ID: 1166381347

View in Genome Browser
Species Human (GRCh38)
Location 19:42356845-42356867
Sequence TGCGGCTGCATGGAAGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1380
Summary {0: 1, 1: 0, 2: 6, 3: 91, 4: 1282}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381347_1166381353 -3 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1166381347_1166381358 15 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381347_1166381363 30 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381363 19:42356898-42356920 CTGCTGGGGGGACTTACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1166381347_1166381361 18 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381347_1166381351 -9 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55
1166381347_1166381360 17 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381347_1166381359 16 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381347_1166381357 14 Left 1166381347 19:42356845-42356867 CCCGCTCCTTCCATGCAGCCGCA 0: 1
1: 0
2: 6
3: 91
4: 1282
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381347 Original CRISPR TGCGGCTGCATGGAAGGAGC GGG (reversed) Exonic
900247916 1:1647636-1647658 TGCAGCTGCGTGAAAGGACCTGG - Intronic
900956740 1:5890775-5890797 TCTGTCTGCTTGGAAGGAGCGGG - Intronic
901894659 1:12300555-12300577 TGCAGCAACATGGATGGAGCTGG - Intronic
901962258 1:12836783-12836805 TGCGACAACATGGAAGGAACTGG + Intergenic
902167295 1:14582949-14582971 TGGGGCTGCAGGGATGGAGGAGG - Intergenic
902262092 1:15233842-15233864 TGCAGCAACATGGATGGAGCTGG - Intergenic
904035493 1:27556501-27556523 GGCGGCTGAAGGGAAGGAGGTGG - Intronic
904379977 1:30104017-30104039 TGAGGCTTCCTGGAAGGAGGAGG + Intergenic
904979061 1:34481208-34481230 TGCAGCAACATGGATGGAGCTGG + Intergenic
906585333 1:46971219-46971241 TGCAGCAACATGGATGGAGCAGG - Intergenic
906765529 1:48428026-48428048 TGCAGCAGCATGGATGCAGCTGG - Intronic
906836769 1:49091875-49091897 TGCAGCAACATGGATGGAGCTGG + Intronic
907572173 1:55493356-55493378 TGCAGCAACATGGATGGAGCTGG - Intergenic
908111326 1:60901399-60901421 TGCAGCAACATGGATGGAGCTGG - Intronic
908819865 1:68074338-68074360 TGTGGCAACATGGATGGAGCTGG - Intergenic
909181042 1:72424465-72424487 TGCAGCTACATGGATGGAGATGG + Intergenic
909322407 1:74306181-74306203 TGCAGCAACATGGATGGAGCTGG - Intronic
909399615 1:75212488-75212510 TGCAGCAACATGGATGGAGCTGG - Intronic
909420216 1:75456200-75456222 TGCAGCAACATGGAAGCAGCTGG + Intronic
910082419 1:83356516-83356538 TGCAGCAACATGGATGGAGCTGG - Intergenic
910166370 1:84332028-84332050 TGCAGCAACATGGATGGAGCTGG - Intronic
910254263 1:85231551-85231573 TGCAGCAGCATGGATGGAGCTGG - Intergenic
910512236 1:88020238-88020260 TGCAGCAACATGGATGGAGCTGG - Intergenic
912098461 1:106174894-106174916 TGCAGGGGCATGGATGGAGCTGG + Intergenic
912216240 1:107616283-107616305 TGCAGCAGCATGGGTGGAGCTGG + Intronic
912256416 1:108063415-108063437 TGCAGCAACATGGATGGAGCTGG + Intergenic
912301632 1:108522905-108522927 TGCAGCAACATGGATGGAGCTGG - Intergenic
912592466 1:110838214-110838236 TGCAGCAACATGGAAGAAGCTGG - Intergenic
912647818 1:111411573-111411595 TGTGGGAGCATGGATGGAGCTGG + Intergenic
913035213 1:114958133-114958155 TGCAACTACATGGATGGAGCTGG + Intronic
913341644 1:117763782-117763804 TGCAGCAACATGGATGGAGCTGG - Intergenic
913433367 1:118820373-118820395 TGCAGCAACATGGATGGAGCTGG + Intergenic
913573764 1:120148204-120148226 TGCAGCAACATGGATGGAGCTGG - Intergenic
913575129 1:120164565-120164587 TGCAGCAACATGGATGGAGCTGG - Intronic
913671117 1:121097876-121097898 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914022884 1:143885297-143885319 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914295025 1:146313006-146313028 TGCAGCAACATGGATGGAGCTGG - Intergenic
914329337 1:146651413-146651435 TGCAGCAACATGGATGGAGCTGG - Intergenic
914556066 1:148763789-148763811 TGCAGCAACATGGATGGAGCTGG - Intergenic
914557434 1:148780206-148780228 TGCAGCAACATGGATGGAGCTGG - Intergenic
914615400 1:149350024-149350046 TGCAGCAACATGGATGGAGCTGG + Intergenic
914661371 1:149793241-149793263 GGCGGCGGCAGGGAGGGAGCGGG + Intronic
914693735 1:150055729-150055751 TGCAGGTACATGGATGGAGCTGG + Intergenic
915025777 1:152828050-152828072 TGAGGCTGCAGGAAATGAGCTGG - Intergenic
915095944 1:153462010-153462032 TGCGGCAACATGGATGGAACTGG + Intergenic
915344890 1:155192448-155192470 GGCTGCTGCAGGGAAGGAGGCGG - Intronic
915577325 1:156788295-156788317 TGCAGCAGCATGGATGGAGCTGG - Intronic
915659027 1:157386371-157386393 TGCAGGGACATGGAAGGAGCTGG - Intergenic
915697594 1:157760135-157760157 TGCAGCAACATGGATGGAGCTGG + Intronic
915756342 1:158264125-158264147 TGTGGGAACATGGAAGGAGCTGG - Intergenic
915795972 1:158733755-158733777 TGGGGCTGCATGGGGGGAGGTGG + Intergenic
916185146 1:162124423-162124445 TGCAGCAACCTGGAAGGAGCTGG - Intronic
916245092 1:162679447-162679469 TGCAGCAACATGGATGGAGCTGG - Intronic
916278269 1:163019497-163019519 TGCAGCAACATGGATGGAGCTGG + Intergenic
916318377 1:163475757-163475779 TGCAGCAACATGGATGGAGCTGG - Intergenic
916648412 1:166812207-166812229 TGCAGCAGCATGGATGCAGCTGG + Intergenic
916967321 1:169963248-169963270 TGCAGCAACATGGATGGAGCTGG - Intronic
917261765 1:173177288-173177310 TGCAGCAACATGGATGGAGCTGG + Intergenic
917302509 1:173591175-173591197 TGCGGGAACATGGATGGAGCTGG - Intronic
917411054 1:174760471-174760493 TGCAGCAGCATGGATGCAGCTGG - Intronic
917559908 1:176139655-176139677 TGCAGCAACATGGATGGAGCTGG + Intronic
917593869 1:176507629-176507651 TGCAGCAACATGGATGGAGCTGG + Intronic
917926289 1:179791582-179791604 TGTGGCGGCATGGGAAGAGCTGG - Intronic
917927953 1:179804650-179804672 TGCGGGAACATGGATGGAGCTGG + Intronic
918482837 1:184998209-184998231 TGCAGCAACATGGATGGAGCTGG + Intergenic
918655842 1:187025107-187025129 TGCAGCAACATGGATGGAGCAGG + Intergenic
919138061 1:193535508-193535530 TGCAACTGCATGGATGGAACTGG - Intergenic
919172163 1:193968636-193968658 TGCAGCAACATGGAAGCAGCTGG + Intergenic
919415835 1:197308129-197308151 TGCAGCAACATGGATGGAGCTGG + Intronic
919600313 1:199614208-199614230 TACGGCAGTATGGATGGAGCTGG - Intergenic
919666184 1:200295071-200295093 TGCAGCAACATGGATGGAGCTGG + Intergenic
920295190 1:204951832-204951854 TGCGGCACCATTTAAGGAGCTGG + Intronic
920382132 1:205541319-205541341 TGCTGCTGCATGGAAGGGAAGGG - Intergenic
920787643 1:209057774-209057796 TGCGGGGACATGGATGGAGCTGG + Intergenic
921260278 1:213380170-213380192 TGCAGCAGCCTGGATGGAGCTGG + Intergenic
921468886 1:215524845-215524867 TGCAGCAACATGGATGGAGCCGG - Intergenic
921753694 1:218827326-218827348 TGTGGCAACATGGATGGAGCTGG - Intergenic
922198615 1:223381893-223381915 TGCAGGGGCATGGATGGAGCTGG - Intergenic
922504233 1:226117341-226117363 TGCGGGTGCATGGGGGAAGCTGG - Intergenic
922713115 1:227848086-227848108 TGCAGCTACATGGATGGAACTGG - Intergenic
922976597 1:229789698-229789720 TGCGGGGACATGGATGGAGCTGG + Intergenic
923042893 1:230332658-230332680 GGCGGCTGTGTGGAAGCAGCGGG - Intronic
923080588 1:230650018-230650040 TGCAGCAACATGGATGGAGCTGG - Intronic
923179587 1:231503316-231503338 TGCAGCAACATGGATGGAGCTGG - Intergenic
923220018 1:231884392-231884414 TGTAGCAGCATGGATGGAGCTGG - Intronic
924063750 1:240203504-240203526 TGCAGCGACATGGATGGAGCTGG + Intronic
924412900 1:243825098-243825120 TGCAGGAGCATGGATGGAGCTGG + Intronic
924413662 1:243834351-243834373 TGCAGCAACATGGATGGAGCTGG + Intronic
924699314 1:246435008-246435030 TGCGGCAACATGGAAACAGCTGG + Intronic
924860335 1:247914041-247914063 TGCAGCTGCATGGATGCAGCTGG + Intergenic
924886510 1:248223439-248223461 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1062835909 10:635588-635610 TGCAGCTGCGGGGAAGCAGCTGG + Intronic
1062920856 10:1278561-1278583 TGCAGCTACATGGATGCAGCTGG - Intronic
1063474875 10:6319351-6319373 TGCAGCAACATGGATGGAGCTGG + Intergenic
1063550247 10:7025758-7025780 TGCGGCAACTTGGATGGAGCTGG + Intergenic
1063699999 10:8375133-8375155 TGCAGCAACATGGATGGAGCTGG - Intergenic
1064305872 10:14165699-14165721 TGCAGCAACATGGATGGAGCTGG + Intronic
1064522902 10:16222445-16222467 TGCAGGTACATGGATGGAGCTGG - Intergenic
1064526720 10:16264483-16264505 TGCGGAAACATGGATGGAGCTGG + Intergenic
1064748565 10:18502336-18502358 TGCAGCAACATGGATGGAGCCGG + Intronic
1064805589 10:19127052-19127074 TGCAGGAGCATGGATGGAGCTGG - Intronic
1064989320 10:21242314-21242336 TGCAGCAACATGGATGGAGCTGG + Intergenic
1065083791 10:22154059-22154081 TGCAGCAACATGGATGGAGCTGG + Intergenic
1065146427 10:22772769-22772791 TGCAGCAACATGGATGGAGCTGG - Intergenic
1065201780 10:23319301-23319323 TGCAGCAACATGGATGGAGCTGG - Intronic
1065219551 10:23482380-23482402 TGCAGCAACATGGATGGAGCTGG + Intergenic
1065221603 10:23501580-23501602 TGCGGGAACATGGATGGAGCTGG - Intergenic
1065392617 10:25199445-25199467 TGCAGCAACATGGATGGAGCTGG - Intronic
1065406625 10:25373142-25373164 TGTAGCAGCATGGATGGAGCTGG + Intronic
1066030920 10:31422966-31422988 TGCGGCAGCATGGATGCAGCTGG - Intronic
1066130153 10:32385243-32385265 TGCAGCAACATGGATGGAGCTGG - Intergenic
1066153176 10:32646878-32646900 TGCAGCAACATGGATGGAGCTGG - Intronic
1066494582 10:35930150-35930172 TGCAGCAACATGGATGGAGCTGG - Intergenic
1066538413 10:36417080-36417102 TGCAGCAGCATGCATGGAGCTGG + Intergenic
1066597801 10:37071203-37071225 TGCAGCAACATGGATGGAGCTGG - Intergenic
1067346089 10:45440121-45440143 GCTGGCAGCATGGAAGGAGCGGG - Intronic
1067474011 10:46554814-46554836 TGTGGCAGCATGGCGGGAGCTGG - Intronic
1067915344 10:50391877-50391899 TGCAGCAACATGGATGGAGCTGG + Intronic
1067918352 10:50425441-50425463 TGCAGCAACATGGATGGAGCTGG + Intronic
1068161342 10:53269145-53269167 TGCAGCAACATGGATGGAGCTGG + Intergenic
1068354056 10:55887587-55887609 TGCAGCAACATGGATGGAGCTGG + Intergenic
1068397696 10:56485638-56485660 TGCAGCAACATGGATGGAGCTGG - Intergenic
1068573663 10:58659428-58659450 TGCAGCAACATGGATGGAGCTGG + Intronic
1068619371 10:59162811-59162833 TGCAGCAACATGGATGGAGCCGG - Intergenic
1068833696 10:61527547-61527569 TGCAGAGACATGGAAGGAGCTGG - Intergenic
1068838692 10:61586121-61586143 TGCAGCAGCATGAATGGAGCTGG + Intergenic
1068948930 10:62758061-62758083 TGCAGGCACATGGAAGGAGCTGG - Intergenic
1069046302 10:63747222-63747244 TGCAGCAACATGGAAGCAGCTGG + Intergenic
1069358745 10:67617399-67617421 TGCAGGAACATGGAAGGAGCTGG - Intronic
1069485557 10:68820518-68820540 TGCAGCAACATGGATGGAGCTGG - Intergenic
1069865918 10:71502787-71502809 TGCTGCTGCAAGGAGGGAGCAGG + Intronic
1069876837 10:71568296-71568318 CCAGGCTGCATGGAAGGTGCAGG - Intronic
1070406514 10:76102530-76102552 TGCAGCAACATGGATGGAGCTGG - Intronic
1070468314 10:76748721-76748743 TGCAGCAACATGGATGGAGCTGG + Intergenic
1070809473 10:79290410-79290432 TGTGGCTACATGGAAGGCTCAGG + Intronic
1070939262 10:80328912-80328934 TGTGGCTGGAGGGAAGGAGGTGG - Intergenic
1071298485 10:84239692-84239714 TGGGGTTGCCTGGGAGGAGCTGG - Intronic
1071569930 10:86691263-86691285 TGGGGCTGCATGGAAGCCACTGG - Intronic
1071830981 10:89371899-89371921 TGCAGCAACATGGATGGAGCTGG + Intronic
1072115141 10:92363726-92363748 TGCAGCACCATGGATGGAGCTGG + Intergenic
1072144665 10:92624188-92624210 TGCAGCAACATGGATGGAGCTGG - Intronic
1072393367 10:95012970-95012992 TGCAGCAACCTGGAAGGAGCTGG - Intergenic
1072394865 10:95028151-95028173 TGCAGCAACATGGATGGAGCTGG - Intergenic
1072713079 10:97730677-97730699 TGCGGCAACATGGATGGAGCTGG + Intergenic
1072864939 10:99048924-99048946 TGCAGCAACATGGATGGAGCTGG + Intronic
1072939369 10:99746206-99746228 TGCAGAGGCATGGATGGAGCTGG + Intronic
1073163799 10:101425521-101425543 TGAGACTGCATGTAAGGAGTAGG + Intronic
1073626420 10:105102374-105102396 TGCAGCAACATGGATGGAGCTGG + Intronic
1073627691 10:105116730-105116752 TGCAGCAACATGGATGGAGCTGG + Intronic
1073867260 10:107819183-107819205 TGGGGCAGCAGGAAAGGAGCAGG + Intergenic
1074013681 10:109510324-109510346 TGCAGCAACATGGATGGAGCTGG - Intergenic
1074207281 10:111294275-111294297 TGCAGCAACATGGATGGAGCTGG - Intergenic
1074209410 10:111316025-111316047 TGCGGCAACATGGATGGATCTGG + Intergenic
1074548922 10:114425276-114425298 TGCAGCAACATGGATGGAGCTGG - Intergenic
1074708804 10:116159715-116159737 TGCGGCTGCACGGAAGGCTGAGG + Intronic
1075363076 10:121857404-121857426 TGCAGCAGCATGGATGCAGCTGG - Intronic
1075645801 10:124095249-124095271 TGCGTCTGCAAGGAAGGCCCTGG + Intergenic
