ID: 1166381345

View in Genome Browser
Species Human (GRCh38)
Location 19:42356838-42356860
Sequence GCATGGAAGGAGCGGGGCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381345_1166381357 21 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381345_1166381361 25 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381345_1166381360 24 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381345_1166381358 22 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381345_1166381359 23 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381345_1166381353 4 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1166381345_1166381351 -2 Left 1166381345 19:42356838-42356860 CCATCGCCCCGCTCCTTCCATGC 0: 1
1: 0
2: 1
3: 21
4: 303
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381345 Original CRISPR GCATGGAAGGAGCGGGGCGA TGG (reversed) Exonic
900754795 1:4426059-4426081 GCATGGAAGGGGCGGGGCATGGG - Intergenic
902536221 1:17120461-17120483 GGAGGGAAGGAGTGGGGCGGAGG + Intergenic
903133437 1:21293774-21293796 GAATGGAAGGCCCTGGGCGAAGG - Intronic
903425671 1:23252454-23252476 GCCTGGAAGGAGTGGGGTGCTGG + Intergenic
903907210 1:26695951-26695973 GGAGGGAGGGAGCGGGGGGAGGG - Intergenic
904623522 1:31789448-31789470 GACTGGAAGGGGTGGGGCGATGG - Intergenic
906471269 1:46132975-46132997 GCGAGGAGGGAGTGGGGCGAGGG + Intronic
906869089 1:49456714-49456736 AAAGGGTAGGAGCGGGGCGAGGG - Intronic
907564820 1:55425048-55425070 GGAAGGAAGGAGTGGGGGGATGG - Intergenic
910734131 1:90433462-90433484 GAAGGGTAGGAGGGGGGCGAGGG + Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
911720261 1:101183037-101183059 GGATGGAAGGAGGGGAGGGAGGG + Intergenic
912318947 1:108692549-108692571 GGAGGGAAGGAGGGGGGGGAGGG - Exonic
912504045 1:110143451-110143473 GCTTGGAAGGCGGGGGGCGGCGG - Intergenic
912935876 1:114003247-114003269 GCAGGGAAGGAGGAGGGCCAGGG + Intergenic
913271214 1:117095237-117095259 GCATGGCAGGTGAGGGGAGATGG + Intronic
913344324 1:117793004-117793026 ACATGGATGGAGCAGGGGGAAGG + Intergenic
914980519 1:152410735-152410757 GCCTCGCAGGAGCTGGGCGAAGG - Exonic
915248544 1:154572521-154572543 GCATGCAAGCAGCGGGGGGTGGG - Intronic
915456499 1:156044099-156044121 GCCTGGGAGGTGGGGGGCGAGGG + Exonic
915668345 1:157465347-157465369 ACATGGCAGGAGCAGGGCCAAGG - Intergenic
916305122 1:163321840-163321862 TCATGGAAGGGGCAGGGCGCAGG - Intronic
916362322 1:163984509-163984531 GCATGGCAGGAGCAGAGAGAAGG + Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
920698938 1:208203293-208203315 GCATGGAAGGGGTGGGGTGGTGG - Intronic
922199863 1:223393026-223393048 GAATGGAAGGGGTGGGGAGAAGG - Intergenic
922506921 1:226131849-226131871 GCATGGAAGGTGCCGGGCAGAGG - Intergenic
922766404 1:228158701-228158723 GCAGGGAAGGCGCAGGGCGGGGG - Exonic
923374568 1:233347735-233347757 GGAGGGAAGGAGCGGGGAAAGGG + Intronic
924561700 1:245161963-245161985 GAATGCAAGGGGCGGGGGGAAGG + Intronic
1062983046 10:1741710-1741732 GCATGGAAGGAGGCTGGTGAAGG + Intergenic
