ID: 1166381344

View in Genome Browser
Species Human (GRCh38)
Location 19:42356837-42356859
Sequence CATGGAAGGAGCGGGGCGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381344_1166381357 22 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381344_1166381358 23 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381344_1166381360 25 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381344_1166381359 24 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381344_1166381361 26 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381344_1166381351 -1 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55
1166381344_1166381353 5 Left 1166381344 19:42356837-42356859 CCCATCGCCCCGCTCCTTCCATG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381344 Original CRISPR CATGGAAGGAGCGGGGCGAT GGG (reversed) Exonic
901577433 1:10211382-10211404 CCTGGAAAGAGGGGTGCGATAGG + Intronic
903425673 1:23252455-23252477 CCTGGAAGGAGTGGGGTGCTGGG + Intergenic
906155710 1:43612876-43612898 CAAGGAAGGATGGAGGCGATGGG - Intronic
908742956 1:67347670-67347692 AATGGAAGGAGAGAGGCAATGGG + Intronic
910065858 1:83150265-83150287 CATGGAAGGAGTGGAGGGAGTGG - Intergenic
915668344 1:157465346-157465368 CATGGCAGGAGCAGGGCCAAGGG - Intergenic
916305121 1:163321839-163321861 CATGGAAGGGGCAGGGCGCAGGG - Intronic
1063464804 10:6236188-6236210 CATGGAAGAAGCCAGGAGATGGG - Intergenic
1069582814 10:69576905-69576927 CAGGGAGGGAGGGGGGCCATGGG + Intergenic
1074708501 10:116157627-116157649 CATGGGAGGAGAGGGTGGATTGG - Intronic
1077411427 11:2405661-2405683 CCTGGCAGGAGAGGGGAGATGGG - Intronic
1083470410 11:62880573-62880595 AATGGAAGAAGAGGGGCGTTTGG + Intronic
1084694750 11:70746621-70746643 CCTGAAAGCAGCGGGGAGATGGG - Intronic
1086143014 11:83519771-83519793 CATGGGATGAGCTGGGTGATGGG + Intronic
1087085266 11:94211878-94211900 CATGGCAGGAGCGGGGCAGGTGG + Intergenic
1089886551 11:121830399-121830421 CATGGGAGGAGAGGGGAGAGAGG - Intergenic
1090172982 11:124621299-124621321 CAGGGAAGGAGGGAGGAGATAGG - Intergenic
1092861665 12:12724536-12724558 CAGGCGAGGAGCGGGGCGAGAGG + Intergenic
1094557002 12:31510883-31510905 CATGGAAGGAGGGGTGTGGTAGG - Intronic
1097452153 12:59749940-59749962 CATAGAAGAAGCAGGGCAATGGG + Intronic
1101317561 12:103643438-103643460 CATTGAAGGAGCAGGGTGTTAGG - Intronic
1103621072 12:122187667-122187689 CACGGAAGGCCCGGGACGATGGG - Intronic
1104097353 12:125569691-125569713 CAGGGAAGGAGCGGGGCACAAGG + Intronic
1104468434 12:129008600-129008622 CATGGCAGGAGCAGGGCCAAAGG - Intergenic
1105853952 13:24359314-24359336 CAGGGCAGGAGCTGGGGGATTGG + Intergenic
1106810161 13:33350744-33350766 CCTGGAAGGAGTGGGGCGCGAGG - Intergenic
1108103429 13:46982926-46982948 CATGGATGGAGGAGGGTGATTGG + Intergenic
1110580534 13:77118431-77118453 GATGGAAGGAGCTGGGAGATTGG + Intronic
1113743468 13:112726386-112726408 CATGCAGGGAGAGGGGCCATGGG + Intronic
1113988053 13:114335020-114335042 CATTGAAGGAGCTGGGGAATGGG + Intergenic
1114455546 14:22851150-22851172 CCTGGAAGGAGCTGAGCCATCGG - Intergenic