1075905334 10:126076224-126076246 TGCAGCAACATGGATGGAGCCGG - Intronic
1075968798 10:126635555-126635577 TGGAGCTCCATGGAAGGAGCAGG - Intronic
1076254167 10:129007256-129007278 TGCAGCAACATGGATGGAGCTGG - Intergenic
1076445152 10:130509334-130509356 TGGGGATGGAAGGAAGGAGCAGG + Intergenic
1076488879 10:130843143-130843165 TGCCTCTGCAGGGAAGCAGCGGG + Intergenic
1076752308 10:132549678-132549700 TGCAGCTGCAGGGCGGGAGCCGG + Intronic
1077757536 11:5049700-5049722 TGCGGCAACATGGATGCAGCTGG - Intergenic
1077835772 11:5926512-5926534 TGCAGGTACATGGATGGAGCTGG + Intronic
1077951697 11:6966203-6966225 TGCAGCGGCATGGATGGAGCTGG + Intronic
1078627410 11:12970306-12970328 TGCAGCAACATGGATGGAGCTGG + Intergenic
1078946849 11:16077652-16077674 TGCAGCAACATGGATGGAGCTGG + Intronic
1079254589 11:18817248-18817270 TGCAGCAACATGGATGGAGCTGG - Intergenic
1079302726 11:19293379-19293401 TGCAGCAACATGGATGGAGCTGG - Intergenic
1079306244 11:19325987-19326009 TGCAGGTACATGGATGGAGCTGG + Intergenic
1079766677 11:24402558-24402580 TGCAGCAGCATGAATGGAGCTGG - Intergenic
1079924983 11:26482891-26482913 TGCGGCAACATGGATGGAACTGG - Intronic
1079945682 11:26737999-26738021 TGCAGCTACATGGATGGAGTTGG + Intergenic
1080083452 11:28250019-28250041 TGCAGCAACATGGATGGAGCTGG - Intronic
1080152461 11:29069454-29069476 TGCAGCATCATGGATGGAGCTGG + Intergenic
1080331938 11:31149038-31149060 TGCAGCAGCTTGGACGGAGCTGG - Intronic
1080480469 11:32644180-32644202 TGCAGCAACATGGATGGAGCTGG + Intronic
1080583164 11:33659887-33659909 TGGGGCTGCATGGCAGGTGGAGG + Intronic
1080689398 11:34543776-34543798 TGCAGCAACATGGATGGAGCTGG + Intergenic
1080724475 11:34881776-34881798 TGCGGGAACATGGATGGAGCTGG + Intronic
1080953054 11:37058692-37058714 TGCAGCAACATGGATGGAGCTGG + Intergenic
1081096918 11:38947822-38947844 TGCAGCAACATGGATGGAGCTGG + Intergenic
1081429887 11:42965393-42965415 TGCAGCAACATGGATGGAGCTGG + Intergenic
1081452956 11:43190829-43190851 TGCAGCAACATGGATGGAGCTGG - Intergenic
1081467922 11:43341432-43341454 TGCAGCAACATGGAAGGAACTGG + Intronic
1081687316 11:45052049-45052071 GGCAGCTGCATGGATGGAGCAGG + Intergenic
1081871683 11:46385566-46385588 CGCGGCTGCAGGGGAGGGGCGGG + Exonic
1082637859 11:55618515-55618537 TACAGCAGCATGGATGGAGCTGG - Intergenic
1082639749 11:55644022-55644044 TGCGGGAACATGGATGGAGCTGG + Intergenic
1082673809 11:56070504-56070526 TGCAGCAACATGGATGGAGCTGG - Intergenic
1082777492 11:57258608-57258630 TGCAGCAACATGGATGGAGCTGG + Intergenic
1082778597 11:57268449-57268471 TGCAGCAACATGGATGGAGCTGG + Intergenic
1082870779 11:57942605-57942627 TGGGGCTGCAGGGAGGGAGCAGG - Intergenic
1082887341 11:58100860-58100882 TGCAGCAGCATGGATGGAACTGG + Intronic
1082921296 11:58497564-58497586 TGCAGCAACATGGATGGAGCTGG + Intergenic
1083128682 11:60600590-60600612 TGCAGGAACATGGAAGGAGCTGG - Intergenic
1083497493 11:63070127-63070149 TGCAGCAACATGGATGGAGCTGG + Intergenic
1083691354 11:64410775-64410797 CGAGGCTGCATGGAAGGATCTGG - Intergenic
1083770813 11:64866201-64866223 TGCAGCAACATGGATGGAGCTGG + Intronic
1084483816 11:69436760-69436782 TGAGGCTGCGGGGAAGGAACTGG - Intergenic
1084841430 11:71854113-71854135 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1085004495 11:73073016-73073038 TGTGGCTGGAGAGAAGGAGCAGG - Intronic
1085153919 11:74275996-74276018 TGCAGCAACATGGATGGAGCTGG + Intronic
1085215771 11:74829689-74829711 TGCAGGGGCATGGATGGAGCTGG + Intronic
1085246543 11:75106532-75106554 TGCAGCAACATGGATGGAGCTGG + Intronic
1085892001 11:80591145-80591167 TGCAGCAACATGGATGGAGCTGG + Intergenic
1086066069 11:82746386-82746408 TGCAGGGACATGGAAGGAGCTGG + Intergenic
1086124676 11:83338268-83338290 TGCAGCAACATGGATGGAGCTGG + Intergenic
1086450244 11:86908513-86908535 AGTGGCTGCAAGGAAGCAGCAGG - Intronic
1087159192 11:94932647-94932669 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1087360406 11:97151422-97151444 TGCAGCAACATGGATGGAGCTGG - Intergenic
1087918532 11:103838283-103838305 TGCGGCTGCATGGATGGATCTGG + Intergenic
1087999855 11:104864661-104864683 TGCAGGTACATGGATGGAGCTGG - Intergenic
1088027172 11:105199546-105199568 TGTGGGAGCATGGATGGAGCTGG - Intergenic
1088392405 11:109329330-109329352 TGCAGCAACATGGATGGAGCTGG - Intergenic
1088440059 11:109860349-109860371 TGCGGCAGCAGGGAAAGAGCTGG - Intergenic
1088603507 11:111506326-111506348 TGCAGCAACATGGATGGAGCTGG + Intronic
1088656261 11:112002932-112002954 TGCAGCAACATGGATGGAGCTGG + Intronic
1088733143 11:112701419-112701441 TGCAGCTACATGGATGGAGCTGG - Intergenic
1088875010 11:113928178-113928200 TGCAGGGGCATGGATGGAGCTGG - Intronic
1089076810 11:115745152-115745174 AGCAGCTGCAGGGGAGGAGCAGG - Intergenic
1089923842 11:122236594-122236616 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1089955277 11:122564953-122564975 TGCAACAGCATGGATGGAGCTGG + Intergenic
1090379297 11:126314241-126314263 TGCTGCAACATGGATGGAGCTGG - Intronic
1090864202 11:130682287-130682309 TGCAGCAGCATGGATGAAGCTGG - Intronic
1090864962 11:130691564-130691586 TGCAGCAGCATGGATGCAGCTGG - Intronic
1090971578 11:131648153-131648175 TGCGGCAACATGGATGGAGCTGG - Intronic
1090984863 11:131757186-131757208 TGCAGCTACCTGGAAGGAGCTGG - Intronic
1091049265 11:132352743-132352765 TGTGGCTGTCTGGGAGGAGCAGG - Intergenic
1091186424 11:133651681-133651703 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1091819213 12:3462188-3462210 TGCAGGAGCATGGATGGAGCTGG - Intronic
1092483091 12:8878344-8878366 TGCAGCAGCATGGATGCAGCTGG + Intronic
1092499986 12:9035840-9035862 TGCAGCAACATGGATGGAGCTGG + Intergenic
1093275063 12:17115899-17115921 TGCAGCAACATGGAAGCAGCTGG + Intergenic
1093349644 12:18082178-18082200 TGCGGGGACATGGATGGAGCTGG + Intronic
1093395445 12:18675718-18675740 TGCAGCAACATGGATGGAGCTGG + Intergenic
1093400871 12:18745165-18745187 TGCAGCAACATGGATGGAGCTGG + Intergenic
1093456494 12:19369731-19369753 TGCGGCTGAGTGGATGGAACTGG - Exonic
1094079580 12:26518214-26518236 TGCAGCAACATGGATGGAGCTGG + Intronic
1094206528 12:27845888-27845910 TGCGGGGACATGGATGGAGCTGG - Intergenic
1094255557 12:28421504-28421526 TGCTGCAGCATGGATGGAGCCGG - Intronic
1094690687 12:32765415-32765437 TGCAGCAACATGGATGGAGCTGG - Intergenic
1094770192 12:33648799-33648821 TGCAGCAACATGGATGGAGCTGG - Intergenic
1094783219 12:33817395-33817417 TGCAGCAACATGGATGGAGCTGG - Intergenic
1095130079 12:38530668-38530690 TGCAGCAACATGGATGGAGCTGG - Intergenic
1095241534 12:39865722-39865744 TGCAGCAACATGGATGGAGCTGG + Intronic
1095367348 12:41423440-41423462 TGCGGAGACATGGATGGAGCTGG - Intronic
1095610477 12:44121998-44122020 TGCTGCAACATGGATGGAGCTGG - Intronic
1095634351 12:44415169-44415191 TGCAGCAACATGGATGGAGCAGG - Intergenic
1095692560 12:45106917-45106939 TGCAGCAACATGGATGGAGCTGG - Intergenic
1095780830 12:46057275-46057297 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1095786643 12:46117035-46117057 TGCAGCAGCTTGGATGGAGCTGG + Intergenic
1095964335 12:47857038-47857060 GGCTGCTGGATGGAAGGAGGTGG - Intronic
1096453491 12:51765950-51765972 TGGGACTGCATGGAAGTGGCAGG + Exonic
1096899980 12:54866764-54866786 TGCCGCAACATGGATGGAGCTGG - Intergenic
1096911295 12:54986907-54986929 TGCAGCAACATGGATGGAGCTGG - Intergenic
1097293424 12:57939731-57939753 TGCAGCAACATGGATGGAGCTGG + Intergenic
1097353802 12:58578419-58578441 TGCAGGTGCATAGATGGAGCTGG - Intronic
1097371632 12:58788754-58788776 TGCAGCAACATGGATGGAGCTGG + Intronic
1097413841 12:59289422-59289444 TGTGGCAACATGGATGGAGCTGG - Intergenic
1097974478 12:65669876-65669898 TGCAGCAACATGGATGGAGCTGG + Intergenic
1098402984 12:70093387-70093409 TGCAGCAACATGGATGGAGCTGG + Intergenic
1098568744 12:71965082-71965104 TGCAGCAACATGGATGGAGCTGG - Intronic
1098742684 12:74194136-74194158 TGCAGGTACATGGATGGAGCTGG - Intergenic
1098776685 12:74629351-74629373 TGCGGCGACATGGATGAAGCTGG - Intergenic
1099032494 12:77544769-77544791 TGCAGCAGCATGGATGGAACTGG + Intergenic
1099265847 12:80446724-80446746 TGCAGCAACATGGATGGAGCTGG - Intronic
1099372050 12:81846241-81846263 TGCAGCAACATGGATGGAGCTGG - Intergenic
1099502030 12:83425761-83425783 TGCAGCAACATGGATGGAGCTGG - Intergenic
1099571290 12:84322286-84322308 TGCAGGAGCATGGATGGAGCTGG + Intergenic
1099647178 12:85372793-85372815 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1099706647 12:86162339-86162361 TGCAGCATCATGGATGGAGCTGG + Intronic
1099833911 12:87882434-87882456 TGCAGCGACATGGATGGAGCTGG + Intergenic
1099860661 12:88221968-88221990 TGCAGCAGCATGGTTGGAGCTGG + Intergenic
1100039452 12:90296081-90296103 TGCAGCAACATGGATGGAGCTGG - Intergenic
1100114764 12:91291024-91291046 TGCAGCAACATGGATGGAGCTGG - Intergenic
1100297189 12:93273983-93274005 CGTGGCTGCATGGCAGGGGCAGG + Intergenic
1100962293 12:99976042-99976064 TGCAGCAACATGGATGGAGCTGG + Intronic
1101106772 12:101448292-101448314 TGCAGCAACATGGATGGAGCTGG - Intergenic
1101187628 12:102295987-102296009 TGCAGCAACATGGATGGAGCTGG - Intergenic
1101302799 12:103498716-103498738 TGCAGGTACATGGATGGAGCTGG + Intergenic
1101732915 12:107441306-107441328 TGCAGGGACATGGAAGGAGCTGG + Intronic
1101920228 12:108926332-108926354 TGCAGCAGCATGGAGGCAGCTGG - Intronic
1102537909 12:113595114-113595136 TGCAGGAACATGGAAGGAGCTGG - Intergenic
1102550844 12:113691049-113691071 TGCAGCAACATGGATGGAGCTGG + Intergenic
1102636654 12:114330495-114330517 TGCGGGAACATGGATGGAGCTGG - Intergenic
1102755537 12:115336549-115336571 TGCAGCAACATGGATGGAGCTGG - Intergenic
1102860078 12:116328716-116328738 TGCAGCAACATGGATGGAGCTGG + Intergenic
1103172623 12:118834600-118834622 TGCAGCAACATGGATGGAGCTGG + Intergenic
1103212514 12:119177181-119177203 TCCAGCTGCATGGGAAGAGCAGG + Intergenic
1103959334 12:124598751-124598773 TGCAGCAACATGGATGGAGCTGG + Intergenic
1104101300 12:125614410-125614432 TGCAGCAACATGGATGGAGCTGG - Intronic
1104518303 12:129448521-129448543 TGCAGCAACATGGATGGAGCTGG - Intronic
1104615656 12:130266407-130266429 TGCGGCAACATGGATGCAGCTGG + Intergenic
1104652905 12:130549653-130549675 TGTGGAAACATGGAAGGAGCTGG - Intronic
1104731053 12:131105558-131105580 TGTGTGGGCATGGAAGGAGCTGG + Intronic
1104891878 12:132144110-132144132 GGCGGCTGCATCGACCGAGCCGG - Exonic
1105343410 13:19549847-19549869 TGCTGCAACATGGATGGAGCTGG + Intergenic
1105379706 13:19875671-19875693 TGCAGCAACATGGAAGCAGCTGG + Intergenic
1105536895 13:21274232-21274254 TGCTGCAACATGGATGGAGCTGG - Intergenic
1105660653 13:22490593-22490615 TGCAGCAACATGGATGGAGCTGG - Intergenic
1105663421 13:22525296-22525318 TGTGACAGCATGGATGGAGCTGG + Intergenic
1105807879 13:23968024-23968046 TGCGGGTACATGGATGAAGCTGG - Intergenic
1105950115 13:25222851-25222873 TGTGGCTGCCTGGCATGAGCTGG + Intergenic
1105971591 13:25433823-25433845 TGCAGCAACATGGATGGAGCTGG + Intronic
1106188722 13:27431482-27431504 TGCAGCAGCTTGGATGGAGCTGG + Intronic
1106318869 13:28619788-28619810 TGCAGCAACATGGATGGAGCTGG - Intergenic
1106604661 13:31216746-31216768 TGCAGCAACATGGATGGAGCTGG - Intronic
1106742891 13:32665852-32665874 TGCGGCAGCATGGATGGAACTGG + Intronic
1107189096 13:37558527-37558549 TGCGGGACCATGGATGGAGCTGG + Intergenic
1107317388 13:39148127-39148149 TGCAGCCACATGGATGGAGCTGG + Intergenic
1107330074 13:39290037-39290059 TGCAGAAGCATGGATGGAGCTGG + Intergenic
1107585676 13:41845661-41845683 TGCAGCAACATGGATGGAGCTGG + Intronic
1107943725 13:45398152-45398174 TGCAGCAACATGGATGGAGCTGG + Intronic
1108165064 13:47684374-47684396 TGCAGCAACATGGATGGAGCTGG - Intergenic
1108788784 13:53941072-53941094 TGCAGCAACATGGATGGAGCTGG + Intergenic
1108970172 13:56364518-56364540 TGCAGCAGCATGGATGGATCTGG + Intergenic
1109022266 13:57113049-57113071 TGCAGGTACATGGATGGAGCTGG + Intergenic
1109036488 13:57268417-57268439 TGCAGCAACATGGAAGGAGTTGG - Intergenic
1109627371 13:64993294-64993316 TGCAGGAGCATGGATGGAGCTGG + Intergenic
1109652400 13:65346570-65346592 TGCGGCAACATGGATGCAGCTGG + Intergenic
1109655258 13:65382448-65382470 TGCAGCAACATGGAGGGAGCTGG - Intergenic
1109695646 13:65953311-65953333 TGCAGCAACATGGATGGAGCTGG - Intergenic
1109703276 13:66055294-66055316 TGCAGCAACCTGGAAGGAGCTGG + Intergenic
1109714160 13:66199404-66199426 TGCAGCAACATGGATGGAGCTGG + Intergenic
1109833486 13:67825165-67825187 TGCGGCAACATGGATGGAGTTGG - Intergenic
1109868728 13:68302743-68302765 TGCGGGGACATGGATGGAGCTGG - Intergenic
1109869461 13:68314300-68314322 TGCAGCAACATGGAAGCAGCTGG + Intergenic