1063661202 10:8036029-8036051 GCGCGGAAGGTGCGGGGAGAGGG + Intergenic
1066048611 10:31615977-31615999 GGATGGAAGGAGAGGGACAAGGG + Intergenic
1067470476 10:46534117-46534139 GCAGGGTGGGAGCAGGGCGAGGG + Intergenic
1067661048 10:48236438-48236460 GCAGGGATGGAGGGTGGCGAGGG - Intronic
1068731496 10:60363246-60363268 GCATGGAACGAAGGGAGCGAAGG + Intronic
1069582813 10:69576904-69576926 GCAGGGAGGGAGGGGGGCCATGG + Intergenic
1069620196 10:69832763-69832785 GGCTGGATGGAGTGGGGCGAAGG - Intronic
1069855975 10:71441237-71441259 GCAGGGGGGGAGCGGGGTGAGGG - Intronic
1070328230 10:75401433-75401455 GCATGGGAGCAGCGGGGGGGAGG + Exonic
1071643865 10:87342376-87342398 GCGCGGACGGGGCGGGGCGAAGG + Intergenic
1072249882 10:93573026-93573048 GCCTGGAAGGACCGCGGCCAGGG - Intronic
1073036900 10:100570168-100570190 GTGTGGGAGGAGTGGGGCGAGGG + Intergenic
1073643224 10:105274081-105274103 GCATGGAAGGAGGGTGGGGGTGG - Intergenic
1076572491 10:131441626-131441648 GCAGAGAGGGAGAGGGGCGATGG + Intergenic
1077144757 11:1039967-1039989 GCAGGGAAGGGGCTGGCCGAGGG - Intergenic
1077144767 11:1039990-1040012 GCAGGGAAGGGGCTGGCCGAGGG - Intergenic
1077898657 11:6473351-6473373 GGATGGAAGGGGCGGGGGGTGGG + Intronic
1078143756 11:8709482-8709504 GCTTGGAAGGAGTGTTGCGAAGG - Intronic
1078840567 11:15073112-15073134 GCAGGGAAGGAGGGGGGGGGAGG - Intronic
1079313534 11:19388142-19388164 GGATGGAAGGAACGGGGTCAAGG + Intronic
1081967187 11:47177128-47177150 GCGTGGGAGGGGCGGGGGGAAGG - Intergenic
1081979067 11:47254937-47254959 GCATAGAAGGACGGGGGCCAGGG - Intronic
1083464167 11:62834228-62834250 GAAAGGAAGGAGCAGGGAGAAGG - Intronic
1083843421 11:65317151-65317173 GCTTGCAAGGAGCTGGGGGAAGG - Intronic
1083887727 11:65581031-65581053 GAATGGTAGGAGAGGGGAGAAGG - Intronic
1083896931 11:65624710-65624732 GGAGGGAAGGAGAGGGGAGAAGG - Intronic
1084072476 11:66745222-66745244 GCATGGAAGGCGCTGGGCTCCGG - Intronic
1084362512 11:68677911-68677933 GCAGTGAAGGAGCGGGCCGGGGG + Intergenic
1085306012 11:75486510-75486532 GCATGAAAGGTGCAGGGCCATGG + Intronic
1088584990 11:111354056-111354078 GAATGGAAGGATGGGGGAGAGGG + Exonic
1091582428 12:1797670-1797692 GCGTGGGAGGAGCCGGGCGGGGG + Intronic
1094409627 12:30155472-30155494 GATTGAAAGGAGCTGGGCGAGGG + Intergenic
1096571973 12:52528774-52528796 GCATGGTGGGGGCGGGGAGAGGG - Intergenic
1097500148 12:60391974-60391996 GGATGGAAGGAGCTGGGGGCAGG + Intergenic
1097641962 12:62192395-62192417 GAAAGAAAGGAGCGGGGGGAGGG + Exonic
1098011929 12:66062207-66062229 GGAGGGAAGGAGCGGGTAGAGGG + Intergenic
1098983380 12:76984465-76984487 GAATGGAAGGAGCGAGGCACTGG - Intergenic
1099485575 12:83225421-83225443 GAATGGAAGGAACTGGGAGAAGG + Intergenic
1101718515 12:107331780-107331802 GAATGGCAGGAGCAGGACGAGGG - Intronic
1103308870 12:119989148-119989170 GCCGGCAAGGGGCGGGGCGAGGG + Intergenic
1104766331 12:131332769-131332791 GCCTGGCAGGAGCGTGGCGTGGG + Intergenic
1104813076 12:131629828-131629850 GCCTGGCAGGAGCGTGGCGTGGG - Intergenic
1105704626 13:22961382-22961404 GCATGAAAGGAGTGAGGTGAGGG + Intergenic
