ID: 1166381346

View in Genome Browser
Species Human (GRCh38)
Location 19:42356844-42356866
Sequence GCGGCTGCATGGAAGGAGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381346_1166381359 17 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381346_1166381358 16 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381346_1166381351 -8 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55
1166381346_1166381360 18 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381346_1166381353 -2 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1166381346_1166381361 19 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381346_1166381357 15 Left 1166381346 19:42356844-42356866 CCCCGCTCCTTCCATGCAGCCGC 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381346 Original CRISPR GCGGCTGCATGGAAGGAGCG GGG (reversed) Exonic
900533907 1:3167862-3167884 GCGGGAGGATGGCAGGAGCGGGG - Intronic
900533927 1:3167920-3167942 GCGGGAGGATGGCAGGAGCGGGG - Intronic
900533967 1:3168038-3168060 GCGGGAGGATGGCAGGAGCGGGG - Intronic
900534027 1:3168214-3168236 GCGGGAGGATGGCAGGAGCGGGG - Intronic
900915944 1:5638686-5638708 GGAGCTGCATGGAAGGAGGCTGG + Intergenic
907541801 1:55222300-55222322 GCTGGTGCCTGGAAGGAGCGTGG - Intergenic
907855876 1:58303162-58303184 GAGGCTGCTTGGAAGGAGGTTGG - Intronic
908423679 1:63984184-63984206 GTGGCTGAATGGTAGGAGCTAGG + Intronic
909747380 1:79114100-79114122 GCAGCTGCACTGAAGGAGCAAGG + Intergenic
914825738 1:151137122-151137144 CCAGCTGCATGCAAGGAGTGTGG + Intronic
915095183 1:153457526-153457548 GTGGCTGCATTTAGGGAGCGGGG + Intergenic
918224959 1:182472779-182472801 AAGGCTGGCTGGAAGGAGCGGGG + Intronic
919787429 1:201268713-201268735 GCTGCTGCAGGGAGGGAGGGCGG + Intergenic
919944521 1:202309607-202309629 GCTGCTGCATGGAAGAGGCCTGG - Intronic
920037562 1:203075866-203075888 GCAGCTGCAGCGCAGGAGCGCGG - Intronic
920698941 1:208203299-208203321 GAGCCTGCATGGAAGGGGTGGGG - Intronic
922335749 1:224617084-224617106 GCGGCTCCTTGGAGGGAGTGCGG + Exonic
923042892 1:230332657-230332679 GCGGCTGTGTGGAAGCAGCGGGG - Intronic
923429340 1:233905368-233905390 GCGGCGGGAAGGGAGGAGCGCGG + Intronic
924901219 1:248402627-248402649 GCTGCTGCATTGAAGGAGCATGG + Intergenic
1062982531 10:1737201-1737223 GCGGCTGCCGGGAAGGAGGCAGG - Exonic
1065798794 10:29332094-29332116 ACTGCTGCATGGAAGGAGCATGG + Intergenic
1066050832 10:31633366-31633388 GCAGGTGCATGGAAGGAGGGAGG - Intergenic
1068713365 10:60157925-60157947 GCAGCGGCAGGGAAGGAGGGAGG + Intronic
1069865919 10:71502788-71502810 GCTGCTGCAAGGAGGGAGCAGGG + Intronic
1069909136 10:71749244-71749266 GGGCCTGCATGGCAGGAGTGGGG - Exonic
1074065370 10:110008247-110008269 GCGGCTGCCGAGAAGGAGGGAGG + Exonic
1075226584 10:120634828-120634850 GAGGATGCAGGGAAGGACCGAGG - Intergenic
1075849410 10:125574866-125574888 TGGGCTGAAAGGAAGGAGCGGGG + Intergenic
1076402011 10:130190723-130190745 GCGGCTGCCGGGAAGCAGGGCGG + Intergenic
1076444285 10:130501272-130501294 GCTGCTGCCTGGAAGGAAGGGGG + Intergenic
1076768084 10:132647691-132647713 GCGGCTGCCTTGGAGGAGGGTGG + Intronic