1110493572 13:76137875-76137897 TGCAGCAACATGGATGGAGCTGG - Intergenic
1110802725 13:79718423-79718445 TGCAGCAACATGGATGGAGCTGG - Intergenic
1111100107 13:83572361-83572383 TGCAGCAACATGGATGGAGCAGG - Intergenic
1111272494 13:85904792-85904814 TGCAGCATCATGGATGGAGCTGG + Intergenic
1111457338 13:88502276-88502298 TGCAGGTGCATGGATGGAGCTGG - Intergenic
1111493689 13:89019896-89019918 TGCAGGTCCATGGATGGAGCTGG - Intergenic
1111495040 13:89036398-89036420 TGCAGCAACATGGATGGAGCTGG - Intergenic
1111808809 13:93071909-93071931 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1111814116 13:93129119-93129141 TGCAGGTACATGGATGGAGCTGG - Intergenic
1111881054 13:93957520-93957542 TGCAGCAACATGGATGGAGCTGG - Intronic
1111927071 13:94475374-94475396 TGCGACAGCATGGATGGACCTGG + Intronic
1111994065 13:95145794-95145816 TGCAGCAACATGGATGGAGCTGG + Intronic
1112065603 13:95789449-95789471 TGCAGGGGCATGGATGGAGCTGG - Intronic
1112112448 13:96317261-96317283 TGCTGCAACATGGAAGGAGCTGG - Intronic
1112222854 13:97508759-97508781 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1112648535 13:101364426-101364448 TGCAGCTGCATGGACAGAACTGG + Intronic
1112694377 13:101931283-101931305 TGAGGGAGAATGGAAGGAGCTGG - Intronic
1112865080 13:103885307-103885329 TGCAGCAACATGGATGGAGCTGG + Intergenic
1113006859 13:105715090-105715112 CGCAGCAACATGGAAGGAGCTGG - Intergenic
1113050307 13:106203976-106203998 TGCGGCAATTTGGAAGGAGCTGG - Intergenic
1113394571 13:109934655-109934677 TGCGGTAACATGGATGGAGCTGG - Intergenic
1113860908 13:113486195-113486217 TGCAGCAACATGGATGGAGCTGG + Intronic
1114202762 14:20538444-20538466 TGTGGGTACATGGATGGAGCTGG - Intergenic
1114203379 14:20544106-20544128 TGCAGCAACATGGAAGGAACTGG - Intergenic
1114397129 14:22374432-22374454 TGCAGCAACATGGATGGAGCTGG - Intergenic
1114705628 14:24723913-24723935 TGCAGCAGCACGGATGGAGCTGG + Intergenic
1114753814 14:25235661-25235683 TGCAGCAACATGGATGGAGCTGG + Intergenic
1114760251 14:25306402-25306424 TTCGTGTGCATGGATGGAGCTGG + Intergenic
1114962649 14:27913413-27913435 TGCAGCAACATGGATGGAGCTGG + Intergenic
1115294013 14:31805605-31805627 TGCGGGGACATGGATGGAGCTGG + Intronic
1115605017 14:34992485-34992507 TGCAGCAACATGGATGGAGCAGG + Intronic
1115858629 14:37659074-37659096 TGTGGGAGCATGGATGGAGCTGG - Intronic
1116173361 14:41431115-41431137 TGCAGCAACATGGATGGAGCTGG + Intergenic
1116197592 14:41749512-41749534 TGCGGGAACATGGAAGGAGCTGG + Intronic
1116267570 14:42713587-42713609 TGCAGCAACATGGATGGAGCTGG + Intergenic
1116286257 14:42975741-42975763 TACAGCAGCATGGATGGAGCTGG - Intergenic
1116359881 14:43980497-43980519 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1116377239 14:44218453-44218475 TGCAGCAACATGGATGGAGCTGG + Intergenic
1116553691 14:46275529-46275551 TGCAGCAACATGGATGGAGCTGG + Intergenic
1116560411 14:46371874-46371896 TGCGGCGACATGGATGAAGCTGG - Intergenic
1116673746 14:47878255-47878277 TGCAGCAACATGGAAGAAGCTGG + Intergenic
1116782964 14:49256744-49256766 TGCAGCAACATGGATGGAGCTGG + Intergenic
1116816592 14:49589886-49589908 TGCAACAGCATGGATGGAGCTGG + Intronic
1116820369 14:49621198-49621220 TGCTTCTGCACGGAAGGGGCGGG - Exonic
1117186804 14:53247791-53247813 TGAGCCTGCCTGGCAGGAGCTGG - Intergenic
1117443849 14:55784593-55784615 TGCGGGAACATGGATGGAGCTGG + Intergenic
1117533253 14:56679417-56679439 TGCAGCAGCATGGATGGAGCTGG + Intronic
1117707471 14:58486247-58486269 TGCAGCAACATGGATGGAGCTGG - Intronic
1117766506 14:59088982-59089004 TGCGGGGACATGGATGGAGCTGG - Intergenic
1118045167 14:61961962-61961984 TGCAGCAACATGGATGGAGCTGG + Intergenic
1118226435 14:63904118-63904140 TGCAGCAACATGGATGGAGCTGG - Intronic
1118426439 14:65668875-65668897 TGCAGCAACATGGATGGAGCTGG + Intronic
1118565055 14:67130414-67130436 TGCAGCTACATGGATGCAGCTGG - Intronic
1118651802 14:67904050-67904072 TGCAGCAACATGGATGGAGCTGG - Intronic
1118680415 14:68235902-68235924 TGCAGCAACATGGATGGAGCTGG + Intronic
1118863755 14:69685968-69685990 TGCGGCTGCACAGAGGGAGCTGG - Intronic
1118997673 14:70851715-70851737 TGCAGCAACATGGATGGAGCTGG - Intergenic
1119522825 14:75298757-75298779 TGGGGCTGGATGCCAGGAGCTGG + Intergenic
1119557128 14:75561890-75561912 TGCAGCAACATGGATGGAGCTGG - Intergenic
1119698870 14:76736415-76736437 TGCAGCAACATGGATGGAGCTGG - Intergenic
1119987441 14:79153955-79153977 TGGGGCTTTATGGAAGAAGCAGG + Intronic
1120184521 14:81380667-81380689 TGCAGCAACATGGATGGAGCTGG + Intronic
1120555666 14:85927698-85927720 TGCAGCAACATGGATGGAGCTGG - Intergenic
1120680036 14:87470361-87470383 TGCAGCAACATGGAAGCAGCTGG + Intergenic
1121140118 14:91534221-91534243 TGCAGCGACATGGATGGAGCTGG - Intergenic
1121572034 14:94953491-94953513 TGCGGGAACATGGATGGAGCTGG - Intergenic
1121740031 14:96245214-96245236 TGCGGGGACATGGATGGAGCTGG - Intronic
1121766711 14:96493927-96493949 TGCAGCAGCATGGACGCAGCTGG - Intergenic
1122137853 14:99645124-99645146 CGCGGCGGCAGGGAAGGGGCGGG - Exonic
1122206004 14:100148362-100148384 TCTGGCTGCCTGGAAAGAGCTGG - Intronic
1122403198 14:101479664-101479686 TGCAGCAGCACGGATGGAGCTGG + Intergenic
1122651117 14:103227652-103227674 TGCAGCCACATGGATGGAGCTGG + Intergenic
1123016256 14:105377084-105377106 TGCGGCTGCCTGGCAGGCCCAGG + Intronic
1123192440 14:106583955-106583977 TGCAGCTGTAGGGAAGGATCAGG + Intergenic
1123780603 15:23623297-23623319 TGCAGCAACATGGATGGAGCTGG - Intronic
1123873692 15:24601912-24601934 TGCAGCAACATGGATGGAGCTGG - Intergenic
1124069982 15:26382007-26382029 TGCGGGTGTGTGGAAGAAGCAGG - Intergenic
1124153435 15:27203341-27203363 TGCAGCAACATGGATGGAGCTGG - Intronic
1124216435 15:27811208-27811230 TGCAGCTACTTGGATGGAGCTGG + Intronic
1125038856 15:35159895-35159917 TGCAGCAACATGGATGGAGCTGG + Intergenic
1125244390 15:37618134-37618156 TGCAGCAACATGGATGGAGCCGG - Intergenic
1125247772 15:37661085-37661107 TGCAGCAACATGGATGGAGCTGG - Intergenic
1126304923 15:47244993-47245015 TGCAGCAGCATGGATAGAGCTGG - Intronic
1126306450 15:47263704-47263726 TGCAGCAACATGGATGGAGCTGG - Intronic
1126526915 15:49666390-49666412 TGCAGGGACATGGAAGGAGCTGG - Intergenic
1126715842 15:51516511-51516533 TGCAGCTGCATAGAAGGGTCGGG - Intronic
1127003503 15:54538691-54538713 TGCGGCAACATGGATGGAACTGG + Intronic
1127182919 15:56442584-56442606 TGCGTCAACATGGATGGAGCTGG + Intronic
1127829847 15:62740758-62740780 TGCAGCTGCAAGGTAGGAGTGGG + Exonic
1128460416 15:67862709-67862731 TGCAGCAGCATGGATGGAACTGG - Intergenic
1128585770 15:68848991-68849013 TGTGGATGCATGGGAGGAGAGGG + Intronic
1128708534 15:69855116-69855138 TTCGGCTGCAGGGCTGGAGCAGG - Intergenic
1128838415 15:70829986-70830008 AGTGGCTGCAGGGAAGGAGCAGG + Exonic
1129408672 15:75336780-75336802 GGCGGATGGATGGCAGGAGCTGG + Intronic
1129607259 15:77030988-77031010 TGAGGCTGCAGGGAGGGAGGTGG - Intronic
1129733241 15:77943868-77943890 GGCGGATGGATGGCAGGAGCTGG - Intergenic
1129917268 15:79284522-79284544 AGGGGCTGAAAGGAAGGAGCAGG + Intergenic
1129979618 15:79855812-79855834 TGCGGCAACATGGTTGGAGCTGG - Intronic
1130706674 15:86239472-86239494 TGCAGCTGCAGGGCAGGAGGAGG + Intronic
1131473093 15:92713386-92713408 TGCGGCAACTTGGATGGAGCTGG + Intronic
1131693260 15:94848579-94848601 TGCAGCAACATGGATGGAGCTGG - Intergenic
1131984447 15:98027733-98027755 TGCTGCAGCATGGATGGAGCTGG + Intergenic
1132328052 15:100988443-100988465 TGCAGCATCATGGATGGAGCTGG - Intronic
1132971907 16:2693268-2693290 TGCCGCTGCAGGGAGGGAACAGG - Intronic
1133408743 16:5550343-5550365 TGTTGCTACATGGAAGGAACTGG + Intergenic
1133910651 16:10063069-10063091 TGCCGCAACATGGATGGAGCTGG + Intronic
1134324192 16:13192069-13192091 TGCAGCAACATGGATGGAGCTGG + Intronic
1134361968 16:13539892-13539914 TGCAGCAGCATGGATGAAGCTGG - Intergenic
1134391918 16:13827879-13827901 TGCAGCAACATGGATGGAGCTGG - Intergenic
1134395784 16:13861795-13861817 TGCAGCAACATGGATGGAGCTGG + Intergenic
1134564846 16:15242567-15242589 TGCAGCAACATGGATGGAGCTGG + Intergenic
1134737650 16:16514131-16514153 TGCAGCAACATGGATGGAGCTGG - Intergenic
1134929854 16:18198029-18198051 TGCAGCAACATGGATGGAGCTGG + Intergenic
1135138767 16:19904193-19904215 TGCAGCAACATGGATGGAGCTGG - Intergenic
1135404223 16:22186703-22186725 TGCTGCTGCAGGGAAGGAGGGGG - Exonic
1135618862 16:23935722-23935744 TGCAGCAACATGGATGGAGCTGG + Intronic
1135720506 16:24813471-24813493 TGCAGCAACATGGATGGAGCTGG - Intronic
1135777242 16:25267508-25267530 TGCAGCAACATGGATGGAGCTGG + Intergenic
1135803917 16:25524758-25524780 TGCAGCAGCATGGATGGAACTGG - Intergenic
1136600784 16:31286144-31286166 TGCGGCAACATGGATGCAGCTGG - Intronic
1137038136 16:35584755-35584777 TGCAGCAGCATTGATGGAGCTGG + Intergenic
1137357707 16:47782525-47782547 TGCAGCAACATGGATGGAGCTGG - Intergenic
1137818757 16:51423679-51423701 TGCAGCAACATGGATGGAGCTGG + Intergenic
1138588728 16:57987778-57987800 TGGGGCTGCAGGCAAGGGGCTGG - Intronic
1138695155 16:58806240-58806262 TGCAGCAACATGGATGGAGCTGG + Intergenic
1138906276 16:61338930-61338952 TGCGGGAGCATGGATGCAGCTGG + Intergenic
1138981050 16:62268943-62268965 TGCAGCCACATGGATGGAGCTGG + Intergenic
1138992759 16:62411302-62411324 TGCAGCTACATGGAAGAAACTGG - Intergenic
1139053471 16:63153567-63153589 AGCAGCAACATGGAAGGAGCTGG + Intergenic
1139399188 16:66666764-66666786 TGCAGCAACATGGATGGAGCTGG + Intronic
1140004224 16:71059521-71059543 TGCAGCAACATGGATGGAGCTGG + Intronic
1140550566 16:75861394-75861416 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1140572805 16:76128449-76128471 TGCAGCAACATGGATGGAGCTGG - Intergenic
1140609829 16:76584563-76584585 TGCAGCTGCATGGATGCAGCTGG - Intronic
1140615740 16:76661010-76661032 TGCAGCAACATGGATGGAGCTGG + Intergenic
1140654713 16:77127750-77127772 TATGGCAGCATGGATGGAGCTGG + Intergenic
1141080977 16:81052173-81052195 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1141857475 16:86693576-86693598 CAGGGCTGCATGGAAGGAGATGG + Intergenic
1141881740 16:86864725-86864747 TGCAGCAACATGGATGGAGCTGG - Intergenic
1141937365 16:87249959-87249981 TGCAGCAACATGGATGGAGCTGG + Intronic
1141949813 16:87333272-87333294 TGCGACTGCGTGGGAGGGGCTGG - Intronic
1142184064 16:88686167-88686189 TGCGGCTGCAGGGAGGGAGGTGG - Intronic
1142196910 16:88743174-88743196 TTCGGCTGCAGGGCAGGGGCTGG + Intronic
1142359336 16:89619221-89619243 GGGGGCTGCAGGGAGGGAGCAGG - Intronic
1142537911 17:632805-632827 TGCAGCTGCATGGATTGAACTGG - Intronic
1143124654 17:4633876-4633898 TGCAGCAACATGGATGGAGCTGG + Intronic
1143170066 17:4923881-4923903 TGCAGCAGCATGAATGGAGCTGG - Intergenic
1143436744 17:6934311-6934333 TGCAGCAACATGGAAGGAGCTGG - Intronic
1143738211 17:8929655-8929677 TGCAGCAGCATGGATGAAGCTGG + Intronic
1143740607 17:8950592-8950614 TGCAGCAACATGGATGGAGCTGG - Intronic
1144461662 17:15463613-15463635 TGGAGCTGCATGGAATGTGCCGG - Intronic
1144715493 17:17432600-17432622 CGGGGGTGCATGGAGGGAGCTGG - Intergenic
1145758371 17:27409255-27409277 AGCGCCTCCATGGAAGGTGCAGG - Intergenic
1146138213 17:30341649-30341671 AGCAGATGCATGGAAGGAGCTGG + Intergenic
1146265921 17:31452685-31452707 TGCTGCTGGATGGAGGGAGGAGG - Intronic
1146834704 17:36100954-36100976 TGCAGCAACATGGATGGAGCTGG - Intergenic
1146849312 17:36208139-36208161 TGCAGCAACATGGATGGAGCTGG - Intronic
1146930730 17:36776041-36776063 TGCAGCAACATGGATGGAGCTGG + Intergenic
1147007334 17:37414094-37414116 TGCAGCAACATGGATGGAGCTGG - Intronic
1147049793 17:37785002-37785024 TGCAGTGGCATGGATGGAGCCGG + Intergenic
1147050167 17:37788393-37788415 TGCGGCAACATGGATGTAGCTGG - Intergenic
1147057946 17:37848582-37848604 TGCAGCTACATGGATGGACCTGG - Intergenic
1148096905 17:45058752-45058774 TGCAGCTGCAGGGAAGGGGGGGG - Intronic
1149090442 17:52771965-52771987 TGCGGCAACATGGATGGAGCTGG + Intergenic
1149123415 17:53197688-53197710 TGCAGCAACATGGATGGAGCTGG - Intergenic
1149128171 17:53260748-53260770 TGCAGCAACATGGATGGAGCTGG + Intergenic
1149162916 17:53716313-53716335 TGCAGCAACATGGATGGAGCTGG - Intergenic
1149194866 17:54107691-54107713 TGCAGCAACATGGATGGAGCTGG + Intergenic
1149417024 17:56470083-56470105 TGCGGGGACATGGATGGAGCTGG - Intronic
1150028312 17:61702602-61702624 TGCAGCAACATGGATGGAGCTGG - Intronic
1150931067 17:69586034-69586056 TGCAGCAACATGGATGGAGCTGG + Intergenic
1150985276 17:70189120-70189142 TGTGGCAGCATGGATGGACCTGG - Intergenic
1150998841 17:70350808-70350830 TGCGGGAACATGGATGGAGCTGG + Intergenic
