ID: 1166381349

View in Genome Browser
Species Human (GRCh38)
Location 19:42356851-42356873
Sequence CACATATGCGGCTGCATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166381349_1166381353 -9 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381353 19:42356865-42356887 GCATATGTGCCCGCTGGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1166381349_1166381359 10 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381359 19:42356884-42356906 GTGGTGCCATGTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 24
4: 138
1166381349_1166381361 12 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381361 19:42356886-42356908 GGTGCCATGTATCTGCTGGGGGG 0: 1
1: 0
2: 2
3: 12
4: 150
1166381349_1166381357 8 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG 0: 1
1: 0
2: 1
3: 12
4: 78
1166381349_1166381364 27 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381364 19:42356901-42356923 CTGGGGGGACTTACCGCTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1166381349_1166381363 24 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381363 19:42356898-42356920 CTGCTGGGGGGACTTACCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 58
1166381349_1166381360 11 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381360 19:42356885-42356907 TGGTGCCATGTATCTGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 161
1166381349_1166381358 9 Left 1166381349 19:42356851-42356873 CCTTCCATGCAGCCGCATATGTG 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1166381358 19:42356883-42356905 CGTGGTGCCATGTATCTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166381349 Original CRISPR CACATATGCGGCTGCATGGA AGG (reversed) Exonic
902962893 1:19977263-19977285 TGGATATGTGGCTGCATGGATGG - Intronic
915609244 1:156977988-156978010 CTCATATGCATTTGCATGGAAGG + Intronic
915796060 1:158734828-158734850 CATATTTGAGGCTGCATGGGTGG - Intergenic
923508772 1:234630841-234630863 CAGATTTTCGACTGCATGGAGGG - Intergenic
1065653290 10:27916838-27916860 CAGATTTTCGACTGCATGGAGGG + Intronic
1068321658 10:55426480-55426502 CACAGATGCTGCTGCAGGGCTGG - Intronic
1072783401 10:98265111-98265133 CATATCTGTGGTTGCATGGATGG + Intronic
1079009234 11:16814814-16814836 CACATATGCGTCAGCCTGGAGGG - Intronic
1082805795 11:57449128-57449150 CACATATGCCAATGCATGCATGG - Intergenic
1086968289 11:93052986-93053008 CACATTAGGGGCTGAATGGATGG + Intergenic
1087265284 11:96053890-96053912 CACATATATGGCTGAAAGGAGGG - Intronic
1087918530 11:103838277-103838299 GTCCTTTGCGGCTGCATGGATGG + Intergenic
1091453833 12:590570-590592 CACAGATGCAGCTGCCTGGTGGG + Intronic
1094006659 12:25760466-25760488 TATATATGCAACTGCATGGATGG + Intergenic
1097578143 12:61420458-61420480 CAGATATCCGGCTGCATGCTGGG + Intergenic
1099835204 12:87901703-87901725 CACAAATCCGTCTGCAAGGAAGG + Intergenic
1104224877 12:126821894-126821916 CACATAGGTGGATGCATGGATGG - Intergenic
1106742890 13:32665846-32665868 GTCATTTGCGGCAGCATGGATGG + Intronic
1128693453 15:69742990-69743012 CATATGTGTGCCTGCATGGAAGG - Intergenic
1131423582 15:92327233-92327255 GAACTATGCTGCTGCATGGAGGG - Intergenic
1133136871 16:3718137-3718159 CAAATATGAGTGTGCATGGAGGG + Intergenic
1136550537 16:30980243-30980265 CACAGATGCAGGTGCCTGGAGGG - Intronic
1136774864 16:32866596-32866618 CAGATTTGAGGCTGCATGTAAGG - Intergenic
1137562779 16:49513624-49513646 CACATATGGGGATGGATGGATGG + Intronic
1138130144 16:54472378-54472400 GACCTGTGCGGTTGCATGGAAGG + Intergenic
1142101489 16:88274135-88274157 GACACATGCTACTGCATGGACGG + Intergenic
1203077286 16_KI270728v1_random:1128711-1128733 CAGATTTGAGGCTGCATGTAAGG - Intergenic
1143975303 17:10825059-10825081 AACATTCCCGGCTGCATGGAGGG + Exonic
1153859207 18:9183141-9183163 CAGATATGGGGTTGCCTGGAGGG - Intronic
1157764007 18:50284091-50284113 CGTAGATGCGGCTGCAGGGAAGG + Exonic
1164517438 19:28948278-28948300 AACATATGCAGCTGCACGGATGG + Intergenic
1166006788 19:39913735-39913757 CACCTATGCTGCTGCATGCCAGG - Exonic
1166381349 19:42356851-42356873 CACATATGCGGCTGCATGGAAGG - Exonic
1166687718 19:44805975-44805997 TACACCTGCGGCCGCATGGATGG + Intergenic
926289137 2:11514974-11514996 CACATGCGCGGATGGATGGATGG - Intergenic