1105857581 13:24386434-24386456 GCATGAAAGGAGTGAGGTGAGGG + Intergenic
1105916561 13:24922626-24922648 GCGAGGAGGGAGCGGGGCGCCGG - Intronic
1110727479 13:78841858-78841880 GCATGGAAAGATCAGGGGGAAGG - Intergenic
1112330796 13:98475660-98475682 CCATGGCAGGGGCGGGGCGCAGG + Intronic
1113673958 13:112195741-112195763 GCAGGGAAGGAGGGGAGAGAGGG - Intergenic
1113674003 13:112195899-112195921 GCAGGGAAGGAGGGGAGAGAGGG - Intergenic
1113743467 13:112726385-112726407 GCATGCAGGGAGAGGGGCCATGG + Intronic
1113938101 13:114005771-114005793 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938139 13:114005881-114005903 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938153 13:114005919-114005941 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938188 13:114006029-114006051 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938214 13:114006103-114006125 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938248 13:114006213-114006235 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938283 13:114006323-114006345 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938297 13:114006361-114006383 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938309 13:114006399-114006421 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938344 13:114006509-114006531 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938358 13:114006547-114006569 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938369 13:114006585-114006607 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938404 13:114006695-114006717 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938418 13:114006733-114006755 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938452 13:114006843-114006865 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938487 13:114006953-114006975 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938510 13:114007027-114007049 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938522 13:114007065-114007087 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938545 13:114007139-114007161 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938581 13:114007249-114007271 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938616 13:114007342-114007364 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1114458250 14:22871345-22871367 GCAGAGAAGGGGCGGGGCGGGGG + Intergenic
1114736677 14:25049860-25049882 GCACGGTAGGACCGGGGCGAGGG - Exonic
1115651447 14:35405005-35405027 GCAGGGAAGTACCGGGGGGAGGG - Intergenic
1116813249 14:49559974-49559996 GAAGGGAAGGAGGGGGGCAAGGG - Intergenic
1117813731 14:59576473-59576495 GCCTCCAAGGAGCGGGGAGAAGG + Intronic
1117814700 14:59584880-59584902 GCGTTGAGGGAGCTGGGCGAGGG - Intergenic
1119378759 14:74215442-74215464 CCCTGGAAGGTGCTGGGCGATGG - Intergenic
1119780790 14:77275665-77275687 GCAGGGAAGGAGAGGAGGGATGG - Exonic
1120635299 14:86943810-86943832 GCAAGGAAGGAGGGGAGAGAGGG - Intergenic