1151734314 17:75929475-75929497 TGCTGCTGGCTGGAAGGAGAGGG + Intronic
1151781406 17:76248587-76248609 GGCGGCTTCATGGAAGAGGCAGG - Intergenic
1151805580 17:76402927-76402949 TGGGGCTGCCTGGAGGGAACGGG + Intronic
1151874802 17:76861547-76861569 AGCGGCTTCGTGGCAGGAGCAGG + Intergenic
1151885594 17:76921581-76921603 TGGGTGTGCATGGAGGGAGCAGG - Intronic
1151930529 17:77229065-77229087 TGCTGGTGCATGGAAGGTGGAGG + Intergenic
1152259938 17:79261442-79261464 TGGAGCTCCTTGGAAGGAGCCGG + Intronic
1152983281 18:299004-299026 TGCAGCAACATGGATGGAGCCGG + Intergenic
1153137841 18:1937681-1937703 TGCAGGGGCATGGATGGAGCTGG - Intergenic
1153493433 18:5673308-5673330 TGCAGCAACATGGATGGAGCTGG - Intergenic
1153934033 18:9904900-9904922 AGAGGCTGCAGGGAAGGAGAGGG - Intergenic
1154088619 18:11334428-11334450 TGAGGCAGCATGGATGAAGCTGG - Intergenic
1154225496 18:12499972-12499994 TGCAGCAACATGGATGGAGCTGG + Intronic
1154937062 18:21071584-21071606 TCCTGCTGCATGGCAGGAACTGG + Intronic
1155100091 18:22602281-22602303 TGCAGCAACATGGATGGAGCTGG - Intergenic
1155105898 18:22666085-22666107 TGCAGCAACATGAAAGGAGCTGG + Intergenic
1155180732 18:23343860-23343882 TGCAGCAACATGGATGGAGCTGG - Intronic
1155230440 18:23768833-23768855 TGCAGCAGCATGGATGCAGCTGG + Intronic
1155763238 18:29592040-29592062 TGCAGCAACATGGATGGAGCTGG + Intergenic
1155801166 18:30105308-30105330 TGCAGCAGCATGGATGGAGCTGG - Intergenic
1155933620 18:31731757-31731779 TGTTGCTGCCTGGAGGGAGCAGG + Intergenic
1156087185 18:33420138-33420160 TGCAGCCACATGGATGGAGCTGG + Intronic
1156096385 18:33537847-33537869 TGCAGCAACATGGATGGAGCTGG + Intergenic
1156364973 18:36417364-36417386 TGCAGGGACATGGAAGGAGCTGG - Intronic
1156632867 18:38991373-38991395 TGCAGCAACATGGATGGAGCTGG + Intergenic
1156907827 18:42375731-42375753 TGCAGCTACATGGATGGAGTTGG - Intergenic
1157133792 18:45034375-45034397 AGCTTCTGCATCGAAGGAGCAGG + Intronic
1157698175 18:49741362-49741384 TGCAGCAACATGGATGGAGCTGG - Intergenic
1157778220 18:50413967-50413989 TGCAGCAACATGGATGGAGCTGG + Intergenic
1158174831 18:54643304-54643326 TGCGGGAACATGGATGGAGCTGG - Intergenic
1158319207 18:56244816-56244838 TGCAGCAGCATGGATGGAACTGG + Intergenic
1158550942 18:58435810-58435832 TGCAGGGACATGGAAGGAGCTGG + Intergenic
1158704283 18:59777593-59777615 TGCAGCAACATGGATGGAGCTGG + Intergenic
1159063592 18:63542937-63542959 TGCAGCAACATGGATGGAGCTGG - Intergenic
1159331394 18:66998524-66998546 TGCAGCAACATGGATGGAGCTGG + Intergenic
1159351105 18:67273904-67273926 TGCAGCAACATGGAAGGAGCTGG + Intergenic
1159486293 18:69062555-69062577 TGCAGCAACATGGATGGAGCTGG - Intergenic
1159501425 18:69275767-69275789 TGCGGGAACATGGATGGAGCTGG - Intergenic
1159576658 18:70186715-70186737 TGCGGCAACATGGATGGAGCTGG + Intronic
1159632880 18:70769168-70769190 TGCGGGGGCATGGATGAAGCTGG + Intergenic
1159791275 18:72782144-72782166 TGCAGCAACATGGATGGAGCTGG - Intronic
1159922595 18:74239334-74239356 TGCAGCTACTTGGATGGAGCTGG + Intergenic
1159972548 18:74671659-74671681 TGTGGGTACATGGATGGAGCTGG - Intronic
1161010431 19:1957180-1957202 TGGGGCTGCCTGGAGGGAGGTGG - Intronic
1161070787 19:2259514-2259536 TGCAGCAACATGGATGGAGCTGG - Intronic
1161227758 19:3155053-3155075 TGAGGATGCATGGGAGGAGTGGG + Intronic
1161395760 19:4044134-4044156 GGCGGCTGCAGGGAAGGTGGGGG - Intergenic
1161784660 19:6316467-6316489 TGCGGCAACATGGATGGAACCGG + Intronic
1164123863 19:22292334-22292356 TGCAGCAACATGGATGGAGCTGG - Intronic
1164880599 19:31729520-31729542 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1165362576 19:35345893-35345915 TGCTGCTGACTTGAAGGAGCAGG - Intronic
1165950053 19:39469251-39469273 TGCCCCTGCAGGGAAGGAGCGGG + Exonic
1166381347 19:42356845-42356867 TGCGGCTGCATGGAAGGAGCGGG - Exonic
1166634454 19:44437813-44437835 TGCAGCAACATGGAAGGAGCTGG + Intronic
1166863629 19:45823468-45823490 TGGGACTGCATGGAAGCAGCAGG + Exonic
1167578342 19:50328367-50328389 GGCGGCGGCCTGGACGGAGCGGG - Exonic
1167666084 19:50823453-50823475 TGAGGCTTCCTGGGAGGAGCAGG + Intronic
1168552850 19:57312439-57312461 TGCAGCAGCATGGATGGAGCTGG - Intergenic
925344966 2:3165410-3165432 TGCAGCAGCATGGACGCAGCTGG - Intergenic
925412372 2:3647436-3647458 TGCGGCAGGATGGGAGAAGCAGG - Intergenic
925747405 2:7055411-7055433 TGGAGCTGCAGGGAAGGAGTAGG - Intronic
925834934 2:7935320-7935342 TGCAGCAACATGGATGGAGCCGG - Intergenic
925954435 2:8948638-8948660 TGCAGCAACATGGATGGAGCTGG - Intronic
925961782 2:9024060-9024082 TGCAGCAACATGGATGGAGCTGG + Intergenic
926663965 2:15499450-15499472 TGCAGCAACATGGATGGAGCTGG + Intronic
926854093 2:17233375-17233397 TGCAGCAACATGGATGGAGCTGG + Intergenic
927128076 2:20031733-20031755 TGCAGGAGCATGGATGGAGCTGG + Intergenic
927210403 2:20635725-20635747 TGCGGTTGCATGGATGCTGCTGG + Intronic
927224579 2:20750853-20750875 TGCAGCAACATGGATGGAGCTGG + Intronic
927235051 2:20865591-20865613 TGCAACAACATGGAAGGAGCTGG + Intergenic
927377637 2:22436751-22436773 TGCGGCAACATGGATGCAGCTGG - Intergenic
927604327 2:24472617-24472639 TGCAGCAGCATAGATGGAGCTGG + Intergenic
928104352 2:28458229-28458251 TGCAGCAACATGGATGGAGCTGG + Intronic
928577158 2:32667347-32667369 AACGGCTTCATGGAAGCAGCTGG - Intronic
928729259 2:34211764-34211786 TGCAGATACATGGATGGAGCTGG + Intergenic
928763638 2:34614768-34614790 TGCAGGAGCATGGATGGAGCTGG + Intergenic
928805920 2:35154783-35154805 TGCAGCAGCATGGATGGAGCTGG + Intergenic
929092676 2:38235147-38235169 TGCAGCAACTTGGAAGGAGCTGG + Intergenic
929135627 2:38621275-38621297 TGCAGCAACATGGATGGAGCTGG + Intergenic
929572258 2:43030080-43030102 TGTGGCTGCAGGGACTGAGCTGG - Intergenic
930583785 2:53245927-53245949 TGCAGCAACATGGATGGAGCTGG + Intergenic
930840342 2:55838341-55838363 TGCAGCAACATGGATGGAGCTGG + Intergenic
930965518 2:57319451-57319473 TGCGGCAACATGGATGAAGCTGG + Intergenic
930973857 2:57430535-57430557 TGCAGCAACATGGATGGAGCTGG - Intergenic
930991378 2:57659900-57659922 TGCAGCAACATGGATGGAGCTGG - Intergenic
931023223 2:58075189-58075211 TGCCGCAACATGGATGGAGCTGG - Intronic
931436039 2:62247615-62247637 TGCGGCAACATGGATGGAACTGG - Intergenic
931557889 2:63525091-63525113 TGCAGCAACATGGATGGAGCTGG + Intronic
931929852 2:67119540-67119562 TGCCGCAGCATGGAAGGAGCTGG + Intergenic
932087236 2:68773350-68773372 TGCAGCAACATGGATGGAGCTGG + Intronic
932380323 2:71276469-71276491 CTCGGCTGCAGGGGAGGAGCTGG + Intergenic
932503976 2:72211008-72211030 TGTGGCTGCCTGGAGGGAACCGG - Intronic
932554290 2:72806324-72806346 TGCAGCAGCATGGATGCAGCTGG - Intronic
932661764 2:73660675-73660697 TGCAGCAGCATGGATGGAGCTGG - Intergenic
933173322 2:79149409-79149431 TGCAGCAACATGGATGGAGCTGG - Intergenic
933192463 2:79350430-79350452 TGCAGCAACATGGATGGAGCTGG - Intronic
933211456 2:79574513-79574535 TGCAGCAGCATGGATTGAGCTGG - Intronic
933285864 2:80384011-80384033 TGCAGCAACATGGATGGAGCTGG + Intronic
933365926 2:81353963-81353985 TGCAGGGGCATGGATGGAGCTGG + Intergenic
933375767 2:81478091-81478113 TGCAGCAACATGGATGGAGCTGG + Intergenic
933783205 2:85816244-85816266 TGCAGCAACATGGATGGAGCAGG + Intergenic
933957855 2:87386122-87386144 TGCGGCCACATGGATGTAGCTGG + Intergenic
934012585 2:87839617-87839639 TGCAGCAACATGGATGGAGCTGG + Intergenic
934034565 2:88078101-88078123 GGCAGCTGCCTGGAATGAGCTGG + Intronic
934097151 2:88617334-88617356 TGCAGCAACATGGAGGGAGCTGG + Intronic
934241977 2:90278039-90278061 TGCGGCCACATGGATGTAGCTGG + Intergenic
934271196 2:91538649-91538671 TGCGGCCACATGGATGTAGCTGG - Intergenic
934490026 2:94756118-94756140 TGCAGGTCCATGGAGGGAGCAGG + Intergenic
935038795 2:99405389-99405411 TCCCCCTGCATGGAAGGAGGCGG - Intronic
935083631 2:99823797-99823819 TGCGGCAACGTGGATGGAGCTGG + Intronic
935490414 2:103712953-103712975 TGCAGCACCATGGATGGAGCTGG - Intergenic
935521814 2:104115994-104116016 TGTGGCAACATGGATGGAGCTGG + Intergenic
935835136 2:107042849-107042871 TGCAGGGGCATGGATGGAGCTGG + Intergenic
935999454 2:108811915-108811937 TGCAGCAACATGGATGGAGCTGG - Intronic
936059175 2:109283326-109283348 TGGGGTGGCAAGGAAGGAGCAGG - Intronic
936174009 2:110203117-110203139 TGCAGCAACATGGATGGAGCTGG + Intronic
936539915 2:113341518-113341540 TGCGTCTGCCTGGCAGGTGCAGG + Intergenic
936905483 2:117531453-117531475 TGCAGCAACATGGATGGAGCTGG + Intergenic
937190183 2:120088279-120088301 TGCGGGACCATGGATGGAGCTGG + Intronic
938014155 2:127853514-127853536 TGCAGCAACATGGATGGAGCTGG - Intronic
939278678 2:140035017-140035039 TGCAGGAGCATGGATGGAGCTGG - Intergenic
939944214 2:148389120-148389142 TGCAGCAACATGGATGGAGCAGG - Intronic
940412564 2:153382469-153382491 TGCAGCAACATGGATGGAGCTGG - Intergenic
940458261 2:153929644-153929666 TGCAGCAACATGGATGGAGCTGG - Intronic
940539096 2:154988005-154988027 TGCAGCAACATGGATGGAGCTGG + Intergenic
940605744 2:155922885-155922907 TGCAGGGACATGGAAGGAGCTGG + Intergenic
940751737 2:157633570-157633592 TGCAGCAACATGGATGGAGCTGG - Intergenic
941332300 2:164193770-164193792 TGCAGCAACATGGATGGAGCTGG + Intergenic
941493345 2:166170012-166170034 TGAAGCAGCATGGATGGAGCTGG + Intergenic
941566026 2:167109289-167109311 TGAGACTCCATGGAAGGAGAAGG - Intronic
941832942 2:169982268-169982290 TGTGGCTGAATGGAAGGATGGGG - Intronic
941859075 2:170260399-170260421 TGCAGCAGCATGGATGCAGCTGG + Intronic
941997639 2:171615705-171615727 TGCAGCAGCATGGAAGGAACTGG + Intergenic
942201284 2:173573920-173573942 TGCAGCAACATGGATGGAGCTGG - Intergenic
942216647 2:173727511-173727533 TGCAGCAACATGGATGGAGCTGG + Intergenic
942632375 2:177964684-177964706 TGCAGCAACATGGATGGAGCTGG - Intronic
942824130 2:180153456-180153478 TGCGGGAACATGGATGGAGCTGG - Intergenic
942896479 2:181061475-181061497 TACAGCAGCATGGAAGGAGCAGG - Intronic
943102076 2:183499150-183499172 TGCAGCTGCATGGATGGAACTGG - Intergenic
943252703 2:185549059-185549081 TGCAGCAACATGGATGGAGCTGG + Intergenic
943373661 2:187048638-187048660 TGCAGCAACATGGATGGAGCTGG - Intergenic
943391118 2:187269051-187269073 TGCAGCAACATGGATGGAGCTGG - Intergenic
943444795 2:187971229-187971251 TGCAGGAGCATGGATGGAGCTGG - Intergenic
943638368 2:190331743-190331765 TGCAGCAACATGGATGGAGCTGG + Intronic
943805920 2:192125716-192125738 TGCGGGGACATGGATGGAGCTGG + Intronic
943833630 2:192491331-192491353 TGCAGCAACATGGATGGAGCTGG + Intergenic
943924294 2:193752145-193752167 TGCAGCAGCATGGATGGAACTGG - Intergenic
943936363 2:193921098-193921120 TGCAGAGGCATGGATGGAGCAGG + Intergenic
943945153 2:194051662-194051684 TGCAGCAACATGGAAGGAGCTGG + Intergenic
943955682 2:194186413-194186435 GGCGGGTGCATGGATGGAACTGG - Intergenic
944059647 2:195559020-195559042 TGCGGGAACATGGATGGAGCTGG + Intergenic
944132363 2:196360391-196360413 TGCAGGAGCATGGATGGAGCTGG + Intronic
944259532 2:197661186-197661208 TGCAGCAACATGGATGGAGCTGG - Intronic
944299289 2:198104336-198104358 TGCAGCAACATGGATGGAGCTGG - Intronic
944731694 2:202523889-202523911 TGCAGCAACATGGATGGAGCTGG + Intronic
945342739 2:208676530-208676552 TGCAGCAACATGGATGGAGCTGG - Intronic
945541920 2:211098423-211098445 TGCAGCAACATGGATGGAGCTGG - Intergenic
945798601 2:214395827-214395849 TGCAGCAACATGGATGGAGCTGG - Intronic
945861074 2:215123078-215123100 TGCAGCAACATGGATGGAGCTGG - Intronic
946319257 2:218940707-218940729 TGCAGCAACATGGATGGAGCTGG - Intergenic
946433217 2:219636468-219636490 TGGGGCAGGATGGATGGAGCAGG - Intronic
946936294 2:224724538-224724560 TGCAGCAGCATGGATAGAGCTGG - Intergenic
946983548 2:225246558-225246580 TGCAGCAACATGGATGGAGCTGG - Intergenic
947198112 2:227589213-227589235 TGCAGGGGCATGGATGGAGCTGG - Intergenic
947641066 2:231708139-231708161 CGCGGCTGCTCGGAAGGAGGGGG - Intronic
947905750 2:233760740-233760762 TGGGGCTGCAAGGAAGGAAAGGG - Exonic
947975106 2:234358503-234358525 TGCAGGAGCATGGATGGAGCTGG - Intergenic
947977431 2:234379094-234379116 TGCGGGAACATGGAAGAAGCTGG - Intergenic
948262597 2:236615167-236615189 GGCAGCTGCAGGGAAGCAGCAGG - Intergenic
1169024659 20:2359003-2359025 TGCAGCAACATGGATGGAGCTGG - Intergenic
1169521253 20:6375521-6375543 TGCAGCAACATGGATGGAGCTGG + Intergenic
1169678121 20:8177992-8178014 TGCAGCAACATGGATGGAGCTGG - Intronic
1169756443 20:9048148-9048170 TGCAGAGGCATGGATGGAGCTGG + Intergenic
1169933724 20:10860626-10860648 TGCAGGTACATGGATGGAGCTGG + Intergenic
1170265254 20:14460020-14460042 TGCAGGTACATGGATGGAGCTGG - Intronic
1170339795 20:15311629-15311651 TGCAGCAACATGGATGGAGCTGG + Intronic
