ID: 1166381348

View in Genome Browser
Species Human (GRCh38)
Location 19:42356846-42356868
Sequence ATGCGGCTGCATGGAAGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381348_1166381361 17 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381348_1166381363 29 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381363 19:42356898-42356920 CTGCTGGGGGGACTTACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1166381348_1166381351 -10 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381351 19:42356859-42356881 GCAGCCGCATATGTGCCCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 55
1166381348_1166381359 15 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381348_1166381358 14 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1166381348_1166381360 16 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381348_1166381353 -4 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1166381348_1166381357 13 Left 1166381348 19:42356846-42356868 CCGCTCCTTCCATGCAGCCGCAT 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381348 Original CRISPR ATGCGGCTGCATGGAAGGAG CGG (reversed) Exonic
901068165 1:6504437-6504459 ATGTGGCTGCTTGTCAGGAGAGG - Intronic
901457415 1:9371210-9371232 ATGCGGTTGGATGAAAGGGGTGG + Intergenic
902404910 1:16177301-16177323 ATTCCTCTCCATGGAAGGAGAGG - Intergenic
902654811 1:17859911-17859933 ACGCTGCTGTGTGGAAGGAGTGG + Intergenic
913011646 1:114689318-114689340 ATGCTGCTGTATGCAGGGAGGGG + Intronic
914347323 1:146811084-146811106 GTGTGGCTGCATGGAGGCAGTGG - Intergenic
919684210 1:200466982-200467004 ATGAGGTTGCAGGGAAGGAAAGG - Intergenic
919933638 1:202237228-202237250 GTGAGGCTGGATGGAGGGAGAGG - Intronic
920382133 1:205541320-205541342 CTGCTGCTGCATGGAAGGGAAGG - Intergenic
922369630 1:224896354-224896376 ATGTGGCTGCATGTAAGCATTGG + Intronic
924816574 1:247447258-247447280 ATGTGATTGCATGGAGGGAGGGG + Intronic
1062940279 10:1415825-1415847 ATAGGGCTGCATGGAAGAGGTGG - Intronic
1067231110 10:44411435-44411457 ATGCTGGAGCATGGAGGGAGGGG - Intergenic
1067346090 10:45440122-45440144 AGCTGGCAGCATGGAAGGAGCGG - Intronic
1069620339 10:69833608-69833630 AAATGGCTGCATGGAAGAAGTGG + Intronic
1070610197 10:77927146-77927168 AGGCGGCAGCAGGGGAGGAGGGG + Intergenic
1071912287 10:90250065-90250087 CTGCCGTTGCATGGAAAGAGAGG - Intergenic
1072213507 10:93268564-93268586 GAGAGGCTGCATGGAAGCAGAGG + Intergenic
1075672249 10:124270612-124270634 ATGGTGCAGCAGGGAAGGAGGGG - Intergenic
1077433789 11:2528566-2528588 GTGAGGCTGCCTGGAAGGTGGGG + Intronic
1078445079 11:11397935-11397957 AAGCGGCTGAATGGAAGCTGAGG - Intronic
1081673483 11:44954869-44954891 ATGCGGCAGCCTGGGAGGAGCGG + Intergenic
1081797207 11:45828947-45828969 CTGCAGCAGCAGGGAAGGAGTGG - Intergenic
1082264436 11:50104377-50104399 CTGTGGCTGCCTGGAAGTAGGGG - Intergenic
1083942427 11:65903546-65903568 TTGGGGCTGCAGTGAAGGAGAGG + Intergenic
1085400363 11:76232399-76232421 ATGGGGTGGAATGGAAGGAGGGG - Intergenic
1089175661 11:116547273-116547295 ATGCGTGTTCATGGAATGAGTGG - Intergenic
1090357989 11:126153407-126153429 ATGAGGCATGATGGAAGGAGGGG + Intergenic
1091566993 12:1656080-1656102 ATGCCACTGCATGGAAGGCTTGG - Intergenic