1078445077 11:11397933-11397955 GCGGCTGAATGGAAGCTGAGGGG - Intronic
1080178520 11:29394994-29395016 CCAGCTCCATGGAAGGAGTGAGG - Intergenic
1081684419 11:45032032-45032054 GCAGCTAGATGGAAGGAGCCTGG - Intergenic
1082870778 11:57942604-57942626 GGGGCTGCAGGGAGGGAGCAGGG - Intergenic
1083644902 11:64166372-64166394 GGGGCTGCGTGGAAGGCCCGGGG - Intergenic
1083881114 11:65548711-65548733 CAGGCTGCATGGCAGGAGTGAGG - Intronic
1083926407 11:65809646-65809668 GCGGCTTCAGGGTAGGAGCATGG - Intergenic
1087211760 11:95452139-95452161 GCCACTGTATGGAAGGAGCCTGG + Intergenic
1089076809 11:115745151-115745173 GCAGCTGCAGGGGAGGAGCAGGG - Intergenic
1089300784 11:117497621-117497643 GCTGCTGGAGGGAAGGAGGGAGG - Intronic
1090502297 11:127273270-127273292 GGGGGTGCAAGGAAGGAGCAAGG + Intergenic
1093005052 12:14042496-14042518 GTGTCTGCATGGACGCAGCGGGG + Intergenic
1096157271 12:49347663-49347685 GGGGCTGCCTGGCAGGAGCAAGG - Exonic
1096771564 12:53939013-53939035 GCGGCGGCACGGGCGGAGCGGGG + Exonic
1098077628 12:66749824-66749846 GCAGCAGCATAGAAGGAGCCTGG + Intronic
1098904806 12:76150977-76150999 GCAGCAGCAAGGAAGGAGTGGGG + Intergenic
1103459059 12:121089453-121089475 GTAGCTCCCTGGAAGGAGCGAGG - Intergenic
1104311121 12:127655149-127655171 CCGGCTGCCCGGGAGGAGCGTGG - Intergenic
1104815857 12:131645015-131645037 TCGGCTGCCTGGAAGAAGGGAGG + Intergenic
1106786009 13:33108686-33108708 CCGGATGGATGGAAGGAGGGAGG + Intronic
1107462398 13:40616728-40616750 GAGGCTGCATGCAAGGGGTGTGG + Intronic
1108077715 13:46698952-46698974 GGGGCTGCCGGGAAGGAACGAGG - Intronic
1109844656 13:67971429-67971451 TCTGCTGCATGGAAGGAATGTGG + Intergenic
1110254370 13:73416270-73416292 GAGGCAGCAAGGAAGGAGGGCGG + Intergenic
1113827533 13:113268184-113268206 CCAGCAGCATGGAAGGAGCATGG + Intergenic
1113914767 13:113863738-113863760 GCGGCTGCCCGGAGGGAGAGAGG + Exonic
1117286651 14:54291918-54291940 GCTGCTGCCTGGGAGGAGGGAGG - Intergenic
1118473767 14:66098788-66098810 GGGGCTCCATGAAAGGAGAGAGG - Intergenic
1119265016 14:73259381-73259403 GCTGCTGCAGAGAGGGAGCGGGG - Exonic
1121182574 14:91940613-91940635 GTGCCTGCAGGGAAGGAGAGAGG + Exonic
1122324822 14:100875735-100875757 GCGGGTGCATGGGGGAAGCGGGG - Intergenic
1124552324 15:30693120-30693142 GGGGCAGCGTGGAAGGAGAGAGG + Intronic
1124678915 15:31712546-31712568 GGGGCAGCGTGGAAGGAGAGAGG - Intronic
1128585771 15:68848992-68849014 GTGGATGCATGGGAGGAGAGGGG + Intronic
1129737460 15:77974159-77974181 GCGGTTGAATGGGAGGAGCCTGG + Intergenic
1130975151 15:88768231-88768253 GGGGCTGCATGGCAGGGGAGGGG + Intergenic
1131423579 15:92327226-92327248 GCTGCTGCATGGAGGGTGGGTGG - Intergenic
1131595355 15:93792639-93792661 GCGACTGCAAGGCAGCAGCGAGG + Intergenic
1132359715 15:101202126-101202148 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132359799 15:101202504-101202526 GAGGCTGCAGGGAAGGATGGAGG + Intronic
1132976515 16:2713838-2713860 CCTGCTGCCTGGAAGGAGGGAGG - Intronic
1133594021 16:7273063-7273085 GCGGAAGGATGGAAGGAGGGAGG - Intronic
1135246438 16:20861229-20861251 GTGGCTTCATGGAGGGAGAGAGG + Intronic
1135246451 16:20861300-20861322 GTGGCTTCATGGAGGGAGAGAGG + Intronic