1170521184 20:17187171-17187193 TGCAGAGGCATGGATGGAGCTGG + Intergenic
1171114821 20:22516011-22516033 TGCAGCAGCATGAATGGAGCTGG + Intergenic
1171117922 20:22542623-22542645 TGCAGCAACATGGATGGAGCTGG - Intergenic
1171130690 20:22650159-22650181 TGCAGCAACATGGATGGAGCTGG - Intergenic
1171937784 20:31292463-31292485 TGCAGCAGCATGGATGGAGCTGG + Intergenic
1173549050 20:43919818-43919840 TGCAGTGGCATGGATGGAGCTGG - Intronic
1173574405 20:44102113-44102135 TGCAGCAACATGGATGGAGCTGG + Intergenic
1173606740 20:44337094-44337116 GCCGGCTGCCTGGAAGGGGCAGG - Exonic
1173695536 20:45008030-45008052 TGCAGCAACATGGATGGAGCTGG - Intronic
1173712348 20:45170845-45170867 TGCAGCAACATGGATGGAGCTGG + Intergenic
1173772365 20:45672539-45672561 TGCAGCAACATGGATGGAGCTGG + Intergenic
1173909281 20:46651933-46651955 TGCGGGAACATGGATGGAGCTGG + Intronic
1174675964 20:52355929-52355951 TGCAGGGGCATGGATGGAGCTGG - Intergenic
1174686393 20:52459865-52459887 TGCAGCAACATGGATGGAGCTGG + Intergenic
1174965598 20:55211044-55211066 TGCAGCAGCTTGGATGGAGCTGG + Intergenic
1175320980 20:58088208-58088230 CGGTGCTGCATGGAAGGAGCTGG + Intergenic
1175673975 20:60931400-60931422 TTCTGCTGCATGGAAGGGGCTGG + Intergenic
1175683549 20:61009354-61009376 TGCAGCAACATGGAAGAAGCTGG - Intergenic
1175688759 20:61050545-61050567 TGAGGGAGCATAGAAGGAGCAGG + Intergenic
1175757817 20:61540750-61540772 TGAAGCTGCATGGAAGAAACTGG - Intronic
1175826812 20:61940995-61941017 AGTGGCAGCAAGGAAGGAGCTGG + Intergenic
1175946496 20:62561366-62561388 TGCGGCTGCAGGGGAGGGCCCGG + Intronic
1176160084 20:63643221-63643243 GGCGGCCACCTGGAAGGAGCAGG - Intronic
1177564323 21:22798407-22798429 TTCAGCTTCATGAAAGGAGCAGG - Intergenic
1177666492 21:24166415-24166437 TGCAGCAACATGGATGGAGCTGG - Intergenic
1177884996 21:26736244-26736266 TGCAGCAACATGGATGGAGCTGG - Intergenic
1177886401 21:26751077-26751099 TGCGGGAACATGGATGGAGCTGG + Intergenic
1178046706 21:28703006-28703028 TGCAGCAACATGGATGGAGCTGG + Intergenic
1178060275 21:28846092-28846114 TGCAGCAGCATGGATGGAGCTGG - Intergenic
1178546243 21:33495267-33495289 TGCGGGAACATGGATGGAGCTGG + Intergenic
1178628396 21:34238142-34238164 TGCAGCAACATGGATGGAGCTGG + Intergenic
1179092666 21:38281567-38281589 TGCAGCAACATGGATGGAGCTGG - Intronic
1179240971 21:39591890-39591912 TGCGGGGACATGGATGGAGCTGG - Intronic
1179476916 21:41652714-41652736 TGCAGCAACATGGATGGAGCTGG - Intergenic
1180064249 21:45404946-45404968 TGCGGCTGCGAGGACGGGGCGGG - Intergenic
1180717550 22:17882036-17882058 TGGGGCAGCATGCAGGGAGCCGG + Intronic
1180880019 22:19197087-19197109 TGGGGCTGAATGCAAGGGGCTGG - Intronic
1181736102 22:24882803-24882825 CGCAGCAGCATGGATGGAGCTGG - Intronic
1182080363 22:27524462-27524484 CTGGCCTGCATGGAAGGAGCCGG + Intergenic
1182201040 22:28570403-28570425 TGCAGCAACATGGATGGAGCTGG + Intronic
1182301162 22:29337874-29337896 TGCGTCTGCAGGGAAGGGGTGGG - Intronic
1182680085 22:32072359-32072381 TGCAGCACCATGGATGGAGCTGG - Intronic
1182735859 22:32532065-32532087 TGCTGGTGCAAGGGAGGAGCTGG + Intronic
1182759297 22:32709010-32709032 TGCTGCTGCAAGACAGGAGCTGG - Intronic
1182788008 22:32923985-32924007 TGTGGGAGCATGGATGGAGCTGG - Intronic
1184103548 22:42354274-42354296 TGTGGCTGCAGGGAAGTGGCGGG - Intergenic
1184126753 22:42492608-42492630 TGGGGCTACTTGGAAGGACCAGG - Intergenic
1184258412 22:43300681-43300703 TGAGGCTGCTTGAAAGGAGGTGG - Intronic
1185179341 22:49350193-49350215 TGTGGCTCCATGGAAGGAACGGG + Intergenic
1185392238 22:50568790-50568812 TGCCCCTGCATGGGAGGAGGTGG + Intergenic
949270970 3:2216231-2216253 TGTGGCATCATGGATGGAGCTGG + Intronic
949297754 3:2546356-2546378 TGCAGCAACATGGATGGAGCTGG + Intronic
949367256 3:3296187-3296209 TGCAGCTACATGAATGGAGCTGG + Intergenic
949680263 3:6505567-6505589 TGCAGGGACATGGAAGGAGCTGG + Intergenic
950140032 3:10609052-10609074 CGCTGCTTCATGGAATGAGCAGG + Intronic
950353919 3:12387014-12387036 TGCAGGGGCATGGATGGAGCTGG - Intronic
950848453 3:16038186-16038208 TGCAGCAACATGGATGGAGCTGG - Intergenic
950852342 3:16074518-16074540 TGCAGAAGCATGGATGGAGCTGG + Intergenic
951030050 3:17871327-17871349 TGCAGCAACATGGATGGAGCTGG - Intronic
951060274 3:18198564-18198586 TGCAGCAGCTTGGATGGAGCTGG + Intronic
951217729 3:20040505-20040527 GGCGGCTGCGGGGCAGGAGCCGG + Exonic
951260145 3:20497535-20497557 TGCAGCAACATGGAAGCAGCTGG - Intergenic
951433613 3:22636833-22636855 TGCAGGGGCATGGATGGAGCTGG - Intergenic
951479213 3:23141780-23141802 TGCAGCAACATGGATGGAGCTGG + Intergenic
951732796 3:25829223-25829245 TGCGGGAACATGGAGGGAGCTGG + Intergenic
952293862 3:32043758-32043780 TGCAGCAGCATGGATGCAGCTGG + Intronic
952408902 3:33029647-33029669 TGCAGCAACATGGATGGAGCTGG + Intronic
952643158 3:35622603-35622625 TGCAGCAACATGGATGGAGCTGG - Intergenic
953230374 3:41059241-41059263 TGCAGCAGCATGGACGCAGCTGG - Intergenic
953727381 3:45411985-45412007 TGCAGCAACATGGATGGAGCTGG - Intronic
954900832 3:54018213-54018235 TGCAGCGGCATGGATGGAGCTGG + Intergenic
955105575 3:55894628-55894650 TGCAGCAACATGGATGGAGCTGG + Intronic
955117659 3:56021867-56021889 TGCGGGAACATGGATGGAGCTGG - Intronic
955141229 3:56271893-56271915 TGCAGCAACATGGATGGAGCTGG - Intronic
955852053 3:63231192-63231214 TGCAGCTACTTGGATGGAGCTGG + Intronic
956050004 3:65237628-65237650 TGCAGGGACATGGAAGGAGCTGG - Intergenic
956331124 3:68110272-68110294 TGCAGAGACATGGAAGGAGCTGG - Intronic
956559715 3:70561481-70561503 TGCAGCAGCATGGATGGAGTTGG - Intergenic
957023610 3:75152939-75152961 TGCAGCAGCATGGATGCAGCTGG - Intergenic
957532293 3:81455855-81455877 TGCAGCCACATGGATGGAGCTGG + Intergenic
957633453 3:82748785-82748807 TGCAGCAACATGGATGGAGCTGG + Intergenic
957748128 3:84372407-84372429 TGCAGGGGCATGGATGGAGCTGG + Intergenic
957852753 3:85831135-85831157 TGCAGCAGCATGGATGCAGCTGG - Intronic
957872010 3:86101267-86101289 TGCAGGGGCATGGATGGAGCTGG - Intergenic
958056530 3:88419401-88419423 TGCAGCAGCATGAATGGAGCTGG - Intergenic
958152561 3:89709518-89709540 TGCAGCAGCATGGATGGAGCTGG + Intergenic
958265256 3:91430643-91430665 TGCAGCAGCATGGATGCAGCTGG - Intergenic
958551474 3:95619368-95619390 TGCAGCAACATGGATGGAGCTGG + Intergenic
959082846 3:101820718-101820740 TGTGGGAGCATGGATGGAGCTGG + Intronic
959268770 3:104177473-104177495 TGCAGCATCATTGAAGGAGCTGG - Intergenic
959328733 3:104974195-104974217 TGCTGCTACATGGATGGAACAGG - Intergenic
959392802 3:105797278-105797300 TGCAGCAACATGGATGGAGCTGG + Intronic
959413283 3:106051950-106051972 TGCAGCAACATGGATGGAGCTGG - Intergenic
959463756 3:106659295-106659317 TGCAGCAACTTGGAAGGAGCTGG + Intergenic
959899712 3:111646911-111646933 TGCAGCAGCATGGATGGAACTGG + Intronic
960061196 3:113323309-113323331 TGCAGCAACATGGATGGAGCTGG + Intronic
960234733 3:115268912-115268934 TGCGGGGACATGGATGGAGCTGG + Intergenic
960369959 3:116823068-116823090 TGCAGCAACATGGATGGAGCCGG + Intronic
960876640 3:122302240-122302262 TGCGGGAACATGGATGGAGCCGG - Intergenic
960884093 3:122376663-122376685 TGCAGCAACATGGATGGAGCTGG + Intronic
961265727 3:125640804-125640826 TGCCGCAGCATGGATGCAGCTGG + Intergenic
961717079 3:128865089-128865111 TGTGCCTGCGTGGGAGGAGCAGG + Intergenic
961943096 3:130657127-130657149 CGCAGCTGCATTCAAGGAGCAGG + Intronic
962507200 3:136059824-136059846 TGCAGGTACATGGATGGAGCTGG + Intronic
963053472 3:141162803-141162825 TGCGGGAACATGGATGGAGCTGG + Intergenic
963274083 3:143313461-143313483 TGTGGCTGCCAGGAAAGAGCAGG - Intronic
963381977 3:144541971-144541993 TGAAGCAGCATGGATGGAGCTGG + Intergenic
963463756 3:145650598-145650620 TGCAGCAACATGGATGGAGCTGG - Intergenic
963491763 3:146010456-146010478 TGCAGCAACATGGATGGAGCTGG + Intergenic
963574170 3:147039074-147039096 TGCAGCAACATGGATGGAGCTGG + Intergenic
963859274 3:150291003-150291025 TGCAGCAACATGGATGGAGCTGG - Intergenic
963867513 3:150378661-150378683 TGCGGAGGGAAGGAAGGAGCTGG + Intergenic
964084191 3:152796770-152796792 TGCAGCAGCATGGATGCAGCTGG - Intergenic
964177480 3:153841599-153841621 TGCAGCAACATGGATGGAGCTGG - Intergenic
964253045 3:154742463-154742485 TGCAGCAACATGGATGGAGCTGG + Intergenic
964414831 3:156436214-156436236 TGCTGGTGCATGGGTGGAGCTGG - Intronic
964458647 3:156896893-156896915 TGCAGCAACATGGATGGAGCTGG + Intronic
964808981 3:160642074-160642096 TGCTGCTGGATGGGAGGAGAGGG - Intergenic
965060603 3:163780510-163780532 AGCGGCTGCCTGGATGGAGTTGG - Intergenic
965385018 3:168035493-168035515 TGCAGGGGCATGGATGGAGCTGG + Intronic
965601113 3:170455506-170455528 TGCAGCAGCATGGATGCAGCTGG - Intronic
965686536 3:171309246-171309268 TGCAGCAACATGGATGGAGCTGG + Intronic
965725063 3:171707012-171707034 TGCAGCAACATGGATGGAGCTGG + Intronic
965725946 3:171716065-171716087 TGCAGCAACATGGATGGAGCTGG - Intronic
965952939 3:174332881-174332903 TGCGGCAACATGGATGGAACTGG + Intergenic
966042037 3:175503224-175503246 TGCAGCAACATGGATGGAGCTGG - Intronic
966273346 3:178135256-178135278 TGCAGCAACATGGATGGAGCTGG + Intergenic
966541120 3:181090746-181090768 TGCAGCAACATGGATGGAGCTGG - Intergenic
966543950 3:181123348-181123370 TGCAGCAACATGGATGGAGCTGG - Intergenic
966722193 3:183075013-183075035 TGCGGGAACATGGATGGAGCTGG - Intronic
966771185 3:183505002-183505024 TGCAGCAACATGGATGGAGCTGG - Intronic
966774108 3:183528993-183529015 TGCAGGGACATGGAAGGAGCTGG + Intronic
967002613 3:185351055-185351077 TGCAGCAACATGGATGGAGCTGG + Intronic
967114233 3:186322271-186322293 TGCAGCAACATGGATGGAGCTGG + Intronic
967386410 3:188915859-188915881 TGCAGGGACATGGAAGGAGCTGG - Intergenic
967461339 3:189750164-189750186 TGCAGCTACATGGATGGAACTGG + Intronic
967646484 3:191929726-191929748 TGCAGCAACATGGATGGAGCTGG + Intergenic
968288980 3:197524578-197524600 TGTGGCTGCATGGAACAAGCTGG - Intronic
968383812 4:118499-118521 TGCTGCAACATGGAAGCAGCTGG - Intergenic
968597351 4:1492302-1492324 TGCGGCTGCACCCCAGGAGCAGG + Intergenic
968719584 4:2191189-2191211 TGCAGCAACATGGATGGAGCTGG + Intronic
968803666 4:2758670-2758692 TGAGGCTTCATGGCAGCAGCCGG + Intergenic
968863988 4:3195973-3195995 TGCTGCTGCTGGGAAGCAGCAGG - Intronic
969198407 4:5581846-5581868 TGAGGCTGGATGCAGGGAGCAGG - Intronic
969259356 4:6023735-6023757 TGTGTCTGCATGGGAAGAGCCGG - Intergenic
969782525 4:9420156-9420178 TGCAGCAGCATGGATGCAGCTGG + Intergenic
969837676 4:9856809-9856831 TGCAGCAACATGGATGGAGCTGG + Intronic
970413626 4:15835327-15835349 TGCAGCAACATGGAAGGAACTGG - Intronic
970578568 4:17451937-17451959 TGCGGCAACATGGATGGAACTGG - Intergenic
970624694 4:17863840-17863862 TGCAGCAACATGGATGGAGCTGG + Intronic
970649691 4:18162568-18162590 TGCAGCAACATGGATGGAGCTGG - Intergenic
970666844 4:18346704-18346726 TGCAGGTACATGGATGGAGCTGG + Intergenic
971004705 4:22359911-22359933 TGCAGCAACATGGATGGAGCTGG + Intronic
971452605 4:26813945-26813967 TCGGGCTGCTTGGCAGGAGCTGG - Intergenic
971737915 4:30481083-30481105 TGCAGCAACATGGATGGAGCTGG + Intergenic
971798448 4:31258561-31258583 TGCTGCAACATGGATGGAGCTGG + Intergenic
972103721 4:35455715-35455737 TGCAGCAACATGGATGGAGCTGG - Intergenic
972153209 4:36122460-36122482 TGCAGCAACATGGATGGAGCTGG + Intronic
972453779 4:39231836-39231858 TGAGGCTGCCTGGAATGAGTTGG + Exonic
972659767 4:41104796-41104818 TGCAGCAACATGGATGGAGCTGG - Intronic
972824564 4:42742313-42742335 TGCAGCATCATGGATGGAGCTGG + Intergenic
972963164 4:44478085-44478107 TGCAGCCACATGGATGGAGCTGG - Intergenic
972983370 4:44732832-44732854 TGCGGCAACATGGATGCAGCTGG + Intergenic
973072738 4:45885167-45885189 TGCAGCAACATGGATGGAGCTGG - Intergenic
973126292 4:46589545-46589567 TGCAGCAGCATGGATGGAGCTGG - Intergenic
973755950 4:54073587-54073609 TGGGGCTGCTTGGCTGGAGCTGG - Intronic
973864807 4:55101793-55101815 TGCAGCTGCATGGATGGAGCTGG - Intronic
973913865 4:55612999-55613021 TGCAGCAACATGGATGGAGCTGG + Intronic
974185297 4:58437725-58437747 TGCAGCAACATGGATGGAGCTGG - Intergenic
974722805 4:65764138-65764160 TGCAGGGACATGGAAGGAGCTGG - Intergenic
975036097 4:69684647-69684669 TGCAGCAACATGGATGGAGCTGG - Intergenic
975105634 4:70565765-70565787 TGTGGGAACATGGAAGGAGCTGG - Intergenic
975163340 4:71148693-71148715 TGCGGGAACATGGATGGAGCTGG - Intergenic
975494394 4:75021755-75021777 TGCGGCAACATGGATGGAGCTGG - Intronic
975705415 4:77107643-77107665 TGCAGCAGCATGGATGCAGCTGG + Intergenic
975891971 4:79040541-79040563 TGCAGCAACATGGATGGAGCTGG + Intergenic
976368967 4:84265272-84265294 TGCAGCAACATGGATGGAGCTGG + Intergenic