1096517577 12:52165620-52165642 AGGAGGCTGCTGGGAAGGAGGGG - Intergenic
1097709343 12:62901063-62901085 ATCCGGCTACATGGAAATAGAGG - Intronic
1098904804 12:76150975-76150997 AAGCAGCAGCAAGGAAGGAGTGG + Intergenic
1099143762 12:79012970-79012992 AAGGGACTGCATGGGAGGAGGGG - Intronic
1099661259 12:85566497-85566519 ATGCTGCTGGATGGTTGGAGAGG + Intergenic
1100504765 12:95208576-95208598 GTGCTGCTGCAAGGAAGGCGTGG - Intronic
1100865980 12:98857282-98857304 ATGCACCTGCATGAGAGGAGTGG + Intronic
1102519752 12:113471016-113471038 TTGCAGCTGCTTGGAAGGGGCGG + Intronic
1103848419 12:123915317-123915339 ATGGGGATGCAGGGGAGGAGAGG + Intronic
1105010049 12:132749582-132749604 AGGCGGATGACTGGAAGGAGAGG + Intronic
1106590856 13:31097341-31097363 ATGAGGCTGCAGGGGAGGATAGG - Intergenic
1113901032 13:113798201-113798223 ATGTGGATGAATGGAAGGATGGG + Intronic
1116997513 14:51339452-51339474 GTGCGGCTGCAGGGAAGGTGAGG - Intergenic
1118589882 14:67393236-67393258 ATGCGACTACATGGAAGGGAAGG + Exonic
1118822147 14:69352595-69352617 ATTGGGCAGCATGGATGGAGAGG + Intronic
1121245349 14:92457964-92457986 ATGCGGAAGCATGAAAGCAGGGG - Intronic
1121701648 14:95959195-95959217 ATGGAGGTGAATGGAAGGAGAGG + Intergenic
1122642674 14:103169657-103169679 ATGCCGCTACCTGGAAAGAGAGG + Intergenic
1123016348 14:105377370-105377392 CTGTGGCTGGATGGGAGGAGGGG + Intronic
1124689033 15:31806523-31806545 AGGGGTCTGCATGGAAGGATGGG - Intronic
1125389193 15:39173153-39173175 GTGTGCCTGCAGGGAAGGAGGGG + Intergenic
1126362380 15:47859801-47859823 ATGCATCTGAATGGATGGAGAGG - Intergenic
1127001884 15:54518456-54518478 ATGCCCCAGCAAGGAAGGAGAGG + Intronic
1127829846 15:62740757-62740779 CTGCAGCTGCAAGGTAGGAGTGG + Exonic
1128515093 15:68337140-68337162 CTGGGCCTGCTTGGAAGGAGGGG + Intronic
1128585769 15:68848990-68849012 GTGTGGATGCATGGGAGGAGAGG + Intronic
1129890572 15:79069060-79069082 GTGAGGCTCCAAGGAAGGAGGGG - Intronic
1134070424 16:11256612-11256634 ATCTGGCTGCAGGGGAGGAGAGG - Intronic
1135404224 16:22186704-22186726 CTGCTGCTGCAGGGAAGGAGGGG - Exonic
1136270844 16:29147382-29147404 GAGCAGCTGCATGGAAGGACTGG + Intergenic
1137436213 16:48455923-48455945 ATGTGCCTGCAGGGAAGGAAAGG - Intergenic
1139986663 16:70904161-70904183 GTGTGGCTGCATGGAGGCAGTGG + Intronic
1140242427 16:73215337-73215359 ATGGGCCTGCATGGAAGGGGTGG - Intergenic
1142283018 16:89159403-89159425 AGGCGGGTGCACGGAAGGGGTGG + Intergenic
1146473036 17:33139644-33139666 ATGCTGCTGCAGGGAATGAAGGG - Intronic
1148096906 17:45058753-45058775 TTGCAGCTGCAGGGAAGGGGGGG - Intronic
1150288220 17:63966037-63966059 AAGAGGCTGCAGGGATGGAGGGG + Intronic
1151265548 17:72952477-72952499 ATGGGGCTCCATGGCAGCAGGGG - Intronic
1151591605 17:75047760-75047782 ATGCCTCAGCATGGAAGAAGGGG - Intronic
1151734313 17:75929474-75929496 GTGCTGCTGGCTGGAAGGAGAGG + Intronic
1152216547 17:79035986-79036008 ATGCGGATGCATGAGAGGAAAGG + Intronic
1152740697 17:82017117-82017139 CTGCGGCTGGGTGGAAGGTGGGG + Intronic
1153934034 18:9904901-9904923 CAGAGGCTGCAGGGAAGGAGAGG - Intergenic
1157579579 18:48765534-48765556 AGCCGGCAGCATGGAGGGAGAGG + Intronic
1159973197 18:74678404-74678426 ATGTGGGGGCCTGGAAGGAGAGG - Intronic