1114736676 14:25049859-25049881 CACGGTAGGACCGGGGCGAGGGG - Exonic
1115525645 14:34278188-34278210 CATGGAGGGAGGGAGGTGATTGG + Intronic
1119378757 14:74215441-74215463 CCTGGAAGGTGCTGGGCGATGGG - Intergenic
1122915673 14:104857250-104857272 GATGGGAGGAGCGGGGAGACAGG - Intergenic
1126087446 15:45023235-45023257 CCTGGAAGGCGCGGGACGTTTGG - Exonic
1128632014 15:69277648-69277670 CATGAAAGGAGAGGGGAAATGGG + Intergenic
1128931042 15:71705171-71705193 CAGGGAAGGAGCAGGGCCAGAGG + Intronic
1131019935 15:89088932-89088954 CCTGGAAGGAGAGGGCCGAGGGG + Intronic
1132147072 15:99435343-99435365 CAAGGGAGGAGCGGGGTGACAGG + Intergenic
1132426783 15:101724480-101724502 CCCGGGAGGGGCGGGGCGATGGG + Exonic
1134864112 16:17589684-17589706 CATGGAAGCAGGGGGGGGAATGG + Intergenic
1138553652 16:57760204-57760226 CATGGCAGGAGCAGGGAGCTGGG - Intronic
1138591155 16:58000418-58000440 CAGGGCAGGCGCGGGGCGAGCGG + Intronic
1140481929 16:75266635-75266657 CCTGGCAGGAGTGGAGCGATGGG - Intronic
1150622741 17:66820726-66820748 CATTGAAGAAGCTGGGCGAAGGG - Intergenic
1151059077 17:71070160-71070182 CATGGAAGGGGCCGGGTGAAAGG + Intergenic
1152481369 17:80555857-80555879 TATGGATGGAGTGGGGTGATTGG + Intronic
1154471874 18:14711554-14711576 CATGGAAGTAGCTGAGAGATAGG - Intergenic
1160739928 19:680974-680996 CATGTAAGGGGCGGGGCTCTTGG + Intronic
1164475720 19:28574517-28574539 CATGGAAGGAGCAGGAGGAAGGG - Intergenic
1165242645 19:34480966-34480988 CCTGGAACCAGCGGGGCCATAGG - Intergenic
1166381344 19:42356837-42356859 CATGGAAGGAGCGGGGCGATGGG - Exonic
1168278775 19:55292457-55292479 CATGGATGAAGCTGGGCGATGGG + Intronic
925274520 2:2639322-2639344 CATGGGAGGAGCAGGGAGAGTGG + Intergenic
932224805 2:70031128-70031150 CAAGGAAGGAGTGGGGTGAGGGG - Intergenic
936542492 2:113363572-113363594 CATGACAGGAGCTGGGAGATTGG - Intergenic
937439972 2:121907304-121907326 CAAGGTAGGAGAGGGGAGATGGG - Intergenic
938141653 2:128799450-128799472 CAAGGAAGGAGAGGGGCCCTGGG - Intergenic
939887962 2:147701862-147701884 CATTGAAGGAGGGGAGTGATTGG - Intergenic
940638748 2:156327560-156327582 TATGGAAGAGGAGGGGCGATGGG + Intronic
946407313 2:219498563-219498585 CCTGGAAGGGGCGGGGCCAGGGG - Intergenic
948359737 2:237411866-237411888 CAGGGAAAGAGCGGGGCCAAGGG + Intronic
1170352707 20:15459612-15459634 GATGGAAGAAGCTGGGCGAGGGG + Intronic
1173826015 20:46047983-46048005 CAGAGAAGGAGTGGGGCGATGGG + Exonic
1175888847 20:62307246-62307268 CCAGGAAGAAGCGGGGCGGTGGG - Intronic
1179911966 21:44455453-44455475 CCTGGAGGGGGCGGGGCGAAAGG - Intergenic
1181944591 22:26506237-26506259 TAGGGAAGGAGAGGGGCGTTGGG - Intronic
1183795549 22:40114048-40114070 AATGGAAGGAGAGGGGACATTGG + Intronic
1184304170 22:43584185-43584207 CATGGAAGGAGTGGGGAAAGTGG + Intronic
1184790395 22:46696347-46696369 CATGGGAGGAGCAGGGAGAGAGG - Intronic
1185094940 22:48800974-48800996 CAGGGAAGGAGCGGGGAGGGTGG + Intronic
949962329 3:9322696-9322718 CATGGACGGTGGGGGGTGATGGG - Intronic
953212832 3:40891611-40891633 CATGGAAGGGGTGGGGAGGTAGG - Intergenic