976452594 4:85208082-85208104 TGCAGCAACATGGATGGAGCTGG + Intergenic
976498115 4:85754225-85754247 TGCAGCAGCATGGATGGAACTGG - Intronic
976503651 4:85820483-85820505 TGAGGCTGGAAGGAGGGAGCAGG + Intronic
976673216 4:87676666-87676688 TGCAGCAACATGGATGGAGCTGG + Intergenic
976973754 4:91141113-91141135 TGCAGCAACATGGATGGAGCTGG - Intronic
977184475 4:93919431-93919453 TGCAGCAACATGGATGGAGCTGG - Intergenic
977482831 4:97599933-97599955 TGCTGCAACATGGATGGAGCTGG + Intronic
977508495 4:97932661-97932683 TGCGGGTGCATGGATGGAGCTGG - Intronic
977537191 4:98267642-98267664 TGCAGCAACATGGATGGAGCTGG - Intronic
977647660 4:99432160-99432182 TGCAGGGACATGGAAGGAGCTGG + Intronic
977732373 4:100369083-100369105 TGCAGCAACATGGATGGAGCTGG - Intergenic
978133727 4:105232162-105232184 TGCAGCAACATGGATGGAGCTGG - Intronic
978252971 4:106655458-106655480 TGCAGCAACATGGATGGAGCTGG + Intergenic
978317984 4:107461293-107461315 TGCGGGAACATGGATGGAGCCGG + Intergenic
978391512 4:108231101-108231123 TGAAGCAGCATGGAAAGAGCTGG - Intergenic
978694783 4:111564866-111564888 TGCAGCAACATGGATGGAGCTGG - Intergenic
978771700 4:112463715-112463737 TGCAGCTACATGGATGGAGCTGG + Intergenic
978839983 4:113200623-113200645 TGCAGCAACATGGATGGAGCTGG - Intronic
978840479 4:113206385-113206407 TGCGGGAACATGGACGGAGCTGG - Intronic
978931317 4:114315955-114315977 TGCAGCAGCATGGATGCAGCTGG + Intergenic
979075729 4:116267050-116267072 TGTGGCAACATGGATGGAGCTGG + Intergenic
979179306 4:117705788-117705810 TGCAGCAGCATGGGTGGAGCTGG - Intergenic
979219161 4:118201082-118201104 TGCAGCAACATGGATGGAGCTGG - Intronic
979583958 4:122392395-122392417 TGCAGCAACATGGATGGAGCTGG + Intronic
979662656 4:123275790-123275812 TGCAGCAGCATGGATGAAGCTGG - Intronic
979854632 4:125616438-125616460 TGCGGGAACATGGATGGAGCTGG - Intergenic
980235190 4:130096285-130096307 TGCAGCAACATGGATGGAGCTGG - Intergenic
980746825 4:137028911-137028933 TGCAGCAACATGGATGGAGCTGG - Intergenic
980824698 4:138059469-138059491 TGCAGCAACATGGATGGAGCTGG - Intergenic
980830205 4:138121863-138121885 TGCAGCAACATGGATGGAGCTGG + Intergenic
981444275 4:144817656-144817678 TGCGGCAACATGGATGGAACTGG + Intergenic
981444803 4:144823285-144823307 TGCAGCAGCATGGATGGAGCTGG - Intergenic
981453566 4:144927743-144927765 TGCAGCCACATGGATGGAGCTGG - Intergenic
981466605 4:145079723-145079745 TGCAGCAGCATGGATGCAGCTGG + Intronic
981516872 4:145619342-145619364 TGCGCCTGCGTGGGAGGATCCGG + Exonic
981739884 4:147990626-147990648 TGCAGCAACATGGATGGAGCTGG + Intronic
982040861 4:151395121-151395143 TGTGGCAACATGGATGGAGCTGG + Intergenic
982162311 4:152582670-152582692 TGCAGCAACATGGATGGAGCTGG + Intergenic
982755808 4:159217453-159217475 TGCAGCAACATGGATGGAGCTGG - Intronic
983046669 4:162995476-162995498 TGCAGGGGCATGGATGGAGCTGG + Intergenic
983173413 4:164560446-164560468 TGCAGCCACATGGAAGCAGCTGG - Intergenic
983268028 4:165528274-165528296 TGCAGCAACATGGATGGAGCTGG - Intergenic
983308047 4:166019149-166019171 TTCAGCCGCATGGATGGAGCTGG + Intronic
983336083 4:166394371-166394393 TGCAGCAACATGGATGGAGCTGG + Intergenic
983565394 4:169145278-169145300 TGCAGCAACATGGATGGAGCTGG + Intronic
983584317 4:169339151-169339173 TGCAGGGGCATGGATGGAGCTGG - Intergenic
983758936 4:171380830-171380852 TGCGGCAACATGAATGGAGCTGG - Intergenic
983824200 4:172237011-172237033 TGCAGCAACATGGATGGAGCTGG - Intronic
983956317 4:173702736-173702758 TGCGGCAGCATGGATGCAGCTGG + Intergenic
983985357 4:174053189-174053211 TGCGGGGTCATGGATGGAGCTGG + Intergenic
984027878 4:174566940-174566962 TGCAGCAACATGGATGGAGCTGG + Intergenic
984178988 4:176457299-176457321 TGCAGCAGCATGGATGGAACTGG + Intergenic
984205830 4:176786852-176786874 TGGGGCTGCCTGGAAGAGGCAGG - Intronic
984337136 4:178407428-178407450 TGCAGCAACATGGATGGAGCTGG + Intergenic
984820235 4:183875563-183875585 TACTGCTGCATGAAAGGAGGAGG - Intronic
984842909 4:184084610-184084632 TGCGGGAACATGGAAGAAGCTGG + Intergenic
984946965 4:184976487-184976509 TGCGGGAGCATGGAAGGAGCTGG - Intergenic
985395858 4:189543143-189543165 TGCAGCAGCGTGGATGGAGCTGG + Intergenic
985749648 5:1667071-1667093 AGCGGCTGCAGGGAAGGGGCGGG + Intergenic
986014030 5:3741688-3741710 CAAGGCTGCCTGGAAGGAGCAGG - Intergenic
986232832 5:5882828-5882850 TCAGGCAGCGTGGAAGGAGCTGG + Intergenic
986431408 5:7684657-7684679 TCCAGCTGGATGGAAAGAGCTGG + Intronic
986473708 5:8102062-8102084 TGCTGCAACATGGATGGAGCTGG - Intergenic
986967244 5:13288712-13288734 TGCAGAGGCATGGATGGAGCTGG - Intergenic
986970867 5:13334879-13334901 TGCAGCAACATGGATGGAGCTGG - Intergenic
987463096 5:18237899-18237921 TGCGGCAGCATGAATGGAACTGG - Intergenic
987796279 5:22631480-22631502 TGCAGCAACATGGATGGAGCTGG + Intronic
987836834 5:23172935-23172957 TGCAGGTACATGGATGGAGCTGG - Intergenic
987872122 5:23633846-23633868 TGCAGCAGCATGGATGGAACTGG + Intergenic
988436810 5:31185432-31185454 TGCGGCAACATGGATGGAACTGG + Intergenic
988554783 5:32226639-32226661 TGCGGCAACATGGATGCAGCTGG - Intergenic
988651560 5:33157520-33157542 TGCAGCAACATGGATGGAGCTGG + Intergenic
988724723 5:33914996-33915018 TGCGGGGACATGGATGGAGCTGG - Intergenic
988976257 5:36519299-36519321 TGCAGCAACATGGATGGAGCTGG + Intergenic
989299283 5:39869821-39869843 TGCAGCAGCATGGATGGAGCTGG - Intergenic
989339949 5:40362940-40362962 TGCAGCAGCATGGATGGAGCTGG - Intergenic
989413320 5:41144880-41144902 TGCAGCAACATGGATGGAGCTGG - Intronic
989541445 5:42623450-42623472 TGGGAATGCATGGATGGAGCTGG - Intronic
989559543 5:42835578-42835600 TGCGGGAACATGGATGGAGCTGG + Intronic
989583026 5:43051264-43051286 TGCAGCTGCTTGGAAGGTGGAGG + Intergenic
989697668 5:44222668-44222690 TGCAGCAGCATGGATGAAGCTGG + Intergenic
989722458 5:44545718-44545740 TGCAGGTACATGGATGGAGCTGG + Intergenic
990046390 5:51437473-51437495 TGCAGCAACATGGATGGAGCTGG - Intergenic
990134113 5:52624441-52624463 TGCAGCAGCATGGATGGAGGTGG - Intergenic
990330648 5:54722175-54722197 GGCGGCTGCCTGGAAGGCACTGG + Intergenic
990486685 5:56266180-56266202 TGCAGCAACATGGATGGAGCTGG - Intergenic
990642261 5:57799999-57800021 TGCAGCAACATGGATGGAGCTGG - Intergenic
991362865 5:65839386-65839408 TGCAGCAACATGGATGGAGCTGG + Intronic
992303312 5:75407641-75407663 TGCAGCAACATGGATGGAGCTGG + Intronic
993019881 5:82579239-82579261 TGCGGGGACATGGATGGAGCTGG - Intergenic
993380978 5:87207360-87207382 TGCAGCAACATGGATGGAGCTGG - Intergenic
993793081 5:92231850-92231872 TGCAGCAACATGGATGGAGCTGG - Intergenic
993923535 5:93837258-93837280 TGCAGCAACATGGATGGAGCTGG - Intronic
993952783 5:94196764-94196786 TGCAGCAACATGGATGGAGCTGG - Intronic
993995656 5:94719513-94719535 TGCAGGTACATGGATGGAGCTGG + Intronic
994262283 5:97673951-97673973 TGCAGGGGCATGGATGGAGCTGG - Intergenic
994263561 5:97687891-97687913 TGCAGCAACATGGATGGAGCTGG + Intergenic
994292193 5:98040995-98041017 TGCAGCAACATGGATGGAGCTGG + Intergenic
994333735 5:98539399-98539421 TGCAGCAGCATGGATGCAGCTGG - Intergenic
994513675 5:100742104-100742126 TGCAGCAACATGGATGGAGCTGG + Intergenic
994550339 5:101226553-101226575 TGCCGCAGCTTGGATGGAGCTGG - Intergenic
994614328 5:102084473-102084495 TGCAGCAACATGGATGGAGCTGG + Intergenic
994638226 5:102369904-102369926 TGCAGCAACATGGATGGAGCTGG + Intergenic
994721696 5:103387669-103387691 TGCAGCAACATGGATGGAGCTGG - Intergenic
994926497 5:106122600-106122622 TGCTGCAGCATGGATGCAGCTGG - Intergenic
995189492 5:109305532-109305554 TGTAGGTGCATGGAAGGAACAGG - Intergenic
995455806 5:112350767-112350789 TGCAGCATCATGGATGGAGCTGG - Intronic
995481696 5:112599452-112599474 TGCAGCAGCATGGATGCAGCTGG + Intergenic
995481803 5:112600673-112600695 TGCAGCAGCATGGATGCAGCTGG + Intergenic
995488470 5:112663740-112663762 TGCGGCAACATGGATGGAGCTGG + Intergenic
995630928 5:114131424-114131446 TGCAGAGACATGGAAGGAGCTGG - Intergenic
995701911 5:114945568-114945590 TGCAGCAACATGGATGGAGCTGG - Intergenic
995717995 5:115099313-115099335 TGCAGCAACATGGATGGAGCTGG - Intergenic
996027672 5:118666623-118666645 TGCAGCAACATGGAAGCAGCTGG + Intergenic
996142360 5:119927947-119927969 TGCAGGTACATGGATGGAGCTGG - Intergenic
996323461 5:122245874-122245896 TGCAGCAACATGGATGGAGCTGG - Intergenic
996469091 5:123838686-123838708 TGCAGCAGCATGGATGGAACTGG + Intergenic
997019670 5:129984325-129984347 TGCAGCAACATGGATGGAGCTGG - Intronic
997378398 5:133415730-133415752 TGCGGCAGCGTGGCAGGGGCAGG + Intronic
997820334 5:137060294-137060316 TGCAGCAACATGGATGGAGCTGG + Intronic
997886338 5:137633657-137633679 TGCAGCAACATGGATGGAGCTGG + Intronic
998313581 5:141158132-141158154 TGCGGCTGTGCAGAAGGAGCAGG + Intergenic
998319581 5:141216255-141216277 TGCGGCTGTGTAGGAGGAGCAGG + Exonic
998577389 5:143331627-143331649 TGCGGCAACATGGATGGAGCTGG + Intronic
998751246 5:145323759-145323781 TGCAGCAACATGGATGGAGCTGG - Intergenic
999593647 5:153177704-153177726 TGCAGCAACATGGATGGAGCTGG + Intergenic
999761703 5:154706401-154706423 TGCAGCAACATGGATGGAGCTGG + Intergenic
999853470 5:155567913-155567935 TGCAGCAACATGGATGGAGCTGG + Intergenic
999853589 5:155569236-155569258 TGCAGCAACATGGATGGAGCTGG - Intergenic
1000493057 5:161939453-161939475 TGCAGCAACATGGATGGAGCTGG - Intergenic
1000510114 5:162170561-162170583 TGCAGGGGCATGGATGGAGCTGG + Intergenic
1000521237 5:162297179-162297201 TGCAGCAACATGGATGGAGCTGG - Intergenic
1000642532 5:163719661-163719683 TGCAGCAACATGGATGGAGCTGG + Intergenic
1000686127 5:164252050-164252072 TGCAGCAACATGGATGGAGCTGG + Intergenic
1000731916 5:164845333-164845355 TGCAGCTACATGGATGGAGCTGG - Intergenic
1000822326 5:165999887-165999909 TGCTGCAGCATGGATGCAGCTGG - Intergenic
1001377171 5:171272038-171272060 TGCAGCAACATGGATGGAGCTGG + Intronic
1001767960 5:174269276-174269298 TGCAGCAACATGGACGGAGCTGG + Intergenic
1001869881 5:175142891-175142913 TGCAGCAACATGGATGGAGCTGG - Intergenic
1001961929 5:175884656-175884678 AGAGGGTGCATGGAAGGAGAGGG - Intergenic
1002052823 5:176581271-176581293 TCCGGCTGCATCGGAGGGGCTGG + Intronic
1002060388 5:176622127-176622149 TGACGCTGCCTGGATGGAGCTGG - Intronic
1002424106 5:179165698-179165720 TGGGGCTGCATGGTAGCTGCAGG + Intronic
1002520864 5:179792757-179792779 TGGGGCAGCAAGGAAGGACCAGG + Intronic
1002821191 6:726519-726541 TGCAGGAGCATGGATGGAGCTGG + Intergenic
1002870139 6:1159619-1159641 TGCAGCAACATGGATGGAGCTGG - Intergenic
1002923677 6:1592463-1592485 TGCAGCAACATGGATGGAGCTGG + Intergenic
1003128781 6:3377577-3377599 TGCAGCTGCATGGGAGGGGAAGG - Intronic
1003242414 6:4356192-4356214 TGCAGCAACATGGATGGAGCTGG - Intergenic
1003315015 6:5004068-5004090 TGCGGCCGGAGGGAAGGGGCGGG - Intergenic
1003532779 6:6951970-6951992 TGCAGCTTCATGGAGGGAGAAGG - Intergenic
1003667619 6:8126479-8126501 TGCGGCAACATGGATGTAGCTGG + Intergenic
1003683262 6:8276582-8276604 TGCAGCAGCATGGATGGAACTGG + Intergenic
1003823276 6:9924316-9924338 TGCGGGAACATGGATGGAGCTGG + Intronic
1004011203 6:11689616-11689638 TGCAGGGACATGGAAGGAGCTGG + Intergenic
1004059355 6:12177009-12177031 TGCGGGAACATGGATGGAGCTGG + Intergenic
1004188568 6:13444204-13444226 TGCGGGAACATGGATGGAGCTGG + Intronic
1004297260 6:14424228-14424250 TGCAGCAGCATGGATGGAACCGG - Intergenic
1004549048 6:16628761-16628783 TGCAGGAGTATGGAAGGAGCTGG - Intronic
1004828575 6:19451258-19451280 TGCAGGGACATGGAAGGAGCTGG - Intergenic
1005151821 6:22760318-22760340 TGCAGAAACATGGAAGGAGCTGG - Intergenic
1005277692 6:24237765-24237787 TGCAGCAACATGGATGGAGCTGG + Intronic
1005464223 6:26096033-26096055 AGTGGCTCCATGGAAGGACCTGG - Exonic
1005796686 6:29370233-29370255 TGCAGCAACATGGATGGAGCTGG - Intronic
1005909698 6:30297680-30297702 TGCAGCAGCATGGATGGAGCTGG - Intergenic
1006139166 6:31917328-31917350 TGCAGCAACATGGATGGAGCTGG + Intronic
1006268116 6:32942236-32942258 TGCAGCATCATGGATGGAGCTGG - Intronic
1006725617 6:36197118-36197140 GGCGGCGGCAGGGAAGGAGAAGG + Intronic
1006980932 6:38147288-38147310 TGCAGCAACATGGATGGAGCTGG - Intronic
1008318782 6:50080772-50080794 TGCAGCGACATGGATGGAGCTGG - Intergenic
1008696156 6:54040760-54040782 TGCAGCAACATGGATGGAGCTGG + Intronic
1008707261 6:54177890-54177912 TGCGGGAACATGGATGGAGCTGG + Intronic
1008740803 6:54605499-54605521 TGCAGGGACATGGAAGGAGCTGG - Intergenic
1008823340 6:55660512-55660534 TGCAGGTACATGGATGGAGCTGG - Intergenic
1009178697 6:60490553-60490575 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1009263969 6:61531168-61531190 TGCAGGAGCATGGATGGAGCTGG + Intergenic
