892-64040914 AGGGAGAGGAGCCATGGGCCAGG - Intronic
1177561454 21:22759515-22759537 AAGGAGATGAGCCATGGGCCAGG + Intergenic
1177952220 21:27552464-27552486 CAGCAGCGGGGCTGTGGGCCAGG + Intergenic
1180026362 21:45164531-45164553 AGGGAGCGGGGCGGTGGGGTGGG + Intronic
1180871599 22:19149992-19150014 GCGGAGCGGGGCGCGGGGCCCGG - Intronic
1181051224 22:20239136-20239158 AGTGGGCGGGGCGTTGGGCCAGG - Intergenic
1181944590 22:26506232-26506254 AAGGAGAGGGGCGTTGGGAGAGG - Intronic
1182226125 22:28800281-28800303 GAGGAGGTGGGCGAGGGGCCGGG - Exonic
1182308526 22:29388369-29388391 AAGAAGTGGGGCGAGGGGTCAGG - Intronic
1183638888 22:39081600-39081622 GAGGAGCGAGGCGATGAGCCTGG - Intronic
1183730871 22:39617761-39617783 AAGGAGGGGTGCGGTGGGCGGGG - Intronic
1184340165 22:43881569-43881591 AAGGAGCTGGGCCTTGGTCCTGG + Exonic
1184368957 22:44070462-44070484 AAGGAGAGGGACGCTGTGCCTGG + Intronic
1185109124 22:48891038-48891060 GAGGAGCGGAGCGGTGGGCAGGG - Intergenic
1185194892 22:49462980-49463002 AGAGAGCTGGGCGATGAGCCGGG - Intronic
950005739 3:9689932-9689954 AAGGAGCAGGGCTGTGAGCCGGG - Intronic
950416981 3:12874444-12874466 AAGGAGGTGGGGGAGGGGCCAGG - Intergenic
950450817 3:13064276-13064298 AAGGAGCGGGGTGCTGGACAAGG - Intronic
953835475 3:46339274-46339296 GGGCAGCGGGGCCATGGGCCTGG + Intergenic
955081459 3:55661405-55661427 AAGGAAAGGGGCTATGAGCCAGG - Intronic
958543413 3:95509899-95509921 GAGGAGTGGGGCCCTGGGCCTGG - Intergenic
960480240 3:118179136-118179158 AAGGAGTGGGGTGGTGGGGCGGG + Intergenic
960671012 3:120155294-120155316 AAGCAGCAGGGCCCTGGGCCAGG + Intergenic
961321699 3:126081697-126081719 AAGGGGTGGGGAGAAGGGCCTGG + Intronic
961735800 3:129001570-129001592 AAGTGGCGGGGCGAAGGGACCGG + Intronic
962863691 3:139428569-139428591 ATGGAGTTGGGCCATGGGCCTGG - Intergenic
966219939 3:177541295-177541317 AAAGAGCAGGGGGATCGGCCAGG - Intergenic
968517290 4:1020683-1020705 AGGGAATGGGGCGATGGGGCGGG + Intronic
968647167 4:1746748-1746770 AGGGAGGGGCGCGATGGTCCTGG - Intergenic
968914281 4:3490408-3490430 AATGAGCGGGGCGGTGGGGGGGG - Intronic
971972189 4:33634890-33634912 GAGGAGGGGGGCCATGGTCCTGG - Intergenic
974931413 4:68365273-68365295 AAGCAGGGGGGCCCTGGGCCTGG - Intergenic
976287602 4:83385253-83385275 GAGGAGCAGGGCCCTGGGCCTGG + Intergenic
976613945 4:87057249-87057271 GAGCAGTGGGGAGATGGGCCTGG + Intronic
977396524 4:96478538-96478560 AAGCAGCGGGGTCCTGGGCCTGG - Intergenic
978351587 4:107825256-107825278 AAGGAGCGCGCGGAGGGGCCAGG + Intronic