1121171189 14:91855765-91855787 GATTGGATGGTGCGGGGCGAGGG + Intronic
1121441022 14:93949523-93949545 GGATGGAAGGAGCTGGGCAGAGG + Intronic
1122265865 14:100546482-100546504 GCAGGTGAGGGGCGGGGCGAGGG - Exonic
1122284893 14:100645051-100645073 GCAAGGAAAGACCGGGGCGGAGG - Intergenic
1122866044 14:104604397-104604419 GCATGGAAGGGGCGCCGCGCCGG + Intronic
1124914493 15:33956270-33956292 GAATTGGAGGAGCGGGGAGATGG - Intronic
1128349850 15:66881499-66881521 GCATGGCAGGAGTGGGGCAGGGG + Intergenic
1128632013 15:69277647-69277669 GCATGAAAGGAGAGGGGAAATGG + Intergenic
1129985873 15:79919438-79919460 GCACGGAAGGTGCGGGGCTCGGG + Intronic
1131019933 15:89088931-89088953 ACCTGGAAGGAGAGGGCCGAGGG + Intronic
1132055935 15:98650021-98650043 GCATGGAAGGGGCGAGGTGCGGG - Intronic
1132560315 16:590502-590524 GCTTGGAAGGGCCGGGCCGAGGG - Intronic
1132694357 16:1195309-1195331 GCGGGGCAGGGGCGGGGCGAGGG + Intronic
1132893688 16:2217330-2217352 GCAGGGAAGGAGCGGTGCAGCGG - Intergenic
1133714851 16:8438078-8438100 GAATGGTAGGAGAGGGGCGAGGG - Intergenic
1137603986 16:49775061-49775083 GCCTGGAGGGAGCTGGGCGGAGG - Intronic
1140481931 16:75266636-75266658 GCCTGGCAGGAGTGGAGCGATGG - Intronic
1142882667 17:2893937-2893959 GCAGGGAAGGAGAGGTGAGAAGG - Intronic
1143391368 17:6561111-6561133 GGAGGGAAGGAGGGGGGAGAAGG - Intergenic
1143836255 17:9695245-9695267 GCATGGAAGAGGCAGGGCAAGGG - Intronic
1144062707 17:11598387-11598409 GCCTGGAAGGGGCGGGACCAGGG + Intergenic
1145274763 17:21422848-21422870 GCAGGGAAGGATAGGGGAGAGGG + Intergenic
1146750469 17:35373843-35373865 GGATGGAGGGAGCGAGGAGACGG - Intergenic
1147150414 17:38510757-38510779 GAGTGGAAGGAGCTGGGCGGAGG + Exonic
1147424975 17:40342084-40342106 GCCTGGACGGGGCGGGGCGGTGG + Intronic
1148155642 17:45424094-45424116 GCATGAAAGGAGGGGGGCAGGGG - Intronic
1149314085 17:55422136-55422158 GCTGGGGAGGGGCGGGGCGAGGG + Intergenic
1150481820 17:65516819-65516841 GAAAGGAAGGAGCAGGGAGAGGG + Intergenic
1150622742 17:66820727-66820749 TCATTGAAGAAGCTGGGCGAAGG - Intergenic
1151660318 17:75515294-75515316 GGACGGAAGGAGCGGGGAGATGG + Intronic
1152368332 17:79870253-79870275 TCCTTGAAGGAGGGGGGCGAGGG - Intergenic
1152919141 17:83057086-83057108 GCCAGGAAGGAGCGGGGAGGGGG + Intergenic
1153261272 18:3226577-3226599 GTGTTGAAGGAGCGGGGTGAAGG - Intergenic
1154140729 18:11822085-11822107 GCACCGCAGGCGCGGGGCGAGGG + Intronic
1154165699 18:12012701-12012723 GCATGGAAGGCGTGGGGCTGAGG + Intronic
1154379594 18:13837404-13837426 TCCTGGGAGGAGCGGGGCCAGGG - Intergenic
1156484098 18:37453923-37453945 GGGTGGAGGGAGCGGGGAGAAGG - Intronic
1157488551 18:48106884-48106906 GCAGGGAAGGGGCTGGGAGAGGG + Intronic
1160539609 18:79613382-79613404 GCATGGAGGGTCAGGGGCGAGGG + Intergenic
1162042212 19:7977821-7977843 GCAAGGGAGGAGCGGGGCAGAGG + Intronic
1164475721 19:28574518-28574540 ACATGGAAGGAGCAGGAGGAAGG - Intergenic
1164604536 19:29588098-29588120 GCAGGGAAGGAGGGGGGCAAGGG - Intergenic
1165144887 19:33724678-33724700 GCAGGGAAGGAGAGGGGGCAGGG - Intronic