1135246465 16:20861371-20861393 GTGGCTTCATGGAGGGAGAGAGG + Intronic
1135246479 16:20861442-20861464 GTGGCTTCATGGAGGGAGAGAGG + Intronic
1136289691 16:29264187-29264209 GAGGGTGCATGGCAGGAGCAAGG - Intergenic
1136289717 16:29264280-29264302 GAGGGTGCATGGCAGGAGCACGG - Intergenic
1136478205 16:30526250-30526272 GTGGCTCCAGGGAGGGAGCGAGG - Intronic
1138544362 16:57706869-57706891 GAGGATGCATGGGAGGAGAGAGG - Intronic
1140609828 16:76584562-76584584 GCAGCTGCATGGATGCAGCTGGG - Intronic
1141857476 16:86693577-86693599 AGGGCTGCATGGAAGGAGATGGG + Intergenic
1142359335 16:89619220-89619242 GGGGCTGCAGGGAGGGAGCAGGG - Intronic
1143436743 17:6934310-6934332 GCAGCAACATGGAAGGAGCTGGG - Intronic
1145275286 17:21425494-21425516 GCGGCTGAGTGGAAGGAGCCAGG + Intergenic
1145758370 17:27409254-27409276 GCGCCTCCATGGAAGGTGCAGGG - Intergenic
1145776021 17:27529524-27529546 GCAGGAGCATGGCAGGAGCGTGG - Intronic
1146138214 17:30341650-30341672 GCAGATGCATGGAAGGAGCTGGG + Intergenic
1146888226 17:36486645-36486667 GCGGCTGCGTGAGAGGCGCGCGG + Exonic
1147179508 17:38675110-38675132 GCGGCGGCTGGGAGGGAGCGCGG + Exonic
1147819702 17:43234414-43234436 GAGGCTCCAGGGCAGGAGCGCGG + Intergenic
1148106532 17:45121611-45121633 GCCGCTGCTTGGAAGGAAGGAGG - Intronic
1150441830 17:65197548-65197570 GAGGCTGACTAGAAGGAGCGGGG - Intronic
1151515545 17:74592669-74592691 GGGGCTGCCTGGAAGAAGCCTGG - Exonic
1151516478 17:74599352-74599374 GGGGCTGCCTGGAAAGAGCCTGG + Intergenic
1151805581 17:76402928-76402950 GGGGCTGCCTGGAGGGAACGGGG + Intronic
1151876379 17:76869902-76869924 GCGGATGCCTGGGAGGAGAGGGG - Intronic
1152917842 17:83051320-83051342 GCGGGCGCGGGGAAGGAGCGCGG + Intronic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1157579582 18:48765536-48765558 CCGGCAGCATGGAGGGAGAGGGG + Intronic
1159467483 18:68803602-68803624 GCAGCTGCTGGGAATGAGCGAGG + Intronic
1160709619 19:544993-545015 GTGGATACATGGAAGGAGGGAGG - Intronic
1160818657 19:1047801-1047823 GTGGCTGCATTGGAGGGGCGGGG + Intronic
1160977449 19:1800335-1800357 GGGGGTGCATGGGAGCAGCGTGG - Exonic
1161202688 19:3024820-3024842 GGGGCTGCAGGGATGGAGGGAGG - Intronic
1161303168 19:3552902-3552924 AGGGCTGCAGGGAAGGAGCCTGG - Intronic
1162316995 19:9945607-9945629 GAGGCTGCAAGGAGGGAGTGAGG + Intergenic
1166175418 19:41065301-41065323 GCAGCAACATGGAAGGAGCCTGG + Intergenic
1166381346 19:42356844-42356866 GCGGCTGCATGGAAGGAGCGGGG - Exonic
1166844278 19:45717338-45717360 GTGGCCGGAGGGAAGGAGCGAGG - Intronic
1166932343 19:46308761-46308783 GCGGCCACCTGGAAGGTGCGTGG + Exonic
1167674818 19:50877582-50877604 GGGGCTGCATGGCTGGAGTGAGG + Intronic
925554979 2:5120984-5121006 GCGGCTCCCTGGAGGGAGAGAGG - Intergenic
925894840 2:8463200-8463222 CCGGCTGCAGGAAAGGAGCCCGG + Intergenic
926718835 2:15943556-15943578 GCTGCTGAATGGAGGGAGGGAGG - Intronic
927444746 2:23149335-23149357 GCAGCTGCAGGGAGGGAGGGTGG - Intergenic
927810847 2:26179529-26179551 GGGGCTGGAAGGGAGGAGCGAGG + Intronic
928095374 2:28401559-28401581 GCTGCTGGATGGGAGGGGCGGGG - Intronic
930798684 2:55419984-55420006 GCAGCTGCACGGGAGGGGCGGGG - Intergenic