981176897 4:141692221-141692243 AAGGAGTTGGGCCCTGGGCCTGG + Intronic
1202764653 4_GL000008v2_random:139549-139571 TAGCAGCGGGGCCATGGGGCTGG + Intergenic
985992862 5:3577883-3577905 AGGGAGAGGGGCCATGGGCCTGG - Intergenic
988526024 5:31988051-31988073 TAGGAGTGGGGCGATGTCCCGGG - Intronic
990287044 5:54310616-54310638 AAGGGGCGCGGCGATTGGCCAGG + Intergenic
990335751 5:54770786-54770808 AAGGAGCTGGGGGATGGGAGGGG + Intergenic
994084569 5:95744002-95744024 AAGGAAGGGGGAGAGGGGCCAGG - Intronic
995988658 5:118209711-118209733 AAGCAGCAGGGCCCTGGGCCTGG - Intergenic
997673733 5:135696868-135696890 AAGGAGCAGGGAGATGGGGCTGG + Intergenic
998847426 5:146324599-146324621 AAGGAGCGGTGCCATGGGTGGGG + Intronic
1000113865 5:158135196-158135218 AAGGAGAGAGGGGATGGGGCAGG + Intergenic
1001634139 5:173197643-173197665 GAGGAGCTGGGATATGGGCCAGG - Intergenic
1003259821 6:4506893-4506915 AAGCAGCAGGGCCCTGGGCCTGG + Intergenic
1005153571 6:22779259-22779281 CAGTAGCGGGGCCCTGGGCCTGG - Intergenic
1005414937 6:25589781-25589803 AAGGAGAGAAGCAATGGGCCGGG - Intronic
1005965015 6:30721013-30721035 AGGGTGGGGGGCGATGCGCCAGG + Intronic
1007055199 6:38876293-38876315 AAGGAGCAGTGAGCTGGGCCCGG - Intronic
1007553258 6:42746222-42746244 AGGGGGCGGGGAGATGGGGCGGG + Intergenic
1008109515 6:47477760-47477782 AAGGTGCGGGGAGCTGGGACCGG - Intergenic
1012940490 6:105409902-105409924 GAGCAGCGGGGCCCTGGGCCTGG + Intergenic
1012986856 6:105884809-105884831 AAGGAGCTGTGCAATGGGACTGG - Intergenic
1015347314 6:132175101-132175123 AAGCAGCAGGGCCCTGGGCCTGG + Intergenic
1016470527 6:144370262-144370284 AAGCAGCAGGGCCCTGGGCCTGG - Intronic
1019521154 7:1461071-1461093 AAGCAGCGGGGCAGTGGGCGGGG + Intergenic
1019524062 7:1472844-1472866 CCGGGGCGGGGCGATGTGCCGGG + Intronic
1019614439 7:1952763-1952785 CTGGACCGGGACGATGGGCCTGG - Intronic
1019705438 7:2495120-2495142 AAGGAGAGGGGGGCCGGGCCCGG + Intergenic
1019711128 7:2518841-2518863 AGGGTGAGGGGCGAGGGGCCCGG - Intronic
1019829349 7:3311167-3311189 AAATTGCAGGGCGATGGGCCTGG + Intronic
1020608072 7:10362557-10362579 AAGCAGCAGGGCCCTGGGCCTGG - Intergenic
1022629378 7:32070910-32070932 AGTGAGCGGGGCGCTGGGCGCGG - Intronic
1023042001 7:36180448-36180470 AAGGAGGGGCACGATGGCCCTGG - Intronic
1024151060 7:46571585-46571607 CAGGAACTGGGCGTTGGGCCTGG + Intergenic
1025092462 7:56075103-56075125 AAAAAGCGGGGGGATGGGGCAGG + Intronic
1025231343 7:57204996-57205018 CAGGAGCAGGGCGAGGGCCCAGG - Intergenic
1025258906 7:57404218-57404240 AAGGAGCGGGGCGAGGAGAAGGG + Intergenic