1165152025 19:33766558-33766580 GCATGGAAGCAGCAGGGCAGAGG + Intronic
1165760185 19:38316329-38316351 GTAGGGATGGGGCGGGGCGAGGG - Intronic
1166222825 19:41376691-41376713 GCGGGGACGGGGCGGGGCGACGG - Exonic
1166381345 19:42356838-42356860 GCATGGAAGGAGCGGGGCGATGG - Exonic
1166859572 19:45802017-45802039 GGAGGGAAGGACCGGGGAGATGG + Intronic
1167609486 19:50500439-50500461 GCAGGGCAGGTGCGGGGGGAGGG - Intergenic
1168278774 19:55292456-55292478 TCATGGATGAAGCTGGGCGATGG + Intronic
926174765 2:10580802-10580824 GCATGGAAGGGGCGGTGTGGGGG + Intronic
926220404 2:10932362-10932384 GCCTGGAAGGAGGGGAGCGAGGG - Intergenic
927667351 2:25041977-25041999 GCAGGGGCGGGGCGGGGCGAGGG + Intergenic
929646564 2:43634420-43634442 GCTGGGAAGGATCGGGGTGATGG - Intergenic
930667457 2:54113924-54113946 GCATGGAATGAACTGGGAGATGG + Intronic
932224806 2:70031129-70031151 GCAAGGAAGGAGTGGGGTGAGGG - Intergenic
937306866 2:120877036-120877058 GCCTGGGAGGAGCGGGGCCTCGG + Intronic
938018377 2:127885944-127885966 GCGCGGACGGGGCGGGGCGAAGG + Intergenic
938108893 2:128551343-128551365 GCATGGCAGGAGCAGAGCTAAGG - Intergenic
938260537 2:129892368-129892390 GGATGGAAGGAGGGGAGCCAAGG + Intergenic
939263701 2:139843706-139843728 GCCAGGAAGGATAGGGGCGAGGG + Intergenic
941515586 2:166472110-166472132 GAATGAAAGGAGTGGGGGGAGGG - Intronic
944491665 2:200263775-200263797 GCATGGCAGGAGCAGGAGGAAGG - Intergenic
944952804 2:204771523-204771545 GCAGGGAAGGAGGGGGGCAAGGG + Intronic
946245281 2:218383893-218383915 GCAAGGGAGGAGCTGGGCTAGGG + Intronic
946407315 2:219498564-219498586 CCCTGGAAGGGGCGGGGCCAGGG - Intergenic
946716318 2:222557663-222557685 GCAGGGAAGGAAGGAGGCGATGG + Intronic
948275323 2:236704012-236704034 GCAGGGGAGGGGTGGGGCGAAGG + Intergenic
948359736 2:237411865-237411887 GCAGGGAAAGAGCGGGGCCAAGG + Intronic
948810965 2:240478110-240478132 GCATGGCTGGAGCGGGAGGAAGG - Intergenic
948902993 2:240965541-240965563 GAAGGGAAGGAGCTGGGCGTCGG + Intronic
948905008 2:240975634-240975656 GCATGGAAGGCTGGGAGCGAAGG - Intronic
949047250 2:241877719-241877741 GCATGGGGGGTGGGGGGCGAAGG - Intergenic
1168952253 20:1810473-1810495 GCAGGGAAGGAGACGGGGGAGGG - Intergenic
1169193680 20:3672508-3672530 GCATGGAAGGTTCAGGGTGAGGG - Intronic
1170352706 20:15459611-15459633 CGATGGAAGAAGCTGGGCGAGGG + Intronic
1171020773 20:21582233-21582255 GCAGGCAAGGAGAGGGGCAAGGG - Intergenic
1171192800 20:23171332-23171354 GAAGGGAAGGAGGGGGGCAAGGG - Intergenic
1172641182 20:36441232-36441254 GCATGGCTGGAGCAGGGCAAGGG - Intronic
1172684864 20:36745960-36745982 GCGGGGAAGGAGCAGGGCAAAGG + Intronic
1173137435 20:40451624-40451646 GCATGGAGGGTGAGGGGTGAGGG - Intergenic
1173826014 20:46047982-46048004 GCAGAGAAGGAGTGGGGCGATGG + Exonic
1174354802 20:49990515-49990537 GCAGGGAAGGATCTGGGGGAGGG + Intergenic
1174708844 20:52684412-52684434 GCCTGGAAGGCCGGGGGCGAGGG - Intergenic
1175364989 20:58447009-58447031 GCATGGAAAGAGCGAGCCTAGGG + Exonic
1175383452 20:58579200-58579222 GCATGGCAGCAGCGGGGTTAAGG - Intergenic