932236567 2:70125273-70125295 GCGGCAGCGTGGCAGGAGCGAGG - Intergenic
932380324 2:71276470-71276492 TCGGCTGCAGGGGAGGAGCTGGG + Intergenic
936389114 2:112055617-112055639 GCGGCGGCGTGGCAGGAGCCCGG - Exonic
936497384 2:113034320-113034342 GCATATGCATGGAAGAAGCGAGG - Intronic
937236872 2:120436540-120436562 GCTGCTGCAGGGGAGGGGCGGGG - Intergenic
938578276 2:132623389-132623411 GCGCCTGAAGGGAAGGAGAGAGG + Intronic
942461654 2:176172371-176172393 GCGGCGGCAGGGCAAGAGCGGGG - Exonic
943369963 2:187003430-187003452 GCGGCAGCATGGCCGCAGCGCGG - Intergenic
944311328 2:198236991-198237013 GCTGCAGCAAGGAAGGAGCCAGG + Intronic
948079985 2:235198121-235198143 GGGGCAGCCTGGAAGGAGTGTGG + Intergenic
948262596 2:236615166-236615188 GCAGCTGCAGGGAAGCAGCAGGG - Intergenic
1172788889 20:37488707-37488729 GAAGCTCCATGGAAGGAGGGTGG - Intergenic
1173853349 20:46232893-46232915 GTGGCTGCATGGGAGGAGGCAGG + Intronic
1174993416 20:55538922-55538944 GATGCTGCAGGGAAGGAGTGAGG - Intergenic
1176382005 21:6118348-6118370 GCGGCTGCCTGGCAGGCCCGGGG - Exonic
1179626239 21:42651087-42651109 GAGGGTGCATGGAAGGGGCCAGG - Intergenic
1179741467 21:43419891-43419913 GCGGCTGCCTGGCAGGCCCGGGG + Exonic
1180705768 22:17808874-17808896 GCGGCTGGAGGAAAGGGGCGTGG - Exonic
1181433876 22:22899196-22899218 GCCTCTGCATGGGAGGAGAGGGG + Intergenic
1181459846 22:23079440-23079462 GAGGCAGCATGGCAGGAGTGGGG + Intronic
1182301161 22:29337873-29337895 GCGTCTGCAGGGAAGGGGTGGGG - Intronic
1183411683 22:37658700-37658722 GCGGCTGCGTGGAACGTGCCAGG + Intronic
1183544691 22:38449165-38449187 GCTGTTGCATGGAAGGAAAGGGG + Intronic
1183779325 22:39988714-39988736 GTGGCAGCAGGGAAGGAGGGAGG + Intergenic
1184103547 22:42354273-42354295 GTGGCTGCAGGGAAGTGGCGGGG - Intergenic
949820482 3:8110881-8110903 GCAACTGCATGGAGGGAGGGGGG - Intergenic
950464378 3:13144640-13144662 GGGGCAGCATGGAAGGGACGCGG - Intergenic
950471112 3:13186973-13186995 GCGGCAGGAAGGAAGGAGGGAGG - Intergenic
951217730 3:20040506-20040528 GCGGCTGCGGGGCAGGAGCCGGG + Exonic
953889805 3:46743363-46743385 GAGTCTGCAGGGAAGCAGCGCGG - Intronic
953929991 3:47001082-47001104 GAGGCTGCCTGGCGGGAGCGTGG + Exonic
953989886 3:47475851-47475873 GCGGCAGCAGGGGCGGAGCGCGG + Exonic
955916326 3:63912122-63912144 GCGGACGGAAGGAAGGAGCGGGG + Intronic
960710117 3:120519361-120519383 GAGGCTGCATGGGAAGAGCATGG + Intergenic
961415678 3:126754906-126754928 GTGGCTGCAAGGAGGGAGTGTGG + Intronic
962811157 3:138960576-138960598 GCCTCTGCGGGGAAGGAGCGCGG - Intergenic
965597017 3:170419811-170419833 GCGGCTGCGCGGACGGAGCTAGG - Intronic
971456848 4:26853014-26853036 GTTGCTTCATGGTAGGAGCGGGG - Intergenic
978771701 4:112463716-112463738 GCAGCTACATGGATGGAGCTGGG + Intergenic
981444802 4:144823284-144823306 GCAGCAGCATGGATGGAGCTGGG - Intergenic
982712201 4:158768931-158768953 GCGGCGGCGCGGGAGGAGCGCGG - Intergenic
987739081 5:21882555-21882577 GCGGCTGCAGGGCATGCGCGCGG - Intronic
992218349 5:74547399-74547421 GAGGCTGCATGGAAGAGGGGAGG + Intergenic
992392012 5:76338163-76338185 GTGGCTGCAGGGCAGGAGCCTGG - Intronic