1026900927 7:74037114-74037136 AAGGGGCCGGGCAAGGGGCCGGG - Intronic
1026957595 7:74387544-74387566 AAGAAGCAGGGCCAGGGGCCGGG - Intronic
1027236681 7:76302657-76302679 AAAGTGCGGGGCGCTGGGCTCGG - Exonic
1029256544 7:99273421-99273443 AAGGTGAGGGCCGAGGGGCCAGG + Intergenic
1029735919 7:102465680-102465702 AAGTAACGGGGGGATGGGCGGGG + Intronic
1033890392 7:146006232-146006254 AAGGAGAGTAGAGATGGGCCGGG - Intergenic
1034306425 7:150048291-150048313 GAGGAGCTGCGCGAGGGGCCTGG - Intergenic
1034800421 7:154052351-154052373 GAGGAGCTGCGCGAGGGGCCTGG + Intronic
1035127166 7:156616836-156616858 CAGGAGCGGGGCGCGGGGCGCGG - Intergenic
1036620954 8:10424414-10424436 TAGGATCGGGGAGAAGGGCCTGG + Intronic
1036620984 8:10424502-10424524 TAGGATCGGGGAGAAGGGCCTGG + Intronic
1046314305 8:112479545-112479567 AGGCAGCAGGGCCATGGGCCTGG - Intronic
1048010026 8:130448043-130448065 AAGGAGAGGGCCGAAGGGCAAGG + Intergenic
1048836491 8:138523905-138523927 AAGGAGTGGGAGGATGGGACAGG + Intergenic
1049419563 8:142510805-142510827 CAGGTGCGGGGCGGCGGGCCGGG + Intronic
1051406053 9:16738829-16738851 AGGGAGCGGGGCGGGGGGCTGGG - Intronic
1056732524 9:89178276-89178298 AAGGCGCCCGACGATGGGCCCGG - Exonic
1059208301 9:112486917-112486939 GAGGAGCGGGGCGGGGGGCGGGG - Intronic
1059360214 9:113736211-113736233 AAGGGGCGGGGCAAGAGGCCAGG + Intergenic
1059514026 9:114876195-114876217 CAGGAGTGGGGCCCTGGGCCTGG + Intergenic
1061496972 9:130980691-130980713 GAGGAGCAGGTGGATGGGCCCGG - Intergenic
1062121353 9:134835656-134835678 ATGGAGAGGGCCCATGGGCCGGG - Intronic
1062265910 9:135686392-135686414 CAGGAGCTGGGCTAGGGGCCTGG - Intergenic
1062579966 9:137225114-137225136 GAGGGGCGGGGCCATGGGGCGGG - Exonic
1062607129 9:137353383-137353405 GAGGAGCGTGGAGATGGGGCAGG - Intronic
1062699077 9:137889833-137889855 AGAGAGCGGGGGCATGGGCCAGG - Intronic
1203545403 Un_KI270743v1:124437-124459 TAGCAGCGGGGCCATGGGGCTGG + Intergenic
1189985040 X:46545900-46545922 ATGGAGCGGGGCCCTAGGCCTGG + Intergenic
1190225303 X:48540178-48540200 AAGGGGAGGGGCTATGGGGCTGG + Intronic
1190526274 X:51332528-51332550 AGGAACCGGGGCGAGGGGCCAGG - Intronic
1190726436 X:53193412-53193434 GAGGAGAGGGGTCATGGGCCGGG - Intronic
1191122588 X:56921653-56921675 GAGTAGTGGGGCCATGGGCCTGG - Intergenic
1191717857 X:64205436-64205458 AAGGAGAGGGGCGAGCGACCGGG + Intronic
1193706271 X:84823785-84823807 AAGCAGTGGGGCCCTGGGCCTGG + Intergenic
1195422128 X:104687365-104687387 AAGGAGTGGGGGGAGGTGCCAGG + Intronic
1200157025 X:153982281-153982303 CAGGGGCGGCGCGATGGGGCTGG + Exonic