1175399567 20:58692820-58692842 GCCGGGCCGGAGCGGGGCGAAGG + Exonic
1175873825 20:62220339-62220361 GCGGGGAGGGGGCGGGGCGAGGG - Intergenic
1175888849 20:62307247-62307269 GCCAGGAAGAAGCGGGGCGGTGG - Intronic
1176286328 21:5021186-5021208 GCCTGGCAGGGGCGGGGCGGGGG - Intergenic
1177277125 21:18926882-18926904 GCAAGGAAGGAGGGGAGGGAGGG - Intergenic
1178988102 21:37326038-37326060 GGAGAGAAGGAGCGGGGCAAGGG + Intergenic
1179870853 21:44242289-44242311 GCCTGGCAGGGGCGGGGCGGGGG + Intergenic
1179976065 21:44867395-44867417 GTATGGAGGGAGGGGGGCAATGG + Intronic
1180799269 22:18624237-18624259 GCATGGCAGCAGCTGGGTGATGG + Intergenic
1181024846 22:20122307-20122329 GAATGGAAGGAGCGAGGCACTGG + Exonic
1181222449 22:21371029-21371051 GCATGGCAGCAGCTGGGTGATGG - Intergenic
1181309073 22:21933971-21933993 GCTTCGGAGGACCGGGGCGAGGG - Intronic
1181638205 22:24184015-24184037 GCATGGCAGCAGCTGGGTGATGG - Intronic
1182123935 22:27802924-27802946 GTAGGGAAGGAGGGGGGAGAAGG + Intergenic
1182564458 22:31186986-31187008 GCATGGAAGCTGGGGGGAGAGGG + Intronic
1183749439 22:39711435-39711457 GGGTGGGGGGAGCGGGGCGAGGG + Intergenic
1184655820 22:45941658-45941680 GGATGGCAGGAGAGAGGCGAGGG + Intronic
1184742614 22:46437872-46437894 GCAGGGAATGAGCAGGGAGAAGG + Intronic
1184889084 22:47368609-47368631 GCATGGAGGGAAAGGGGCGAGGG - Intergenic
949414542 3:3800382-3800404 GCAAGGAAGGTGGCGGGCGACGG + Intronic
953136889 3:40189493-40189515 GCCTGGAAGGGGAGGGGAGAGGG - Intronic
953610740 3:44445491-44445513 GAAGGGAAGGAGAGGGGCCAGGG - Exonic
958878123 3:99638506-99638528 GCAGGGAAGGAGCGGCGGGCGGG - Exonic
960388455 3:117049827-117049849 GAAGGGTAGGAGGGGGGCGAGGG + Intronic
961735797 3:129001564-129001586 CCCTGGAAGTGGCGGGGCGAAGG + Intronic
963732427 3:148986642-148986664 GCCTGGGAGGTGGGGGGCGAGGG + Intergenic
966007297 3:175031266-175031288 GTATGGAAGGAGGGAGGCAAGGG - Intronic
966505678 3:180698790-180698812 GCATGGCAGGAGCAGTGTGAAGG + Intronic
966512629 3:180781288-180781310 GCATGGCAGCAGCGGGGTGGTGG + Intronic
968576127 4:1366996-1367018 GCCTGGAAGGCGCGGGGTGGTGG - Intronic
968916720 4:3499902-3499924 GTTGGGAAGGTGCGGGGCGAGGG + Intronic
969600186 4:8171509-8171531 GCAGGGAAGGAGCAGGGAGCAGG + Intergenic
969977361 4:11117234-11117256 GAATGGCAGGTGCGGGGTGAGGG - Intergenic
971788888 4:31141809-31141831 GCATGGTAGGAGGGGGGTGAGGG + Intronic
973298947 4:48558910-48558932 GCATGGAAAGAGAGGAGCAAAGG - Intronic
973739280 4:53903370-53903392 GGAGGGAAGGAGGGGGGGGAAGG + Intronic
975504384 4:75122412-75122434 GGAAGGAAGGAGAGGGGAGAGGG + Intergenic
981042646 4:140237698-140237720 GAAGGGGAGGAGCGGGACGAGGG - Intergenic
984667983 4:182448786-182448808 GCGTGTGTGGAGCGGGGCGAGGG + Intronic
985643542 5:1074648-1074670 GCCGAGAAGGAGTGGGGCGATGG - Exonic
991264650 5:64703009-64703031 GCATGACAGGAGAGGGGAGATGG - Intronic
992023568 5:72649374-72649396 GCAGGGGAGGAGCAGGACGAGGG - Intergenic
993651733 5:90529807-90529829 GCACGGAAGGAGCGGAGTCAAGG - Intronic
994633212 5:102311912-102311934 TCATGGAAGGTGTGGGGTGAAGG - Intergenic