1161227757 19:3155052-3155074 CTGAGGATGCATGGGAGGAGTGG + Intronic
1161395761 19:4044135-4044157 GGGCGGCTGCAGGGAAGGTGGGG - Intergenic
1163103434 19:15110356-15110378 ATGCGGCTGCAGGGGAGGAGGGG + Intronic
1164766934 19:30779423-30779445 ATACGAATGCAGGGAAGGAGAGG - Intergenic
1165950052 19:39469250-39469272 CTGCCCCTGCAGGGAAGGAGCGG + Exonic
1166271671 19:41718192-41718214 TAGAGGCTGCATGGCAGGAGAGG - Exonic
1166381348 19:42356846-42356868 ATGCGGCTGCATGGAAGGAGCGG - Exonic
925118408 2:1399063-1399085 ATGCACCTGCAGGGAAGGTGGGG - Intronic
925310328 2:2877237-2877259 ATCCGGCTGCCTTCAAGGAGAGG + Intergenic
926174759 2:10580794-10580816 ATCCCGCTGCATGGAAGGGGCGG + Intronic
927645508 2:24874561-24874583 AGGAGGCTGGAGGGAAGGAGAGG - Intronic
929587876 2:43127381-43127403 AGGCGGCTGGATGGATGGTGAGG + Intergenic
930093771 2:47551263-47551285 ATGTGGCTGCCTGGAGGAAGAGG - Intronic
932772704 2:74509944-74509966 AGGTGGCTGCAGGGAAGCAGGGG + Intergenic
935858933 2:107306028-107306050 ATTCTGCTGCCAGGAAGGAGTGG + Intergenic
939588499 2:144033948-144033970 GTGGGGCTGCATGGGATGAGTGG + Intronic
941832943 2:169982269-169982291 TTGTGGCTGAATGGAAGGATGGG - Intronic
941921320 2:170853787-170853809 ACTAGGCTGCTTGGAAGGAGGGG - Intronic
942397524 2:175567584-175567606 ATGCCAATGCATGGGAGGAGGGG - Intergenic
944721291 2:202425294-202425316 GTGCTGCTGCATGGTTGGAGAGG + Intronic
947141363 2:227022062-227022084 ATGGGGCTCCCTGGAATGAGAGG - Exonic
947641067 2:231708140-231708162 CCGCGGCTGCTCGGAAGGAGGGG - Intronic
947905751 2:233760741-233760763 ATGGGGCTGCAAGGAAGGAAAGG - Exonic
948922456 2:241072053-241072075 ATGCACCTCCATGGCAGGAGGGG + Intronic
1168989902 20:2086174-2086196 ATGGGGCTGCAGTGATGGAGTGG + Intergenic
1171011863 20:21513354-21513376 CTGCGGCTGCAGGAATGGAGGGG + Intronic
1172205365 20:33159500-33159522 ATGGGACTGCATGGATGGACTGG + Intergenic
1173859600 20:46274222-46274244 ATTGGGCAGCATGGAGGGAGGGG + Intronic
1174920183 20:54693718-54693740 ATGAAGCTGCAAGGAATGAGAGG - Intergenic
1182301163 22:29337875-29337897 CTGCGTCTGCAGGGAAGGGGTGG - Intronic
1183352316 22:37341175-37341197 ATGTGGCAGCATGGGAGGGGAGG + Intergenic
1184103549 22:42354275-42354297 ATGTGGCTGCAGGGAAGTGGCGG - Intergenic
1185179340 22:49350192-49350214 CTGTGGCTCCATGGAAGGAACGG + Intergenic
956314471 3:67918919-67918941 ATATGGCTGCTTGGAAGCAGAGG - Intergenic
959186430 3:103052751-103052773 ATGCAGCTGTCTGGAAAGAGAGG - Intergenic
960322674 3:116255706-116255728 ATGCTGGTGAATGTAAGGAGGGG + Intronic
961156488 3:124684127-124684149 AAGGGGCTGCAGGGATGGAGAGG - Intronic
962609525 3:137062733-137062755 ATGCTGCTCCAGGGAAAGAGTGG - Intergenic
964808982 3:160642075-160642097 CTGCTGCTGGATGGGAGGAGAGG - Intergenic
968615070 4:1574021-1574043 GTGTGGCTGCTGGGAAGGAGGGG - Intergenic
968658575 4:1789386-1789408 ATGAGGCTGAGTGGAAGGACAGG - Intergenic
971525558 4:27613586-27613608 ATGAGGCAGCATGACAGGAGTGG - Intergenic
972229989 4:37061255-37061277 AAGAGGCTGCATGGAATCAGTGG - Intergenic
972427278 4:38945366-38945388 ATGCAGCTGCAATGAAGGCGTGG - Exonic
979829883 4:125286084-125286106 ATGTGACTTCATGAAAGGAGAGG - Intergenic
985096759 4:186420513-186420535 ATGGGGCTGCCTGGAAGCTGCGG + Intergenic