1009285246 6:61807514-61807536 TGCGGCAACATAGATGGAGCTGG + Intronic
1009315324 6:62212002-62212024 TGCAGGTACATGGATGGAGCTGG + Intronic
1010084649 6:71902822-71902844 TGCAGGTACATGGATGGAGCTGG - Intronic
1010096795 6:72056107-72056129 TGCAGCAACATGGATGGAGCTGG + Intronic
1010127789 6:72454049-72454071 TGCAGCAACATGGAAGGAGCTGG + Intergenic
1010257485 6:73775816-73775838 TGCAGGTACATGGATGGAGCTGG - Intronic
1010507239 6:76675554-76675576 TGCAGCAACATGGACGGAGCTGG - Intergenic
1010520014 6:76821148-76821170 TGCAGCAACATGGATGGAGCTGG - Intergenic
1010849443 6:80753686-80753708 TGCAGTAACATGGAAGGAGCAGG - Intergenic
1010858010 6:80867673-80867695 TGCAGCAACATGGATGGAGCCGG + Intergenic
1011463382 6:87629849-87629871 TGCAGCAACATGGATGGAGCAGG - Intronic
1011595939 6:89016198-89016220 TGCAGCAACATGGATGGAGCTGG + Intergenic
1011612804 6:89169653-89169675 TGCAGCAACATGGATGGAGCTGG - Intergenic
1012121610 6:95374498-95374520 TGCTGCAACATGGATGGAGCTGG + Intergenic
1012155032 6:95808633-95808655 TGCAGCAACATGGATGGAGCTGG - Intergenic
1012250823 6:96978439-96978461 TGCAGCAACATGGATGGAGCTGG - Intronic
1012354956 6:98302586-98302608 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1012563869 6:100621178-100621200 TGCAGGGGCATGGATGGAGCTGG + Intronic
1012563925 6:100621934-100621956 TGCAGGGGCATGGATGGAGCTGG + Intronic
1012706986 6:102544085-102544107 TGCAGCAACATGGATGGAGCTGG + Intergenic
1012979037 6:105810782-105810804 TGGGGCTGTAGGGTAGGAGCAGG + Intergenic
1012989788 6:105913180-105913202 TGCAGCAACATGGATGGAGCTGG - Intergenic
1013376878 6:109525982-109526004 TGCAGCAACATGGATGGAGCTGG + Intronic
1013727603 6:113118922-113118944 TGCGGCAGCATGAATGAAGCTGG + Intergenic
1013965012 6:115945011-115945033 TGCAGCAACATGGATGGAGCTGG - Intronic
1014041711 6:116834717-116834739 TGCAGAGGCATGGATGGAGCTGG - Intergenic
1014195719 6:118555946-118555968 TGCGGGAACATGGATGGAGCTGG - Intronic
1014376875 6:120687044-120687066 TGTGGCAACATGGATGGAGCTGG + Intergenic
1014819260 6:125968308-125968330 TGCAGCAGCATGGATGCAGCTGG - Intronic
1015066440 6:129034769-129034791 TGCAGCAACATGGATGGAGCTGG - Intronic
1015158152 6:130121371-130121393 TGCGGGAACATGGATGGAGCTGG - Intronic
1015349808 6:132204411-132204433 TGTGGCAGCATGGATGCAGCTGG - Intergenic
1015390287 6:132674114-132674136 TGCAGTAGCATGGAAGGAGCTGG - Intergenic
1015470909 6:133605102-133605124 TGCGGCAACATGGATAGAGCTGG - Intergenic
1015481591 6:133717281-133717303 TGCAGAGGCATGGATGGAGCTGG + Intergenic
1015688779 6:135896826-135896848 TGGAGCTGGAAGGAAGGAGCTGG - Intronic
1015931119 6:138360692-138360714 TGCAGCAGCATAGAGGGAGCTGG - Intergenic
1016652474 6:146478501-146478523 TGCTGCAACATGGATGGAGCTGG - Intergenic
1016666116 6:146642605-146642627 TGCGGGAACATGGATGGAGCTGG + Intronic
1017157585 6:151336063-151336085 TGCAGCAACATGGAAGGATCTGG - Intronic
1017277972 6:152592409-152592431 TGCAGCAACATGGATGGAGCTGG + Intronic
1017375621 6:153764368-153764390 TGCAGCAACATGGATGGAGCTGG + Intergenic
1018156241 6:160987921-160987943 TGCAGCAACATGGATGGAGCTGG + Intergenic
1018184048 6:161250037-161250059 TGCAGCAACATGGATGGAGCTGG + Intronic
1018496560 6:164353061-164353083 TGCAGCAACATGGATGGAGCTGG - Intergenic
1019174445 6:170153059-170153081 TGCGGCTGCCCTGCAGGAGCTGG + Intergenic
1019296805 7:281856-281878 TGCAGCAACATGGATGGAGCTGG + Intergenic
1020121916 7:5509331-5509353 TGTGGCTGGATGGAGAGAGCTGG - Intronic
1020385698 7:7599873-7599895 TGCAGCAGCATGGATAGAGCTGG + Intronic
1020556694 7:9679401-9679423 TGTGGGGACATGGAAGGAGCTGG - Intergenic
1020571101 7:9862856-9862878 TGCAGCAACATGGATGGAGCTGG + Intergenic
1020974863 7:14992273-14992295 TGCAGGGGCATGGATGGAGCTGG + Intergenic
1021046622 7:15930690-15930712 TGTAGCAGCATGGAAGTAGCTGG + Intergenic
1021383256 7:19994806-19994828 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1021407462 7:20288951-20288973 TGCAGCAGCGTGGATGGAGCTGG + Intergenic
1021491372 7:21222777-21222799 TGCAGCAACATGGATGGAGCTGG - Intergenic
1021618462 7:22526951-22526973 TGTGGCAACATGGATGGAGCTGG + Intronic
1022314790 7:29235732-29235754 TGCAGCAACATGGATGGAGCCGG + Intronic
1022415966 7:30177290-30177312 TGCCACTGCAGGGAAGGAGGCGG + Intergenic
1022928055 7:35076404-35076426 TGCAGCAACATGGATGGAGCTGG + Intergenic
1022984871 7:35642651-35642673 TGCGGGAACATGGATGGAGCTGG + Intronic
1023610888 7:41969240-41969262 TGCAGACGCATGGAAGTAGCCGG - Intronic
1023996038 7:45159378-45159400 TGTGTCTGGAAGGAAGGAGCTGG + Intronic
1024252435 7:47516657-47516679 TGCGGCAGCACGTAAGGAGATGG + Intronic
1024371226 7:48586425-48586447 TGCAGCAGCATGGATGCAGCTGG + Intronic
1024375291 7:48630457-48630479 TGCAGCAACATGGATGGAGCTGG - Intronic
1024652144 7:51413300-51413322 TGCAGCAACATGGATGGAGCTGG + Intergenic
1024733773 7:52280900-52280922 TGCAGCAACATGGATGGAGCTGG - Intergenic
1025037321 7:55603912-55603934 TGCAGCAACATGGATGGAGCTGG + Intergenic
1025071988 7:55907755-55907777 TGCAGCAACATGGATGGAGCTGG - Intronic
1025865877 7:65380157-65380179 TGCAGCAACATGGATGGAGCTGG - Intronic
1026193531 7:68151418-68151440 TGCAGCAACATGGATGGAGCTGG + Intergenic
1026251570 7:68675577-68675599 TGCAGCAACATGGATGGAGCTGG - Intergenic
1026317011 7:69235852-69235874 TGCAGCAACATGGATGGAGCTGG + Intergenic
1026445978 7:70485316-70485338 TGCAGCACCATGGATGGAGCTGG + Intronic
1026449620 7:70516271-70516293 TGCGGGTGTGTGGAAGGAGGAGG - Intronic
1026656674 7:72262649-72262671 TGCAGCAGCATGGATGCAGCTGG - Intronic
1026935822 7:74254680-74254702 CGCGGCGGCGTGGGAGGAGCAGG + Intergenic
1026976851 7:74504054-74504076 TGCGGCAACATGGAAGTAGCTGG - Intronic
1027194124 7:76017404-76017426 TGCAGCACCATGGATGGAGCTGG + Intronic
1027481578 7:78704744-78704766 GGCTGCAACATGGAAGGAGCAGG + Intronic
1027833968 7:83217864-83217886 TGCAGCGACATGGATGGAGCTGG - Intergenic
1027903406 7:84148375-84148397 TGCGGAAGGATGGAAGGAGATGG + Intronic
1028374220 7:90129184-90129206 TGCAGCAACATGGATGGAGCTGG - Intergenic
1028714686 7:93951303-93951325 TGATGCTGCATGGAAAGACCAGG + Intergenic
1029334930 7:99890565-99890587 TGCAGCAACATGGATGGAGCTGG + Exonic
1029373098 7:100161779-100161801 TGCAGGTGCATGGATGAAGCTGG + Intronic
1030200444 7:106897676-106897698 TGCGGGAACATGGATGGAGCTGG - Intronic
1030379016 7:108790147-108790169 TGCAGCAACATGGATGGAGCTGG - Intergenic
1030388049 7:108890432-108890454 TGCGGGAACATGGATGGAGCTGG + Intergenic
1030487194 7:110184456-110184478 TGCAGCAACATGGAAGGAGCTGG - Intergenic
1030699991 7:112627573-112627595 TGCAGAAGCATGGATGGAGCTGG - Intergenic
1030832964 7:114249509-114249531 TGCAGTGGCATGGATGGAGCTGG - Intronic
1030950628 7:115786996-115787018 TGCAGCAACATGGATGGAGCTGG - Intergenic
1030989061 7:116278325-116278347 TGCAGCAACATGGATGGAGCTGG + Intergenic
1030993257 7:116326960-116326982 TGCAGCAACATGGATGGAGCTGG - Intronic
1031043339 7:116861842-116861864 TGCAGCAACTTGGAAGGAGCTGG - Intronic
1031181974 7:118430872-118430894 TGCAGCAACATGGATGGAGCTGG - Intergenic
1031316837 7:120269210-120269232 TGCAGCCACATGGATGGAGCTGG + Intergenic
1031429300 7:121646899-121646921 TGCAGCAACATGGATGGAGCTGG - Intergenic
1031811042 7:126369231-126369253 TGCAGCAACATGGATGGAGCTGG - Intergenic
1032176558 7:129633496-129633518 TGCCACTGCAGGGAGGGAGCAGG + Intronic
1032895000 7:136240721-136240743 TGGGGCTGCAGGGAGGGAGGAGG - Intergenic
1033000372 7:137497637-137497659 TGCAGCAACATGGATGGAGCTGG + Intronic
1033527449 7:142230597-142230619 TGCAGCAGCATGGATGAAGCTGG - Intergenic
1033584871 7:142766865-142766887 TGCAGCAACATGGATGGAGCTGG - Intergenic
1033807094 7:144966823-144966845 TGCAGCAACATGGATGGAGCTGG + Intergenic
1033976633 7:147110670-147110692 TGCGGGCACATGGATGGAGCTGG - Intronic
1034403540 7:150884874-150884896 TGCAGCAACCTGGAAGGAGCTGG + Intergenic
1035142279 7:156774860-156774882 TGCAGCAACATGGATGGAGCTGG + Intronic
1035148832 7:156849202-156849224 TGCAGCGACATGGATGGAGCTGG + Intronic
1035528951 8:336332-336354 TGAGGCTGCATGGAGAGGGCAGG + Intergenic
1035644445 8:1207374-1207396 TGCGGCAGCCTGGATGGAGTTGG - Intergenic
1035698218 8:1617029-1617051 TGCAGCAACATGGATGGAGCTGG - Intronic
1035742032 8:1935758-1935780 TGCATGTGCATGGGAGGAGCTGG + Intronic
1035975909 8:4311345-4311367 TGCAGCAACATGGATGGAGCTGG + Intronic
1035990287 8:4482390-4482412 TGCAGGAGCATGGATGGAGCTGG - Intronic
1036009197 8:4701954-4701976 TGCAGGGGCATGGATGGAGCTGG + Intronic
1036017083 8:4796920-4796942 TGTGGCTGCATGGAGGGGGCAGG + Intronic
1036113942 8:5937348-5937370 TGCAGATACATGGATGGAGCTGG - Intergenic
1036216288 8:6882772-6882794 TGGTCCTGGATGGAAGGAGCTGG + Intergenic
1036216306 8:6882856-6882878 TGGCCCTGGATGGAAGGAGCTGG + Intergenic
1036216313 8:6882884-6882906 TGGTCCTGGATGGAAGGAGCTGG + Intergenic
1036216330 8:6882968-6882990 TGACCCTGGATGGAAGGAGCTGG + Intergenic
1036216337 8:6882996-6883018 TGGCCCTGGATGGAAGGAGCTGG + Intergenic
1036690764 8:10943428-10943450 TGTGGCTGGAGGGCAGGAGCAGG - Intronic
1036739762 8:11349195-11349217 TGAGGCTGGAAGGAAGGAGCGGG + Intergenic
1037541409 8:19875460-19875482 TGCAGCAACATGGATGGAGCTGG - Intergenic
1037901389 8:22691403-22691425 GGGGGCTGGCTGGAAGGAGCCGG + Exonic
1038709165 8:29925141-29925163 TGCAGCAGCCTGGATGGAGCTGG - Intergenic
1038911127 8:31965810-31965832 TGCAGCAACATGGATGGAGCTGG + Intronic
1038984996 8:32798920-32798942 TGCAGCAACATGGATGGAGCTGG + Intergenic
1039137109 8:34337716-34337738 TGCAGCAGCATGGATGAAGCTGG + Intergenic
1039321070 8:36432144-36432166 TGCGGCAACATGGAGGCAGCTGG + Intergenic
1039393296 8:37200477-37200499 TGAGGCTACATGGAAGTAGCTGG + Intergenic
1039625362 8:39044774-39044796 TGCAGCAACATGGATGGAGCTGG - Intronic
1040461325 8:47651799-47651821 TGCAGCAGCTTGGATGGAGCTGG + Intronic
1040533604 8:48286462-48286484 TGCAGGAGCATGGATGGAGCTGG + Intergenic
1041180642 8:55244362-55244384 TGCAGCAACATGGATGGAGCTGG - Intronic
1041295167 8:56349303-56349325 TGCAGCAACATGGATGGAGCTGG - Intergenic
1041302408 8:56426518-56426540 TGCTGCAACATGGATGGAGCTGG - Intergenic
1041353853 8:56978739-56978761 TGCAGGGGCATGGATGGAGCTGG + Intronic
1041610810 8:59845957-59845979 TGCAGCAACATGGAAGCAGCTGG + Intergenic
1042143088 8:65699138-65699160 TGCAGCAACATGGATGGAGCTGG - Intronic
1042340582 8:67674867-67674889 TGCAGCAACATGGATGGAGCTGG + Intronic
1042519679 8:69698151-69698173 TGCAGCAACATGGATGGAGCTGG - Intronic
1042790562 8:72600683-72600705 TGCGGGAACATGGATGGAGCTGG + Intronic
1042795241 8:72655141-72655163 TGCAGCAACATGGATGGAGCTGG + Intronic
1042977963 8:74491933-74491955 TGCAGCAACATGGATGGAGCTGG - Intergenic
1043116537 8:76261213-76261235 TGCAGCGACATGGATGGAGCTGG + Intergenic
1043135653 8:76520684-76520706 TGCCACAGCATGGATGGAGCTGG - Intergenic
1043145557 8:76649112-76649134 TGCAGCAGCATGGATGGAACTGG + Intergenic
1043250136 8:78062307-78062329 TGCAGCAGCATGGATGAAGCTGG + Intergenic
1043640675 8:82446434-82446456 TGCAGCAACATGGATGGAGCTGG - Intergenic
1043675183 8:82942657-82942679 TGCAGCAACATGGATGGAGCTGG + Intergenic
1043994595 8:86797395-86797417 TGTGGGAGCATGGATGGAGCAGG + Intergenic
1044367896 8:91371537-91371559 TGCAGCAACATGGATGGAGCTGG - Intronic
1044905676 8:96999535-96999557 TGCAGGGACATGGAAGGAGCTGG - Intronic
1045592891 8:103618181-103618203 TGCAGGAGCATGGATGGAGCTGG + Intronic
1045718813 8:105081423-105081445 TGCGGCAACATGGATGGAGTTGG + Intronic
1045819887 8:106324206-106324228 TGTGGCTACATGGATGGAGATGG + Intronic
1046215956 8:111147270-111147292 TGCAGCAACATGGAAGCAGCTGG - Intergenic
1046392140 8:113588610-113588632 TGCAGGGGCATGGATGGAGCTGG + Intergenic
1046413140 8:113875420-113875442 TGCAGCAACATGGATGGAGCTGG - Intergenic
1046465577 8:114598223-114598245 TGCTGCAACATGGATGGAGCTGG - Intergenic
1046851899 8:118984179-118984201 TGCAGCAACATGGATGGAGCTGG + Intergenic
1046963141 8:120131014-120131036 TGCGGCAACATGGATGCAGCTGG - Intronic
1047164655 8:122423751-122423773 TGCAGCAACATGGATGGAGCTGG - Intergenic
1047277993 8:123420210-123420232 TGCAGCAACATGGATGGAGCTGG - Intronic
1047595037 8:126369806-126369828 TGTGGGAACATGGAAGGAGCTGG - Intergenic
1047712243 8:127564163-127564185 TTAGGCTGAATGGAAGGAGTAGG + Intergenic
1048089649 8:131225279-131225301 TGCAGGTACATGGATGGAGCTGG + Intergenic
1048339575 8:133528280-133528302 TGTGCCTGCAGGGAAGGAGCAGG + Intronic
1048559834 8:135522244-135522266 TGCAGGGACATGGAAGGAGCTGG - Intronic