928257619 2:29737834-29737856 AACACATGTGCCTGCATGGAGGG + Intronic
928261604 2:29772470-29772492 CACATATGCAGATGCAGGGGTGG + Intronic
928307929 2:30186351-30186373 CCCATATGAGTCTGCATGTACGG + Intergenic
929628495 2:43434551-43434573 CACACAAGCGGCTGGATGGCAGG + Intronic
929649849 2:43667625-43667647 AACATATGCTACAGCATGGATGG + Intronic
930402290 2:50905517-50905539 CACAAATGTGGCTGCAAGGGAGG - Intronic
930752002 2:54943329-54943351 CACAGATGAGGGAGCATGGATGG - Intronic
931436040 2:62247621-62247643 AACATTTGCGGCAACATGGATGG - Intergenic
933325278 2:80827727-80827749 CACATAAGCGTCTTCATGGGGGG + Intergenic
940804907 2:158175737-158175759 GACATAAGCGGATGAATGGATGG + Intronic
946335273 2:219031537-219031559 CACATGGGCAGCTGCAGGGATGG + Exonic
946414063 2:219530587-219530609 CAGACATGTGGATGCATGGACGG + Intronic
948141024 2:235671443-235671465 CACAGGTGCGGCTGCCTGGATGG + Intronic
948878118 2:240840961-240840983 CACCTATGTGGCTGCACTGATGG - Intergenic
1169333151 20:4732280-4732302 CACCTAGGTGTCTGCATGGAAGG - Exonic
1171355141 20:24538406-24538428 CACATAGGCCACAGCATGGATGG - Intronic
1173449024 20:43145983-43146005 CAAATATTCAGCTGCAAGGAGGG + Intronic
1175245039 20:57577113-57577135 CACATACACAGCTGGATGGATGG + Intergenic
1176274219 20:64254741-64254763 CACATATGAGGCGGCTTGCATGG + Intergenic
1177452680 21:21291725-21291747 CAAATATGCGGCAACATGGGTGG - Intronic
1182785247 22:32902119-32902141 CACCTAGGGGGCTGCCTGGAAGG - Intronic
1184281825 22:43441821-43441843 CTCATTTGCCACTGCATGGAAGG + Intronic
1184803442 22:46776430-46776452 CACAGCTGCGGCTGCGTGGTGGG + Intronic
1185392236 22:50568784-50568806 CACACATGCCCCTGCATGGGAGG + Intergenic
953566017 3:44032711-44032733 CACATCTGTGGCTGCAGGCAGGG - Intergenic
953881384 3:46693160-46693182 GACATATGCGACAGCAGGGAGGG - Intronic
957755761 3:84484875-84484897 CACGGATGAGACTGCATGGATGG - Intergenic
961777783 3:129302057-129302079 CACAGAAGAGACTGCATGGAAGG - Exonic
962124244 3:132598707-132598729 GACAGATGCTGCTGCATGGTGGG + Intronic
963044501 3:141092823-141092845 CACCTGTGCTGCTGCAAGGAGGG + Intronic
964518823 3:157542292-157542314 CTTATATGCGGAAGCATGGAAGG + Intergenic
967637157 3:191816245-191816267 GACATATGCTGTAGCATGGATGG + Intergenic
976208418 4:82643410-82643432 CATATATGCTGCAACATGGATGG + Intronic
976658675 4:87516555-87516577 CACAGATGGGAGTGCATGGATGG - Intronic
978071989 4:104484818-104484840 AACATATGATGCTGAATGGAGGG + Intronic
980193855 4:129562030-129562052 GACATATGCTGCTCCGTGGATGG - Intergenic
991404152 5:66285431-66285453 CTCATATGGGGCTCCTTGGAGGG + Intergenic
996701249 5:126452215-126452237 CACATTTGCTGTTTCATGGATGG + Intronic
997064413 5:130544919-130544941 CACCTTTCCGGCTGGATGGAAGG - Intergenic
999654949 5:153802269-153802291 AAAATATGCTGCTGCTTGGATGG + Intronic
1012223757 6:96682251-96682273 CACATATGTTGCTGAATAGATGG - Intergenic
1016888242 6:148979591-148979613 CACATTTGTAGCTGAATGGATGG - Intronic
1020138519 7:5599484-5599506 CAGATGTGGGGCTGCATGGTTGG + Intronic
1021553252 7:21894375-21894397 CAGATTTGGGGCTCCATGGAAGG + Intronic
1022990120 7:35698521-35698543 TAAATAGGCAGCTGCATGGACGG - Intergenic
1026916923 7:74125889-74125911 CACATATGAGGGTTCTTGGAAGG - Intergenic
1029449085 7:100630903-100630925 AACATCTTCGGCTGCATCGAAGG - Exonic
1040698777 8:50035806-50035828 CACAAATCCGACAGCATGGAGGG + Intronic
1046184078 8:110690350-110690372 CACACCTGCAGCTGCATGGCCGG + Intergenic
1047298078 8:123588774-123588796 GACATCTGTGGCTCCATGGATGG + Intergenic
1047906025 8:129474147-129474169 CACACCTGCAGCTGCATGGCTGG - Intergenic
1051094553 9:13451331-13451353 CAGATGTGCAGCTTCATGGAAGG - Intergenic
1056126551 9:83540155-83540177 CACATATGAGGTGGCAGGGATGG + Intergenic
1060886393 9:127155463-127155485 CACATCAGGGGCTGCATGGAGGG + Intronic
1061418957 9:130463010-130463032 CACTAAAGGGGCTGCATGGAGGG + Intronic
1061957365 9:133970568-133970590 CACATGTGGGGCTGCAGAGATGG + Intronic
1061958628 9:133976793-133976815 CAGATATTCTACTGCATGGACGG + Intronic
1187756471 X:22532724-22532746 CTGATTTGGGGCTGCATGGAAGG - Intergenic
1197871441 X:131066085-131066107 CTCAGATGAGGCTGCTTGGAAGG + Intronic
1198813106 X:140556403-140556425 CATCTATGCTACTGCATGGATGG + Intergenic