985749647 5:1667070-1667092 CAGCGGCTGCAGGGAAGGGGCGG + Intergenic
993647269 5:90476147-90476169 ATAAGCCTTCATGGAAGGAGAGG + Intronic
996636969 5:125703736-125703758 ATGCTGCTCCAGGGAAGGAATGG - Intergenic
997456234 5:134019628-134019650 ATGTTGCTGCCTGGAAGGATAGG - Intergenic
999316476 5:150587396-150587418 ATGTGGATGCATGGATGGATGGG + Intergenic
1000957296 5:167558464-167558486 ACCCGGCTGCATGGCAGGAGTGG + Intronic
1001961930 5:175884657-175884679 AAGAGGGTGCATGGAAGGAGAGG - Intergenic
1003090540 6:3098777-3098799 ATTGGGGTGCAAGGAAGGAGTGG + Intronic
1003315016 6:5004069-5004091 ATGCGGCCGGAGGGAAGGGGCGG - Intergenic
1004892821 6:20117776-20117798 TTGCAGCTGAATGGGAGGAGGGG - Intronic
1006186005 6:32182120-32182142 GTGTGGGTGCATGGAGGGAGAGG + Intronic
1006948255 6:37800100-37800122 ATGAGGGTGCATAGGAGGAGTGG - Intergenic
1008465649 6:51827609-51827631 AGGTGGCTTCATGGAAGAAGAGG - Intronic
1008742245 6:54623471-54623493 TTGCGACTTCAGGGAAGGAGAGG + Intergenic
1012153181 6:95781624-95781646 ATGAGGCTGAATGGATGAAGGGG + Intergenic
1015023048 6:128500183-128500205 ATCAGGCTGCAGTGAAGGAGTGG + Intronic
1017944750 6:159086379-159086401 CTGGGGCTGCATGTGAGGAGAGG - Intergenic
1017987853 6:159460352-159460374 AAGGGACTGCGTGGAAGGAGTGG + Intergenic
1019542597 7:1558303-1558325 ATGCAGCTGGATGGAAGTTGGGG - Intronic
1019606313 7:1911959-1911981 ATGCAGCTGCAGGGCAGAAGTGG + Intronic
1021467127 7:20956950-20956972 ATGCTGCTGGAAGGTAGGAGAGG + Intergenic
1022529407 7:31057670-31057692 AAGCTGCTGCAGGGAAGGAGGGG - Intronic
1022780925 7:33582340-33582362 ATGGGGCTGCTTGGAAGGGGTGG + Intronic
1024563300 7:50662187-50662209 AGGCTGGTGCATGGCAGGAGGGG + Intronic
1028878741 7:95854778-95854800 ATGCTGCTGCATGATTGGAGAGG + Intronic
1033806145 7:144956111-144956133 ATTCTGCTGCATAGATGGAGGGG - Intergenic
1035098250 7:156374454-156374476 AACCGCCTGCATGCAAGGAGTGG + Intergenic
1035946522 8:3969404-3969426 AGGCTGCTGCATGGAAGAGGAGG - Intronic
1036739761 8:11349194-11349216 CTGAGGCTGGAAGGAAGGAGCGG + Intergenic
1039459134 8:37728792-37728814 GTGTGTCTGCATGGAAGCAGAGG - Intergenic
1041654057 8:60330887-60330909 ATGTGGATGGATAGAAGGAGTGG - Intergenic
1045019935 8:98033429-98033451 ATCTGGCTGCATGGAAAAAGTGG + Intronic
1049460113 8:142723059-142723081 ATGCAGCTGTCTGGAAAGAGAGG + Intergenic
1049606874 8:143533655-143533677 TGGCGGCTGCATGGAGTGAGAGG - Intronic
1049929883 9:446167-446189 AAGGGGCTGCAAGGAGGGAGAGG - Intronic
1051602309 9:18887818-18887840 ATGGGGCAGCCTAGAAGGAGAGG - Exonic
1053052839 9:34976241-34976263 GTGGTGCTGCATGGATGGAGAGG + Intronic
1053492059 9:38515125-38515147 TTGCTGCTGCATGGTGGGAGAGG + Intergenic
1055794193 9:79956682-79956704 ATGCTGCTGCATAGAGAGAGAGG + Intergenic
1058768307 9:108205255-108205277 ATGCCACTGCAAGGAAAGAGAGG + Intergenic
1060276693 9:122187928-122187950 ATTCTGCTGCATGGAAGGGAAGG + Intronic
1061741398 9:132708853-132708875 ATGAAGCTGCAAGCAAGGAGGGG - Intergenic
1062615470 9:137394097-137394119 AAGCGGCGGCTGGGAAGGAGTGG - Intronic
1188275939 X:28200294-28200316 GTGAGGCTGCATGGAAGAAAAGG - Intergenic
1189404205 X:40704407-40704429 ATGCAGGTGCTCGGAAGGAGAGG + Intronic
1199897459 X:152138070-152138092 ATGCGGCTTCAGGGGAGCAGAGG - Intronic