995319301 5:110813910-110813932 GGGGCTGCGTGGAAGAAGAGGGG + Intergenic
998216721 5:140243140-140243162 GCTGCTGAATGGAAGGAGGGTGG - Intronic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1001543087 5:172552729-172552751 GAGGCTTCTTGGAAGAAGCGAGG + Intergenic
1001547866 5:172581631-172581653 GAGGCTGGAGGGAAGGAGGGAGG - Intergenic
1001961928 5:175884655-175884677 GAGGGTGCATGGAAGGAGAGGGG - Intergenic
1002641353 5:180632078-180632100 GCGGCTGGCATGAAGGAGCGGGG + Intronic
1003315014 6:5004067-5004089 GCGGCCGGAGGGAAGGGGCGGGG - Intergenic
1005464222 6:26096032-26096054 GTGGCTCCATGGAAGGACCTGGG - Exonic
1007350744 6:41271911-41271933 GCTGCTGCAGGTAAGGAGAGTGG - Intronic
1010340290 6:74742653-74742675 GTGGCTGCATGGAAATAGAGTGG - Intergenic
1013048335 6:106509736-106509758 GTGGCTGAATGGAAGGAGCATGG + Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1021149803 7:17135531-17135553 CAGCCTGCATGGAAGGAGTGGGG + Intergenic
1022507400 7:30915540-30915562 GGGGGTGCATGGGAGGAGGGTGG + Intronic
1024633481 7:51268073-51268095 GCGCCTGCAGGGCAGGAGGGAGG - Intronic
1024681859 7:51698604-51698626 GCTGCTACATGGAAGGTGCTTGG + Intergenic
1025028043 7:55534409-55534431 GCAGCTGCGTGTAGGGAGCGGGG + Intronic
1025284977 7:57653712-57653734 GCGGTTGCATGGCGGCAGCGAGG + Intergenic
1026935823 7:74254681-74254703 GCGGCGGCGTGGGAGGAGCAGGG + Intergenic
1029984115 7:104905917-104905939 GAGGCTGCTTTGAAGGAGCAAGG - Intronic
1034344778 7:150379477-150379499 GAGGCAGCACGGGAGGAGCGGGG - Intronic
1034818378 7:154194539-154194561 CTGGCTGCCTGGGAGGAGCGAGG - Intronic
1035389606 7:158496406-158496428 GAGGCTGCAGGGAAGGGGAGGGG - Intronic
1035788192 8:2279084-2279106 ACAGCTGCATGGCAGGAGGGTGG + Intergenic
1035804615 8:2442621-2442643 ACAGCTGCATGGCAGGAGGGTGG - Intergenic
1038008815 8:23457633-23457655 GCGGCTCCAGGAAAGGAGCGCGG - Exonic
1039615521 8:38952115-38952137 GTGGCTGCATAGAGGGAGGGAGG + Intronic
1049929881 9:446165-446187 GGGGCTGCAAGGAGGGAGAGGGG - Intronic
1053052841 9:34976243-34976265 GGTGCTGCATGGATGGAGAGGGG + Intronic
1053679690 9:40476690-40476712 GCGGCAACATGGATGGAGCTTGG + Intergenic
1053833405 9:42108609-42108631 GTGGCTGCATGGAAGGTGGCAGG - Intronic
1054284030 9:63148255-63148277 GCGGCAACATGGATGGAGCTTGG - Intergenic
1054292772 9:63312226-63312248 GCGGCAACATGGATGGAGCTTGG + Intergenic
1054390790 9:64616701-64616723 GCGGCAACATGGATGGAGCTTGG + Intergenic
1054504932 9:65899608-65899630 GCGGCAACATGGATGGAGCTTGG - Intergenic
1054597145 9:67078802-67078824 GTGGCTGCATGGAAGGTGGCAGG + Intergenic
1057057187 9:91972499-91972521 GGGGCTGAATGGAGGGAGCCAGG + Intergenic
1057835686 9:98443198-98443220 GAGGCTCCTTGGAAGGAGCCAGG - Intronic
1062106617 9:134758359-134758381 GAGGCTGCCTGGAAGGAGAAGGG - Intronic
1062687246 9:137820138-137820160 GTGGCTGCAGGGACGGAGCCTGG - Intronic
1186496499 X:10015709-10015731 GCGGCGGCGCGGAAGGAGCTGGG - Exonic
1189204041 X:39222459-39222481 GCAGCTGCAGGGAGGGAGAGGGG - Intergenic
1191937356 X:66439837-66439859 GAGGGAGCATGGAAGGAGGGAGG + Intergenic
1192546478 X:72018680-72018702 GAGGCTGCTTGGAAGCAGCCGGG + Intergenic