996696946 5:126408090-126408112 GCAGGGAAGGAGGGGAGCAAGGG - Intronic
996719118 5:126612807-126612829 GCATGGTAGCAGTGGGGTGAAGG + Intronic
997239388 5:132295363-132295385 GCATGGGAGGAGGGGTGTGAGGG + Intronic
997291166 5:132737000-132737022 GCAGGGAGGCAGCGGAGCGAAGG - Intronic
999093585 5:148958567-148958589 GGATGGAAAGAGCTGGGCCAGGG + Intronic
999484199 5:151978319-151978341 GAAGGGTAGGAGAGGGGCGAGGG - Intergenic
999533266 5:152486303-152486325 GAAGGGAAGGAGTGGGGCAAAGG + Intergenic
1001083478 5:168683843-168683865 GCGTGGTAGGGGCGGGGAGAAGG + Intronic
1001342589 5:170861816-170861838 GGAGGGACGGGGCGGGGCGACGG - Intergenic
1001961924 5:175884649-175884671 GCATGGAAGGAGAGGGGTGGGGG - Intergenic
1005332208 6:24761301-24761323 GCAGGGATGGGGCGGGGCCAAGG + Intergenic
1006406715 6:33849823-33849845 GCCTGGAAGGTGCCGGGGGATGG - Intergenic
1006441917 6:34058424-34058446 GCAGGGAAGGAGAGGGCCCAGGG + Intronic
1006470021 6:34223497-34223519 GAGGGGAAGGGGCGGGGCGAAGG + Intergenic
1006620837 6:35362834-35362856 TCATGGAAAGAGTGGGGCCAGGG - Intronic
1007166522 6:39832285-39832307 GCATAGGAGGAGAGGGGAGAAGG - Intronic
1007314246 6:40972198-40972220 GGATGGAAGGAGAGGGGCAAGGG - Intergenic
1007417585 6:41700975-41700997 GCATGGCAGGACAGGGACGAGGG + Intronic
1009626031 6:66139671-66139693 GTATGGGTGGAGCGGGGCCATGG + Intergenic
1010395852 6:75391159-75391181 GCATGGAAGGAGGAGGGTGAAGG - Intronic
1011271843 6:85587953-85587975 GCAGGGGAGGAGCGGGGGGCAGG + Intronic
1011423653 6:87202737-87202759 TCATGGATGGGGCGGGGGGAAGG - Intronic
1013177631 6:107690908-107690930 GCATGGGAGGGGTGGGGTGAGGG + Intergenic
1013800770 6:113939299-113939321 GCATGGTGGGAGGGGGGCGAGGG + Exonic
1017237886 6:152136348-152136370 TCATAGAAGGAGCGTTGCGACGG + Intronic
1017793514 6:157822673-157822695 GCTGGGAAGGAGCGGAGCGATGG - Intronic
1018774274 6:166999130-166999152 GCACGCAAGGGGCGGGGCGTCGG - Intergenic
1019163896 6:170086864-170086886 GCATGGCGGGAGCGGGCCTATGG - Intergenic
1019742355 7:2681114-2681136 GCAGGGCTGGAGCGGGGCCATGG + Intronic
1021697127 7:23286348-23286370 GAGTGGAAGGAGGGGGGAGAGGG - Intergenic
1022507402 7:30915546-30915568 GCATGGGAGGAGGGTGGTGAGGG + Intronic
1023740135 7:43273175-43273197 GGATGGAGGGAGTGGGGCAAGGG + Intronic
1024644983 7:51363372-51363394 CCATGGAAGGACAGGGGAGATGG + Intergenic
1025603542 7:63022784-63022806 GCAGGGAAGGAGAGGGGCCTTGG - Intergenic
1025887168 7:65607163-65607185 GGATGGAGGGAGTGGGGCGAGGG - Intergenic
1028199719 7:87947057-87947079 GAAGGGAAGGAGAGGGGCAAGGG + Intronic
1029550515 7:101234847-101234869 GCATGGGAGGAGTGGGGAGCAGG - Intronic
1029959566 7:104675393-104675415 GCAGGGAAGGAGTAGAGCGAAGG - Intronic
1031855247 7:126914770-126914792 GGATGGAGGGAGTGGGGCAAGGG + Intronic
1033797655 7:144866797-144866819 GGATGGAGGGAGCGGGGCAAGGG - Intergenic
1034244598 7:149634889-149634911 GCCTGGAAGGAACGGGGCAGAGG + Intergenic
1034508908 7:151519189-151519211 GCGTGGGAGGCGCGGGGCGGGGG - Intronic