961735799 3:129001565-129001587 CCTGGAAGTGGCGGGGCGAAGGG + Intronic
962292272 3:134146683-134146705 CAGGGCAGGAGCTGGGAGATAGG - Intronic
966689346 3:182726940-182726962 CACAGAAGGGGCGGGGCGGTGGG - Intergenic
969846171 4:9922037-9922059 CATGGATGGAGCTGGAAGATAGG - Intronic
971788889 4:31141810-31141832 CATGGTAGGAGGGGGGTGAGGGG + Intronic
972689028 4:41378624-41378646 CATGGAAGCAGGGAGGCCATAGG + Intronic
982755876 4:159218252-159218274 CATGGTAGGAGGGTGGTGATTGG + Intronic
983937580 4:173512999-173513021 AATGGAAGGAGGTGGGGGATTGG - Intergenic
985469441 5:29781-29803 CATTGAAGGAGCTGGGGAATGGG - Intergenic
991574818 5:68091872-68091894 CATGGAAAGAGCAGGGCCTTTGG + Intergenic
1001075596 5:168625409-168625431 TATGGAAGGAGCGGGGGGAGAGG - Intergenic
1001683427 5:173575474-173575496 CATGACAGGAGAGGGGGGATGGG + Intergenic
1004051883 6:12090519-12090541 CATGGAAGGAGCGTGGGGTGAGG - Intronic
1004274410 6:14222700-14222722 TATGGAAGGGGCAGGGAGATGGG + Intergenic
1005062884 6:21793540-21793562 CATGGAAGGAGCAGGGGCTTCGG + Intergenic
1006026412 6:31150010-31150032 CATGGAAGGAGCAAGGTGCTGGG + Intronic
1006934533 6:37708159-37708181 AATGGAAGGAGAAGGGAGATGGG + Intergenic
1009626032 6:66139672-66139694 TATGGGTGGAGCGGGGCCATGGG + Intergenic
1010892748 6:81334540-81334562 CATGGCATGGGTGGGGCGATTGG + Intergenic
1011423652 6:87202736-87202758 CATGGATGGGGCGGGGGGAAGGG - Intronic
1013649271 6:112177628-112177650 AAAGGAAGGAGCGGGGCTGTGGG - Intronic
1017602690 6:156100763-156100785 AATGGAAGGAGCGAGGAAATTGG - Intergenic
1019163895 6:170086863-170086885 CATGGCGGGAGCGGGCCTATGGG - Intergenic
1019294963 7:269245-269267 CATGGAAGGAGGGCGGAGAATGG - Intergenic
1021612590 7:22472769-22472791 CAGGGAAGGAGGGGGAGGATGGG - Intronic
1022629379 7:32070915-32070937 CAGGGAGTGAGCGGGGCGCTGGG - Intronic
1024644984 7:51363373-51363395 CATGGAAGGACAGGGGAGATGGG + Intergenic
1025603541 7:63022783-63022805 CAGGGAAGGAGAGGGGCCTTGGG - Intergenic
1026453025 7:70545850-70545872 CATAGAAGGAGTGGGGGGAGTGG + Intronic
1027278246 7:76584493-76584515 CATGGAAGGAGTGGAGGGAGTGG + Intergenic
1028833794 7:95352041-95352063 CATGGAAGCAGCGGCGGGGTGGG - Intergenic
1029462813 7:100706050-100706072 CAGGGAAGGGGCGGGGCGAACGG + Exonic
1035338079 7:158142844-158142866 CGTGGAAGGAGCTGGGGCATGGG - Intronic
1036564451 8:9926418-9926440 CATGAAGGGAGCTGGGGGATGGG - Intergenic
1037588791 8:20295952-20295974 CATGCAAGGAGAGGGGAGAGAGG - Intronic
1041342481 8:56860143-56860165 CAAGGAAGAAGCGGGGTGAATGG + Intergenic
1049786313 8:144452515-144452537 CATGGAAGGGGCCGTGCCATGGG + Exonic
1058367967 9:104232884-104232906 CATGGAAGGAATGTGGTGATAGG - Intergenic
1059484625 9:114617234-114617256 CAGGGGAGGAGGGGGGCAATGGG - Exonic
1062579969 9:137225119-137225141 CTTGGGAGGGGCGGGGCCATGGG - Exonic
1187094001 X:16127441-16127463 CATGGGAGGAGAGGGAGGATGGG - Intronic
1199067711 X:143440145-143440167 CTTGGAAGAAGTGGGGGGATGGG - Intergenic
1200057873 X:153470873-153470895 CCGGGAAGGGGCGGGGCGAACGG + Intronic