1048640757 8:136357811-136357833 TGCAGCAACATGGATGGAGCTGG - Intergenic
1048679654 8:136825860-136825882 TGCAGCAACATGGATGGAGCTGG + Intergenic
1050425420 9:5508155-5508177 TGCGGGAACATGGATGGAGCTGG + Intergenic
1050762811 9:9094365-9094387 TGCAGCAGCTTGGATGGAGCTGG + Intronic
1050928084 9:11291042-11291064 TGCAGCTACATGGATGGAGCTGG - Intergenic
1050933466 9:11361561-11361583 TGCTGCAGCATGGTTGGAGCTGG + Intergenic
1051555116 9:18374213-18374235 TACGGCTCCAAGGAAGGACCAGG - Intergenic
1051567639 9:18518446-18518468 TACGGCAACATGGATGGAGCTGG - Intronic
1051831723 9:21286542-21286564 TGCGGGAACATGGATGGAGCTGG - Intergenic
1051886722 9:21900862-21900884 TGCAGCAGCATGGATGTAGCTGG + Intronic
1051976600 9:22957654-22957676 TGCAGCAACATGGATGGAGCTGG - Intergenic
1052529718 9:29666330-29666352 TGCAGCTGCATGGATGCAGCTGG + Intergenic
1052749478 9:32474689-32474711 TGAGGCTGCAGTGAAGGTGCTGG - Intronic
1052902106 9:33802135-33802157 TGCAGCAACATGGATGGAGCTGG - Intergenic
1053052840 9:34976242-34976264 TGGTGCTGCATGGATGGAGAGGG + Intronic
1053535768 9:38923968-38923990 TGCAGCTGCATGGATGCAGCTGG + Intergenic
1053550226 9:39070356-39070378 TGCGACAGCATGGATGGAACTGG + Intergenic
1053570247 9:39296970-39296992 TGCAGCAACATGGATGGAGCTGG + Intergenic
1053806965 9:41812535-41812557 TGCAGGAACATGGAAGGAGCTGG - Intergenic
1053814336 9:41890467-41890489 TGCGACAGCATGGATGGAACTGG + Intronic
1053836200 9:42137925-42137947 TGCAGCAACATGGATGGAGCTGG + Intergenic
1053917568 9:42954699-42954721 TGCAGGTCCATGGAGGGAGCAGG - Intergenic
1054091869 9:60855980-60856002 TGCAGCAACATGGATGGAGCTGG + Intergenic
1054113283 9:61131570-61131592 TGCAGCAACATGGATGGAGCTGG + Intergenic
1054126902 9:61322036-61322058 TGCAGCAACATGGATGGAGCTGG - Intergenic
1054207989 9:62148381-62148403 TGCAGCTGCCTGGATGCAGCTGG + Intergenic
1054594418 9:67050599-67050621 TGCAGCAACATGGATGGAGCTGG - Intergenic
1054616260 9:67296973-67296995 TGCGACAGCATGGATGGAACTGG - Intergenic
1054623627 9:67374892-67374914 TGCAGGAACATGGAAGGAGCTGG + Intergenic
1055231379 9:74070665-74070687 TGCAGCAACATGGATGGAGCTGG - Intergenic
1055239091 9:74162791-74162813 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1055255631 9:74367141-74367163 TGCGGCAACATGGATAGAGCTGG + Intergenic
1055342835 9:75303291-75303313 TGCAGGTACATGGATGGAGCTGG - Intergenic
1055356528 9:75443226-75443248 TGCAGCAACATGGATGGAGCTGG - Intergenic
1055746769 9:79455655-79455677 TGCAGGAGCATGGATGGAGCTGG - Intergenic
1055966458 9:81869623-81869645 TGCAGCAACATGGATGGAGCTGG - Intergenic
1056093680 9:83229410-83229432 TGCAGCAACATGGATGGAGCTGG - Intergenic
1056588940 9:87950059-87950081 TGCAGCAACATGGAAGCAGCTGG - Intergenic
1056819908 9:89832690-89832712 TGCGGCAACTTGGATGGAGCTGG + Intergenic
1057466604 9:95319561-95319583 TGCAGCAACATGGATGGAGCTGG - Intergenic
1057533052 9:95871526-95871548 TGCAGCAACATGGATGGAGCTGG - Intergenic
1057695434 9:97319624-97319646 CGCAGCAGCATGGATGGAGCTGG - Intronic
1058108889 9:101007890-101007912 TGCAGGGGCATGGATGGAGCTGG + Intergenic
1058252980 9:102725341-102725363 TGCAGCAACATGGATGGAGCTGG + Intergenic
1058733412 9:107872519-107872541 TGTGGTTGGATGGAAAGAGCTGG + Intergenic
1058916699 9:109574027-109574049 TGCAGCAACATGGATGGAGCTGG + Intergenic
1059405061 9:114094267-114094289 TGAGGCTGCAGGGAAGCAGGAGG + Exonic
1059497601 9:114722419-114722441 TGCAGCAACATGGATGGAGCTGG + Intergenic
1060789176 9:126474146-126474168 TTAGGCTGCATGGAAGGGGCAGG + Intronic
1060819377 9:126652446-126652468 TGCGGCCGCATGGGCGGGGCTGG + Intronic
1061491473 9:130947290-130947312 TGGGGCTGCAGGGGAGGTGCTGG - Intergenic
1062047505 9:134431306-134431328 AGCGTCTCCATGGAGGGAGCTGG + Intronic
1062106618 9:134758360-134758382 TGAGGCTGCCTGGAAGGAGAAGG - Intronic
1185689439 X:2141162-2141184 TGCAGCAACATGGATGGAGCTGG + Intergenic
1185829352 X:3285027-3285049 TGCGGCTACATGGATGGAGCTGG - Intergenic
1185844148 X:3421464-3421486 TGCAGCAGCATGGATGGAACAGG + Intergenic
1185884061 X:3766342-3766364 TGCAGCAACATGGATGGAGCTGG - Intergenic
1185914192 X:4017144-4017166 TGCAGCTACATGGATGGAACAGG - Intergenic
1185937059 X:4269737-4269759 TGCAGCACCATGGATGGAGCTGG + Intergenic
1186032673 X:5387020-5387042 TGCAGCAACATGGATGGAGCTGG - Intergenic
1186122247 X:6375793-6375815 TGCGGGGACATGGATGGAGCTGG + Intergenic
1186189032 X:7051243-7051265 TGCAGCAACATGGATGGAGCTGG + Intronic
1186234534 X:7493413-7493435 TGCGGGCACATGGATGGAGCTGG - Intergenic
1186373278 X:8968490-8968512 TGCAGCGACATGGAAGGAGCTGG + Intergenic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1186529611 X:10282105-10282127 TGGGGCAGCCTGGAGGGAGCTGG - Intergenic
1186531794 X:10304246-10304268 TGCAGCAACATGGAAGGAACTGG - Intergenic
1186654540 X:11598646-11598668 TGCAGCAACATGGATGGAGCTGG - Intronic
1186683649 X:11901395-11901417 TGCAGCAACTTGGAAGGAGCTGG - Intergenic
1187297889 X:18020035-18020057 TGCAGCAACATGGATGGAGCTGG + Intergenic
1187559929 X:20392655-20392677 TGCGGGAACATGGATGGAGCTGG - Intergenic
1187600198 X:20820797-20820819 TGCAGGTACATGGATGGAGCTGG + Intergenic
1187671538 X:21670998-21671020 TGCAGCAACATGGATGGAGCTGG - Intergenic
1187688397 X:21839596-21839618 TGCCACCGCAAGGAAGGAGCCGG + Intergenic
1187756470 X:22532718-22532740 TGGGGCTGCATGGAAGGTTCTGG - Intergenic
1187916237 X:24154831-24154853 TGCGGAAACATGGATGGAGCTGG + Intronic
1188065342 X:25652263-25652285 TGTGGCAACATGGATGGAGCTGG - Intergenic
1188096627 X:26031613-26031635 TGCGGGAGCATGGATGGAGCTGG + Intergenic
1188148702 X:26646178-26646200 TGCAGCAACATGGATGGAGCTGG - Intergenic
1188155261 X:26733960-26733982 TGCAGCAACATGGATGGAGCTGG - Intergenic
1188259164 X:28002060-28002082 TGCAGCAACATGGATGGAGCTGG - Intergenic
1188431783 X:30111786-30111808 TGCGGCAACATGGATGTAGCTGG - Intergenic
1188526871 X:31096923-31096945 TGCAGCTACATGGATGCAGCTGG + Intergenic
1188573507 X:31617919-31617941 TGCAGCAACATGGATGGAGCTGG + Intronic
1188701440 X:33269283-33269305 TGCAGCGACATGGATGGAGCTGG + Intronic
1188724088 X:33560013-33560035 TGCGGCAACATGGATGCAGCTGG - Intergenic
1188810548 X:34649394-34649416 TGTGGGAACATGGAAGGAGCTGG + Intronic
1189154383 X:38741913-38741935 TGCAGCAACATGGATGGAGCTGG - Intergenic
1189582548 X:42422596-42422618 TGCAGCAACATGGATGGAGCTGG + Intergenic
1189596214 X:42568424-42568446 TGCAGGAGCATGGATGGAGCTGG - Intergenic
1189611216 X:42738199-42738221 TGCAGCAACATGGATGGAGCTGG + Intergenic
1189652515 X:43205281-43205303 TGCAGAGGCATGGATGGAGCTGG - Intergenic
1190531574 X:51384002-51384024 TGCAGCAGCATGGATGCAGCTGG + Intergenic
1190537623 X:51445704-51445726 TGCAGCAACATGGATGGAGCTGG - Intergenic
1190902721 X:54694337-54694359 TGCAGGTACATGGATGGAGCTGG + Intergenic
1190905619 X:54724370-54724392 TGCAGCAACATGGATGGAGCTGG - Intergenic
1191164317 X:57371391-57371413 TGCAGAAGCATGGATGGAGCTGG - Intronic
1191673933 X:63775519-63775541 TGCGGCAACATGGATGGAGCTGG + Intronic
1191818767 X:65278943-65278965 TGCGGGAACATGGATGGAGCTGG - Intergenic
1192075801 X:67994858-67994880 TGCAGCAACATGGAGGGAGCTGG - Intergenic
1192289094 X:69772778-69772800 TGCAGCAGCATGGATGCAGCTGG - Intronic
1192546477 X:72018679-72018701 CGAGGCTGCTTGGAAGCAGCCGG + Intergenic
1193200939 X:78689770-78689792 TGCAGCAACATGGATGGAGCTGG - Intergenic
1193266475 X:79477077-79477099 TGCAGAGGCATGGATGGAGCTGG - Intergenic
1193316201 X:80067761-80067783 TGCAGCAACATGGATGGAGCTGG - Intergenic
1193439656 X:81524059-81524081 TGAAGCAGCATGGATGGAGCTGG - Intergenic
1193512581 X:82422847-82422869 TGCAGCAACATGGATGGAGCTGG + Intergenic
1193622031 X:83765331-83765353 TGCAGCAACATGGATGGAGCTGG - Intergenic
1193838190 X:86372970-86372992 TGCAGCAACATGGAAGCAGCTGG - Intronic
1193863620 X:86701711-86701733 TGCAACAGCATGGATGGAGCTGG + Intronic
1193879422 X:86903014-86903036 TGCAGCAACATGGATGGAGCTGG + Intergenic
1193984503 X:88223510-88223532 TGCAGCAACATGGAAGCAGCTGG - Intergenic
1193991100 X:88308263-88308285 TGCAGCAACATGGATGGAGCTGG - Intergenic
1194179153 X:90691880-90691902 TGCAGCAACATGGATGGAGCTGG + Intergenic
1194310163 X:92296543-92296565 TGCAGCAACATGGATGGAGCTGG - Intronic
1194434246 X:93850117-93850139 TGCAGCAACATGGATGGAGCTGG + Intergenic
1194435272 X:93861596-93861618 TGCAGCAACATGGATGGAGCTGG + Intergenic
1194545891 X:95233028-95233050 TGCGGGAACATGGATGGAGCTGG + Intergenic
1194568085 X:95519197-95519219 TGCAGCACCATGGATGGAGCTGG + Intergenic
1194817920 X:98467858-98467880 TGCAGCAACATGGATGGAGCTGG + Intergenic
1194830147 X:98613577-98613599 TGCGGGAGCATAGATGGAGCTGG - Intergenic
1195241087 X:102952739-102952761 TGCAGCAGCATAGATGGAGCTGG - Intergenic
1195412713 X:104585738-104585760 TGCAGCAACATGGATGGAGCTGG - Intronic
1195501544 X:105606740-105606762 TGCGGCTACATGGATGTAACTGG + Intronic
1195512792 X:105737075-105737097 TGCAGCAACATGGATGGAGCTGG + Intronic
1195575590 X:106446513-106446535 TGCAGCTACATGGATGGAGCTGG + Intergenic
1195602249 X:106762717-106762739 TGCAGCAACATGGATGGAGCTGG + Intronic
1195901358 X:109801001-109801023 TGCAGCAACATGGATGGAGCTGG + Intergenic
1195987821 X:110649978-110650000 TGCAGCAACATGGATGGAGCTGG - Intergenic
1196065104 X:111455648-111455670 TGCAGAGGCATGGATGGAGCTGG + Intergenic
1196103620 X:111873197-111873219 TGCAGCAACATGGATGGAGCTGG + Intronic
1196112458 X:111961931-111961953 TGCAGCAACATGGAGGGAGCTGG + Intronic
1196238236 X:113307985-113308007 TGCAGCAGCATGGATGGAACTGG + Intergenic
1196254881 X:113505464-113505486 TGCCGCAACATGGATGGAGCTGG - Intergenic
1196344824 X:114642040-114642062 TGCAGAGGCATGGATGGAGCTGG - Intronic
1196587796 X:117449754-117449776 TGCAGCAACATGGATGGAGCGGG + Intergenic
1197088154 X:122503826-122503848 TGCAGCAGCATGGATGCAGCTGG - Intergenic
1197242608 X:124136049-124136071 TGCGGGAACATGGATGGAGCTGG - Intronic
1197279328 X:124516994-124517016 TGCGGGAACATGGATGGAGCTGG + Intronic
1197350337 X:125374354-125374376 TGCGGGGACATGGATGGAGCTGG - Intergenic
1197368993 X:125602366-125602388 TGCAGCAACATGGATGGAGCTGG + Intergenic
1197422233 X:126252324-126252346 TGCAGCAACATGGATGGAGCCGG - Intergenic
1197549019 X:127864908-127864930 TGCAGCAACATGGATGGAGCTGG + Intergenic
1197626793 X:128810974-128810996 TGCAGCAACATGGATGGAGCTGG - Intergenic
1197904856 X:131413833-131413855 TGCGGGAACATGGATGGAGCTGG + Intergenic
1198076592 X:133199194-133199216 TGTGGGGGCATGGATGGAGCTGG - Intergenic
1198494334 X:137176001-137176023 TGCAGCAACATGGATGGAGCTGG - Intergenic
1198501541 X:137254183-137254205 TGCAGCTATATGGATGGAGCTGG + Intergenic
1198570487 X:137949974-137949996 TGCAGCAACATGGATGGAGCTGG - Intergenic
1198673683 X:139108983-139109005 TGCAGGTACATGGATGGAGCTGG - Intronic
1198813107 X:140556409-140556431 TGCTACTGCATGGATGGAACTGG + Intergenic
1198855010 X:141006351-141006373 TGCAGCAACATGGATGGAGCTGG + Intergenic
1198877003 X:141238789-141238811 TGCAGCAACATGGATGGAGCTGG - Intergenic
1198907682 X:141581018-141581040 TGCAGCAACATGGATGGAGCTGG - Intergenic
1198909109 X:141593406-141593428 TGCAGCAACATGGATGGAGCTGG + Intronic
1198917969 X:141694745-141694767 TGCAGCAACATGGATGGAGCTGG - Intronic
1198945478 X:142008308-142008330 TGCAGCAACATGGATGGAGCCGG - Intergenic
1198949350 X:142053220-142053242 TGCAGCAACTTGGAAGGAGCTGG - Intergenic
1198957935 X:142152214-142152236 TGCAGCTACATGGATGGAGCTGG - Intergenic
1199131890 X:144198870-144198892 TGCAGCAACATGGATGGAGCTGG - Intergenic
1199636353 X:149816301-149816323 TGCAGCAACATGGATGGAGCTGG + Intergenic
1199641274 X:149864631-149864653 TGCAGCACCATGGATGGAGCTGG + Intergenic
1199748792 X:150794802-150794824 TCTGGCTGGATGGAAGCAGCTGG - Intronic
1199750662 X:150814445-150814467 TCTGGCTGGATGGAAGCAGCTGG - Intronic
1199836143 X:151593539-151593561 TGCGGGGACATGGAAGAAGCTGG - Intronic
1200225891 X:154417323-154417345 TGTGGCACCATGGAAGCAGCAGG + Intronic
1200365121 X:155654619-155654641 TGCAGTTGCATGGATGGAACTGG - Intronic
1200618455 Y:5410830-5410852 TGCAGCAACATGGATGGAGCTGG - Intronic
1200781309 Y:7218594-7218616 TGCAGCAACATGGATGGAGCTGG + Intergenic
1200795868 Y:7340725-7340747 TGCAGCAGCATGGATGGAGGTGG - Intergenic
1201223604 Y:11794315-11794337 TGCGGCAACATGGATGCAGCTGG - Intergenic
1201249035 Y:12037308-12037330 TGCAGCTACATGGATGGAGCTGG + Intergenic
1201769493 Y:17605629-17605651 TGCGGCAACATGGATGTAGCTGG + Intergenic
1201832061 Y:18300356-18300378 TGCGGCAACATGGATGTAGCTGG - Intergenic
1202588754 Y:26459987-26460009 TGCTGCAACATGGATGGAGCTGG - Intergenic