1035338080 7:158142845-158142867 GCGTGGAAGGAGCTGGGGCATGG - Intronic
1035389689 7:158496609-158496631 GCAGGGAAGGGGAGGGGCGCAGG - Intronic
1035637866 8:1160740-1160762 GCATGGAAGGAGCCAGGCTCGGG - Intergenic
1036364815 8:8111027-8111049 CCATGGAAGGAGCTGGGAGGGGG + Intergenic
1036603509 8:10285644-10285666 GCGGGGAAGGAGTGGGGGGAAGG - Intronic
1037305244 8:17497305-17497327 GCGGGGAAGGAGCGGGGCGAGGG + Intronic
1041147008 8:54887574-54887596 GGAGGGAAGGAGTGGGGCAAGGG - Intergenic
1041447073 8:57964176-57964198 ACAAGGAAGGAGCGGGGAAAAGG - Intergenic
1041753549 8:61288186-61288208 GCATCGAAAGAGCGGGGGAAAGG - Intronic
1043242490 8:77953009-77953031 GCATGGTGGGGGCGGGGTGATGG - Intergenic
1044343681 8:91077588-91077610 GCAAGGATGGAGTGGGGTGACGG - Intronic
1047998496 8:130358301-130358323 GGAGGGAAGGAGGCGGGCGAAGG + Intronic
1048336181 8:133504100-133504122 GCATGGAAGGTGGGGAGGGAGGG + Intronic
1048902389 8:139051203-139051225 GAATGGAAGGAGCGGAGGCAAGG + Intergenic
1051855975 9:21565836-21565858 GCATGGGAGGATGGGGGTGAGGG - Intergenic
1052278070 9:26701240-26701262 GGATGGAAGGAGAGGGGCAAGGG + Intergenic
1052883644 9:33622643-33622665 GCATGGCAGGAGCTGGGGGGAGG + Intergenic
1053329375 9:37188969-37188991 GAAAGGAAGGAGTGGGGAGAGGG - Intronic
1053752737 9:41273347-41273369 GCATAGGAGGAGCCGGGCGGGGG - Intergenic
1054258262 9:62837699-62837721 GCATAGGAGGAGCCGGGCGGGGG - Intergenic
1054333509 9:63782342-63782364 GCATAGGAGGAGCCGGGCGGGGG + Intergenic
1055787402 9:79885074-79885096 GCAGGGAGAGAGTGGGGCGAGGG + Intergenic
1056681097 9:88719963-88719985 GCATGGAAGGAGCGTGGGTTTGG - Intergenic
1057489699 9:95511296-95511318 TGAGGGAGGGAGCGGGGCGAGGG - Intronic
1058153363 9:101486318-101486340 GAAGGGAAGGAGCGCAGCGATGG - Intronic
1058280714 9:103110003-103110025 GCAGGGAAGGAGGAGGTCGAGGG + Intergenic
1059386626 9:113969636-113969658 GGATGGCAGGAGAGGGGAGAGGG + Intronic
1059430306 9:114245974-114245996 GCATGGAGGGTGCTGGGCAAAGG - Intronic
1061016006 9:127981029-127981051 GCACGGCAGGGGCGGGGCGCCGG + Intergenic
1061508327 9:131045458-131045480 GCCAGGAAGGGGCGGGGCCAGGG - Intronic
1062365767 9:136208255-136208277 GCGTGGGGGGAGCGGGGGGAGGG + Exonic
1062696201 9:137877616-137877638 GGGTGGGAGGCGCGGGGCGAGGG + Intergenic
1186373617 X:8972662-8972684 TCATGGAAAGAACGGGGCCAAGG + Intergenic
1187094002 X:16127442-16127464 GCATGGGAGGAGAGGGAGGATGG - Intronic
1187586650 X:20669975-20669997 GAAGGGTAGGAGTGGGGCGAGGG - Intergenic
1188064821 X:25646110-25646132 GAATGGAAGGAGCGAGGCACTGG - Intergenic
1188201375 X:27295823-27295845 GTCTGGGAGGGGCGGGGCGATGG + Intergenic
1188230271 X:27653971-27653993 GCCTGGAAGGAGAGGGGAAACGG - Intronic
1193261098 X:79407008-79407030 GGAGGGAAGGAGCGGGGCTAGGG + Intergenic
1193387954 X:80893333-80893355 GCAAGGCAGGAGCGAGGCTAGGG - Intergenic
1193803441 X:85965458-85965480 GCACAGAAGGAGCGGTGCTAAGG - Intronic
1199067712 X:143440146-143440168 GCTTGGAAGAAGTGGGGGGATGG - Intergenic
1200281105 X:154777862-154777884 GCCTGGCAGGAGCGGGGGGCAGG + Intergenic